Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3761-3766, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cloning, Expression, and Purification of the K5
Capsular Polysaccharide Lyase (KflA) from Coliphage K5A: Evidence
for Two Distinct K5 Lyase Enzymes
Bradley R.
Clarke,
Fred
Esumeh,
and
Ian S.
Roberts*
School of Biological Sciences, University of
Manchester, Manchester M13 9PT, United Kingdom
Received 3 February 2000/Accepted 17 April 2000
 |
ABSTRACT |
The Escherichia coli K5 capsular polysaccharide
[-4)-
GlcA-(1,4)-
GlcNAc-(1-] is a receptor for the
capsule-specific bacteriophage K5A. Associated with the structure of
bacteriophage K5A is a polysaccharide lyase which degrades the K5
capsule to expose the underlying bacterial cell surface. The
bacteriophage K5A lyase gene (kflA) was cloned and
sequenced. The kflA gene encodes a polypeptide with a
predicted molecular mass of 66.9 kDa and which exhibits amino acid
homology with ElmA, a K5 polysaccharide lyase encoded on the chromosome of E. coli SEBR 3282. There was only limited nucleotide
homology between the kflA and elmA genes,
suggesting that these two genes are distinct and either have been
derived from separate progenitors or have diverged from a common
progenitor for a considerable length of time. Southern blot analysis
revealed that kflA was not present on the chromosome of the
E. coli strains examined. In contrast, elmA was
present in a subset of E. coli strains. Homology was observed between DNA flanking the kflA gene of
bacteriophage K5A and DNA flanking a small open reading frame
(ORFL) located 5' of the endosialidase gene of the E. coli K1 capsule-specific bacteriophage K1E. The DNA homology
between these noncoding sequences indicated that bacteriophages K5A and
K1E were related. The deduced polypeptide sequence of ORFL
in bacteriophage K1E exhibited homology to the N terminus of KflA from
bacteriophage K5A, suggesting that ORFL is a truncated
remnant of KflA. The presence of this truncated kflA gene
implies that bacteriophage K1E has evolved from bacteriophage K5A by
acquisition of the endosialidase gene and subsequent loss of functional
kflA. A (His)6-KflA fusion protein was
overexpressed in E. coli and purified to homogeneity with a
yield of 4.8 mg per liter of bacterial culture. The recombinant enzyme
was active over a broad pH range and NaCl concentration and was capable
of degrading K5 polysaccharide into a low-molecular-weight product.
 |
INTRODUCTION |
At least 80 distinct capsular
polysaccharides (K antigens) have been described previously for
Escherichia coli (26). Expression of a
polysaccharide capsule on the cell surface confers resistance to host
immune defenses and other adverse environmental conditions (3,
29). In addition, many of these structurally distinct capsules
act as receptors for bacteriophages, and variation of capsular
structure may be a mechanism for evasion of bacteriophage infection.
Due to their specificity, capsule-specific bacteriophages can be used
for identification of numerous E. coli K serotypes. Integral
to the tail structure of many capsule-specific bacteriophages are
enzymes which degrade the bacterial polysaccharide and provide the
bacteriophages access to receptors on the cell surface (5, 32-35).
The E. coli K5 capsular polysaccharide is a polymer of
-4)-
GlcA-(1,4)-
GlcNAc-(1- (40). This structure is
identical to N-acetylheparosan, the precursor polymer of
heparin and heparan sulfate (17). Coliphage K5A, a
bacteriophage specific for E. coli K5 capsule-expressing
strains, has been previously described (9). This
bacteriophage contains a lyase which degrades the K5 polysaccharide
randomly throughout the polymer by a
elimination reaction. The
final reaction products of this bacteriophage lyase consist of hexa-,
octa-, and decasaccharides (8, 12). In addition to the
bacteriophage-borne K5 lyase, a chromosomally encoded K5 lyase enzyme
has been described for E. coli SEBR 3282 (16).
The chromosomal gene (elmA) has been cloned and expressed in
E. coli K-12 and has been shown to produce final reaction
products with higher molecular weights than those of products observed for the bacteriophage lyase (12, 16).
In this communication, we report the cloning and analysis of the
bacteriophage K5A lyase gene and describe the expression, purification,
and characterization of the recombinant enzyme. We show that the
bacteriophage K5A lyase gene is not found on the chromosome of E. coli K5 strains, whereas elmA is present on the
chromosome of some strains. The difference in the distribution of the
bacteriophage K5A lyase gene and elmA and lack of any shared nucleotide homology indicate that these two genes are distinct variants. These genes either have diverged extensively throughout the
evolution of E. coli or have convergently evolved from
separate ancestral genes. Additionally, we provide evidence indicating that bacteriophage K5A is likely to be the progenitor to the E. coli K1 capsule-specific bacteriophage K1E.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and culture conditions.
E.
coli K-12 SURE {e14
mcrA
(mcrCB-hsdSMR-mrr)171 endA1 supE44 thi-1 gyrA96
relA1 lac recB recJ sbcC umuC::Tn5 uvrC
[F' proAB lacIq Z
M15
Tn10]} was obtained from Stratagene, and E. coli K-12 TOP10 ([F
mcrA
(mcrCB-hsdSMR-mrr)
80lacZ
M15
lacX74 deoR recA1 araD139
(araA-leu)7697 galU galK rpsL endA1 nupG])
was obtained from Invitrogen. E. coli K5 wild-type strains
were obtained from K. Jann, Max Planck Institut für
Immunbiologie, Freiburg, Germany. Plasmids used in this study were
pTTQ18 (31) and pBAD/HisB (Invitrogen). Bacteria were
routinely grown at 37°C in Luria-Bertani (LB) medium supplemented
with 100 µg of ampicillin per ml when required. Bacteriophage K5A was
propagated using E. coli Bi8337-41 as a host in LB medium containing 0.2% D-glucose and 10 mM MgCl2.
DNA methods.
Bacteriophage DNA was purified by the procedure
described for bacteriophage lambda (30). Recombinant DNA
techniques were performed according to standard procedures
(30). Restriction and modifying enzymes were purchased from
Boehringer, Mannheim, Germany. Double-stranded DNA sequencing was
performed with custom oligonucleotide primers using the ABI PRISM
BigDye Terminator cycle sequencing kit together with an Applied
Biosystems automated DNA sequencer.
To construct the (His)6-KflA fusion protein, the
kflA gene was amplified from pBL4 by PCR using
Pfu DNA polymerase. Two primers, 5'AGGAAGATCTATGGCTAAATTAACCAAACCT3' and
5'TGCCGAATTCTTACTTAGGAAGGGCAGCTAG3', were constructed
incorporating BglII and EcoRI restriction sites into the 5' and 3' ends of the kflA gene, respectively. The
amplification product was ligated into
BglII-EcoRI-digested pBAD/HisB to position kflA in frame with the N-terminal (His)6 fusion
tag of the vector.
The nucleotide sequences of the
kflA and
elmA
genes were compared using the BLAST 2 program, which aligns two given
nucleotide
sequences (
37).
Small-scale recombinant protein expression and preparation of
cell lysates.
The bacteriophage genomic library was screened for
lyase activity by assaying lysates from pools of 10 recombinant clones in E. coli SURE. Individual clones were then screened from
the pools showing lyase activity. E. coli SURE cells (10 ml)
containing the genomic fragments in pTTQ18 were grown to an optical
density at 600 nm (OD600) of 0.6 at 37°C with shaking at
200 rpm and then induced by addition of 1 mM IPTG
(isopropyl-
-D-thiogalactopyranoside). Incubation was
then continued for 1 h, and the cells were harvested at
5,000 × g for 10 min. The cells were washed once in
ice-cold 100 mM Tris-Cl (pH 7.5), resuspended in a 1/10 volume of the
same buffer, and then sonicated with five 30-s bursts separated by 1 min of cooling in ice water. The sonicates were clarified by centrifugation at 10,000 × g for 20 min.
Arabinose-dependent expression of the (His)
6-KflA fusion
protein was performed using
E. coli TOP10 as an expression
host.
This strain is able to import
L-arabinose but unable
to metabolize
this sugar. For small-scale expression of fusion protein
TOP10(pLYA100),
cultures were grown at 37°C at 200 rpm in 10 ml of LB
medium to
an OD
600 of 0.5.
L-Arabinose was then
added, and the cultures
were incubated for a further 2 h. One
milliliter of each culture
was harvested, and the pellets were
resuspended in lysis buffer
(100 µl of 125 mM Tris-Cl, 0.5%
[wt/vol] sodium dodecyl sulfate
[SDS], 5% [vol/vol] glycerol,
1.25% [vol/vol]

-mercaptoethanol,
0.05% [wt/vol] bromophenol
blue, pH 6.8) and boiled for 5 min.
These lysates (10 µl) were used
directly for SDS-polyacrylamide
gel electrophoresis
(PAGE).
Purification of K5 polysaccharide.
Bi8337-41 cells were
grown overnight in 500 ml of LB broth and harvested at 5,000 × g for 10 min. The pellet was washed once in 50 ml of
phosphate-buffered saline (pH 7.2), resuspended in 50 ml of extraction
buffer (50 mM Tris-Cl, 5 mM EDTA, pH 7.3), and incubated at 37°C for
30 min. The cells were pelleted by centrifugation and treated three
times further with extraction buffer. Polysaccharide was precipitated
from the pooled supernatants by addition of cetyl-3-ethyl ammonium
bromide (Na salt) to a final concentration of 0.1% (wt/vol) followed
by incubation at room temperature for 16 h. The precipitate was
recovered by centrifugation at 10,000 × g for 20 min
at 20°C, dissolved in 1 M NaCl, and precipitated again by addition of
ethanol to 80% (vol/vol). The precipitate was dissolved in 5 ml of
distilled water and dialyzed against distilled water. The solution was
centrifuged at 100,000 × g, and the supernatant
containing K5 polysaccharide was freeze-dried.
K5 polysaccharide lyase assays.
Polyacrylamide gel assays
were performed as previously described (27). Briefly, lysate
or purified fusion protein was incubated in 25 µl of 25 mM
Tris-acetate (pH 8.5) containing 20 µg of K5 polysaccharide for
1 h at 37°C. A 1/10 volume of 2 M sucrose-0.02% (wt/vol)
bromophenol blue in electrophoresis buffer (89 mM Tris, 89 mM boric
acid, 2 mM EDTA, pH 8.3) was added, and 20 µl of each reaction
mixture was loaded onto a polyacrylamide gel (25% acrylamide, 0.82%
bisacrylamide). Gels were pre-electrophoresed for 1 h at 12 V/cm,
and samples were electrophoresed at 6 V/cm. Gels were stained by the
combined alcian blue-silver staining method (24).
The spectrophotometric assay for lyase activity took advantage of the
4,5 bond formed due to cleavage of the K5 polysaccharide
by

elimination
(
2,
12). The
A232
was monitored as a function of time using
saturating concentrations of
K5 polysaccharide as substrate. The
reaction rate was expressed in
absorbance units (AU) per minute.
Typical reactions were performed at
37°C and contained 1 µg of
purified KflA fusion protein and 800 µg of K5 polysaccharide in
a 1-ml reaction mixture. The rate of
product formation was monitored
over 5 min. Buffer conditions were
varied according to the nature
of the specific
experiment.
Purification of the (His)6-KflA fusion protein.
E. coli TOP10(pLYA100) (500 ml) was grown in LB broth
supplemented with ampicillin at 37°C at 200 rpm. When the
OD600 reached 0.5, L-arabinose was added to a
concentration of 0.02% (wt/vol) and the culture was incubated for a
further 2 h. The bacteria were harvested at 4,000 × g for 10 min at 4°C. The pellet was washed in 200 ml of buffer A
(50 mM Tris-Cl, pH 8.5) and resuspended in 40 ml of ice-cold buffer A. The cell suspension was passed once through a French pressure cell
operated at 20,000 lb/in2. The resulting lysate was then
centrifuged at 100,000 × g for 1 h at 10°C.
The entire lysate was loaded on a 5-ml Pharmacia HiTrap Q column
(pre-equilibrated in buffer A) at 2 ml/min. This was followed
by
washing with 100 ml of buffer A at 5 ml/min. Elution was performed
over
150 ml with a linear 0 to 0.5 M NaCl gradient (in buffer
A). Fractions
(2 ml) were collected, and those containing the
most fusion protein, as
determined by SDS-PAGE and Western blotting
with

-Xpress antibody,
were
pooled.
The pooled solution from the anion-exchange chromatography was adjusted
to 500 mM NaCl and 0.1% (vol/vol) Triton X-100. This
was then loaded
at 3 ml/min onto a 5-ml Pharmacia HiTrap chelating
column (charged with
Ni
2+), and the column was washed with 100 ml of buffer B
(50 mM Tris-Cl,
500 mM NaCl, 0.1% [vol/vol] Triton X-100, pH 8.5).
Proteins were
eluted into 2-ml fractions at 5 ml/min with a linear 0 to
500
mM imidazole gradient (in buffer B) over 150 ml. Fractions judged
to contain the KflA fusion protein by SDS-PAGE and Western blotting
were pooled and concentrated in a Centriprep 30 concentrator (Amicon)
according to the manufacturer's instructions. The concentrated
eluant
was desalted in buffer C (50 mM Tris-Cl, 0.1% [vol/vol]
Triton
X-100, pH 8.0) using four 5-ml Pharmacia HiTrap desalting
columns
linked in a series. The desalted eluant was concentrated
as described
above to 5 ml and stored at 4°C.
Additional analytical methods.
SDS-PAGE was performed
according to the method of Laemmli (13), and Western
blotting was performed as described by Towbin et al. (38)
using the ECL detection kit (Amersham). Protein concentration was
estimated with the Bio-Rad protein assay kit using bovine gammaglobulin
as a protein standard.
Nucleotide sequence accession number.
The kflA
nucleotide sequence has been submitted to the GenBank database under
the accession no. Y10025.
 |
RESULTS AND DISCUSSION |
Cloning and nucleotide sequencing of the coliphage K5 lyase
gene.
A library of bacteriophage K5A DNA was constructed in the
expression vector pTTQ18 and transformed into E. coli SURE.
Lysates from 250 recombinants were screened for lyase activity by
overnight incubation with purified K5 polysaccharide followed by PAGE
of the reaction products. One clone, pBL4, exhibited detectable lyase activity (data not shown). Plasmid pBL4 contained a cloned fragment of
2.8 kb, and Southern blot analysis confirmed that the cloned DNA was
derived from the genome of bacteriophage K5A (data not shown).
The nucleotide sequence of the cloned DNA in pBL4 was determined. The
insert comprised 2,872 bp with a G+C content of 48%.
Two open reading
frames (ORFs) were identified in the opposite
orientation to the
tac promoter of pTTQ18 (Fig.
1). The largest
ORF (ORF
635)
was 1,905 bp and encoded a putative protein of 635
amino acids with a
predicted molecular mass of 66.9 kDa. A putative
ribosomal binding site
was identified 10 bp upstream of the ORF
635 translational
initiation codon. A BLAST search (
1) of the GenBank
peptide
database revealed 53% identity over 619 amino acids (68%
similarity)
between the ORF
635 polypeptide and ElmA, a chromosomally
encoded K5 polysaccharide lyase from
E. coli SEBR 3282 (O10:K5:H4)
(data not shown) (
16). This amino acid homology
indicates that
ORF
635 encodes the bacteriophage K5A lyase,
and therefore, this
gene was designated
kflA (K5 lyase).
Located 3' to
kflA was a
partial ORF (ORF
P)
encoding 147 amino acids (Fig.
1). ORF
P was
also preceded
by a putative ribosomal binding site. A BLAST search
of the GenBank
database failed to find any proteins with significant
homology to the
polypeptide encoded by ORF
P. The noncoding region
of the
cloned bacteriophage K5A DNA 5' to
kflA contained homology
to the consensus for SP6 bacteriophage promoters as described
previously for the K1E bacteriophage (
6,
22,
23). This
implies that
kflA is transcribed by a bacteriophage RNA
polymerase.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison between the cloned coliphage K5 DNA sequence
and that of bacteriophage K1E encoding the endosialidase gene. (A)
Arrows indicate ORFs and the direction of translation. ORFP
is translated in the same direction as the K5 polysaccharide lyase gene
(kflA). Regions of nucleotide homology between the two
bacteriophage sequences are depicted by similarly shaded boxes joined
by dotted lines. (B) A BLAST comparison showing homology between the N
termini of the deduced polypeptides encoded by ORFL and
kflA. Conservative amino acid changes are represented by
"+."
|
|
The kflA gene is distinct from elmA.
Comparison of the nucleotide sequences of kflA and
elmA using a pairwise BLAST2 alignment (36)
identified a short stretch of homology of 77% over 69 bases (data not
shown). The lack of extensive homology suggests that these two genes
are distinct and either have been derived from separate progenitors or
have diverged from a common progenitor for a considerable length of time. To determine if a chromosomal variant of kflA exists,
E. coli K5 wild-type isolates were analyzed by Southern blot
analysis using the kflA gene as a probe. No hybridization
was detected at low stringency among the strains examined (data not
shown). Therefore, it is apparent that KflA is not encoded on the
chromosome of E. coli strains and has evolved solely as a
phage-encoded enzyme distinct from elmA. Southern
hybridization of genomic DNA from the E. coli K5 wild-type
strains using the elmA gene as a probe at high stringency
revealed hybridization to a fragment of approximately 11.5 kb in 4 out
of 11 of these strains (Fig. 2).
Therefore, elmA is not present on the chromosome of all
E. coli K5 strains. Three of the E. coli strains
hybridized by the elmA probe (20026, 21786, and 21834) (Fig.
2, lanes 2, 5, and 9) have been shown to contain K5 lyase activity in
cell lysates and, in addition, produce shorter polymer on their
surfaces than those of other K5 strains (11). It is not
known whether the O15:K5 strain, which also hybridized to
elmA (Fig. 2, lane 8), exhibits intracellular lyase activity or low-molecular-weight polysaccharide. The correlation between K5
polymer size and the presence of elmA suggests that the
chromosomally encoded lyase may have a regulatory role in capsule
synthesis. The relationship between the presence of elmA in
E. coli and expression of low-molecular-weight K5 capsule
with the ecology and pathogenicity of such strains is unclear. It is
possible that ElmA may be encoded by a cryptic K5-specific
bacteriophage (distinct from K5A) which is present only in a subset of
K5 strains. A role for a chromosomally encoded ElmA lyase in control of
capsule size would be different from the role of the KflA enzyme, which
is utilized solely by bacteriophage K5A for recognition of E. coli cells expressing K5 capsule and subsequently to gain access
to the cell surface.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot showing hybridization of the
elmA gene with HindIII-digested genomic DNA
of various E. coli wild-type strains. Lane 1, Bi8337-41
(O10:K5:H4); lane 2, 20026 (O10:K5:H4); lane 3, 21831 (O86:K5:H10);
lane 4, 21835 (O1:K5:H1); lane 5, 21786 (O4:K5); lane 6, 21795 (O5:K5:H4); lane 7, 21195 (O6:K5); lane 8, 21832 (O15:K5); lane 9, 21834 (O117:K5); lane 10, 21830 (O25:K5:H1); lane 11, 21836 (O75:K5).
Strain designations refer to the Freiburg collection number. The
elmA probe was amplified by PCR from the chromosome of
strain 20026. The size of the restriction fragments that hybridized to
the probe is indicated on the right.
|
|
Coliphage K5 is the progenitor of bacteriophage K1E.
Analysis
of the 5' noncoding region of the cloned bacteriophage K5A nucleotide
sequence revealed that the first 437 nucleotides, up to the
kflA translation initiation codon, exhibited 88% identity with sequence 5' to a small ORF (ORFL) encoded by the
E. coli K1 capsule-specific bacteriophage K1E (Fig. 1A)
(6, 22). In bacteriophage K1E, ORFL is located
immediately 5' to an ORF encoding the endosialidase which degrades the
polysialic acid capsule of E. coli K1 (22). In
addition, the nucleotide sequence spanning 88 bp between the 3' end of
kflA and ORFP of bacteriophage K5A exhibited
95% identity with the intergenic region between ORFL and
the endosialidase gene (Fig. 1A). This nucleotide sequence homology
between noncoding regions of bacteriophage K5A and K1E indicates that
these two bacteriophages are related. It was also observed that the
first nine consecutive amino acids of the KflA and the ORFL
polypeptides were identical (Fig. 1B). The homology between these
polypeptides could be extended to 41% identity (60% similarity) over
the first 46 amino acids (Fig. 1B), although no homology was detected
between the remaining 66 C-terminal amino acids of the ORFL
polypeptide and sequences in KflA. Translation of ORFL has
not been demonstrated, and the function of this ORF is unknown
(22). However, the homology between the N termini of the
ORFL polypeptide and KflA suggests that the
ORFL may be a truncated remnant of kflA. Thus,
it appears that bacteriophage K1E is a derivative of bacteriophage K5A
in which the endosialidase gene was acquired by lateral transfer
followed by the subsequent loss of the kflA gene. No
homology was detected between the noncoding DNA 3' of the K1E
endosialidase gene and bacteriophage K5A sequence, and therefore, it is
not known if the endosialidase gene was inserted between
kflA and ORFP or whether the gene represented by
ORFP was replaced by the endosialidase gene. In addition,
it cannot be determined whether the endosialidase gene was acquired by
K1E before or after loss of the kflA gene.
Expression and purification of a (His)6-KflA fusion
protein.
The KflA lyase was overexpressed in E. coli
K-12 as a fusion protein containing an N-terminal (His)6
tag. The entire kflA gene was amplified by PCR and cloned
downstream of the araBAD promoter in the expression vector
pBAD/His. The resulting plasmid was designated pLYA100. Transcription
of kflA from the araBAD promoter is induced by
the presence of L-arabinose in a dose-dependent manner
(14, 15). Optimum expression of soluble KflA fusion protein
was obtained by induction at an L-arabinose concentration of 0.02% (wt/vol) (Fig. 3).

View larger version (118K):
[in this window]
[in a new window]
|
FIG. 3.
Coomassie blue-stained gel showing overexpression of the
(His)6-KflA fusion protein in E. coli TOP10.
Cells were induced with 0.02% (wt/vol) L-arabinose and
grown for 2 h following induction. Lane 1, molecular weight
markers (in thousands); lane 2, induced TOP10(pBAD/HisB); lane 3, induced TOP10(pLYA100); lane 4, purified (His)6-KflA. The
arrowhead indicates the purified KflA protein.
|
|
The (His)
6-KflA fusion protein was purified from 500 ml of
induced culture using a combination of anion-exchange chromatography
and immobilized metal (nickel) adsorption chromatography (IMAC).
The
majority of the KflA fusion protein was eluted from the ion-exchange
column at an NaCl concentration of between 160 and 200 mM (results
not
shown). This material was pooled and subjected to IMAC. A
protein,
migrating at 66 kDa in SDS-PAGE, was eluted from the
IMAC column at
between 170 and 245 mM imidazole. This fraction
was collected and shown
to contain lyase activity (Table
1).
The
total activity obtained in the pooled IMAC fraction was greater
than
that obtained after the ion-exchange stage. It is possible
that this
increase in activity was due to removal of an inhibiting
substance
during the IMAC stage. A similar observation was found
during the
purification of a glycosyltransferase involved in chondroitin
sulfate
biosynthesis (
39). After desalting and concentration,
the
KflA fusion protein was obtained at a 14-fold purification,
giving a
yield of 2.4 mg per 500 ml of original culture (Table
1). The fusion
protein was judged homogeneous by SDS-PAGE (Fig.
3). A minor band was
observed migrating slightly faster than the
KflA fusion protein on
SDS-PAGE (Fig.
3). However, this band became
more prominent after
prolonged storage at 4°C, and thus, the presence
of this band was a
result of degradation of the full-length fusion
protein (data not
shown).
Analysis of (His)6-KflA activity.
Cleavage of K5
polysaccharide with recombinant KflA was visualized by analyzing the
products of the lyase reaction by PAGE. Untreated K5 polysaccharide
preparations exhibit a wide range of molecular weights (Fig.
4, lane 1) as a result of varying levels of polymerization during biosynthesis. Incubation of K5 polysaccharide (800 µg/ml) with a dilution series of purified KflA fusion protein showed that at a high enzyme concentration (36 µg/ml) the
polysaccharide was degraded into a single low-molecular-weight product
(Fig. 4, lane 2). As the enzyme concentration was decreased from 9 to 2.25 µg/ml, the polysaccharide was not degraded to completion and
products of successively higher molecular weight were accumulated (Fig.
4, lanes 3 to 6). Since it has been previously shown that incubation of
bacteriophage K5A with K5 polysaccharide results in final reaction
products of hexa-, oct-, and decasaccharides (12), the
lowest-molecular-weight product observed following degradation with 36 µg of KflA per ml (Fig. 4, lane 2) is likely a hexasaccharide. Based
on the
elimination reaction, the two sequentially
higher-molecular-molecular weight bands (Fig. 4, lanes 4 to 7)
represent octa- and decasaccharides, respectively. It has been
suggested that cleavage of the K5 polysaccharide by the KflA lyase into
oligosaccharides smaller than three repeating units may not be possible
due to a minimum chain length required for substrate recognition and
cleavage (12).

View larger version (103K):
[in this window]
[in a new window]
|
FIG. 4.
PAGE of K5 polysaccharide digested for 1 h with
various concentrations of purified KflA lyase as described in Materials
and Methods. Lane 1, undigested K5 polysaccharide; lane 2, 36 µg of
KflA per ml; lane 3, 18 µg/ml; lane 4, 9 µg/ml; lane 5, 4.5 µg/ml; lane 6, 2.25 µg/ml; lane 7, 1.13 µg/ml; lane 8, 0.56 µg/ml; lane 9, 0.28 µg/ml; lane 10, 0.14 µg/ml.
|
|
Legoux et al. (
16) demonstrated that the ElmA lyase produces
final reaction products of 10 disaccharide units in length,
considerably longer than those produced by KflA. The significance
of
this difference in the sizes of the reaction products is as
yet
unclear.
The purified KflA lyase fusion protein was active over a broad pH range
(Fig.
5). Maximum activity was observed
at pH 8.5,
but activity diminished substantially as the pH was lowered
below
6.0 or raised above 9.0. Although significant activity was
observed
at pH 6.75 and 7.25, the activity was decreased at pH 7.0 (Fig.
5). The reason for the low activity at pH 7.0 is unclear.
However,
the theoretical pI of native KflA is 7.09 [7.25 for
(His)
6-KflA],
and it is possible that a lack of charge at
a pH approaching 7.0
may adversely affect KflA activity. The pH optimum
of 8.5 differs
markedly from an optimum of pH 5.5 found for the
bacteriophage
K1E endosialidase (
37). Both bacteriophage K5A
and K1E were
isolated from sewage (
7,
9), and presumably one
of their
natural habitats is the mammalian colon. The pH of the human
colon
ranges from 5.7 in the cecum to 6.7 in the rectum (
4),
and
therefore, the KflA enzyme would be active in this environment.
The
KflA fusion protein had no apparent requirement for divalent
cations,
and activity was not significantly affected by changes
in NaCl
concentration. The enzyme retained most of its activity
at an NaCl
concentration as high as 1 M (results not shown).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 5.
Effect of pH on KflA lyase activity. Lyase activity was
determined by monitoring the A232 over 5 min.
Reactions were performed using 1 µg of (His)6-KflA fusion
protein and 800 µg of K5 polysaccharide in each 1-ml reaction
mixture. Reactions were performed in 25 mM morpholineethanesulfonic
acid (MES) (pH 5.5 to 6.75)-25 mM HEPES (pH 7.0 to 8.0)-25 mM
Tris-acetate (pH 8.5 to 9.0).
|
|
The K5 polysaccharide substrate utilized by the KflA lyase is identical
to the precursor molecule of heparin and heparan sulfate
(
40). Synthesis of heparin and heparan sulfate involves N
deacetylation
and N sulfation of GlcNAc residues of
[-4)-

GlcA-(1,4)-

GlcNAc-(1-]
n polymers
followed by epimerization of GlcA residues to iduronic
acid and O
sulfation at various positions (
17). These modifications
are
not stoichiometric, and therefore, heterogeneity exists due
to the
degree of epimerization and sulfation. Generally, heparin
is more
extensively modified than heparan sulfate. Heparin lyases
produced by
Flavobacterium heparinum are enzymes that degrade
heparin
and heparan sulfate (
21). Three forms of heparin lyase
have
been purified and exhibit different specificities for heparin
and
heparan sulfate. Applications of these enzymes include structural
studies of heparin-like polymers (
18,
19), synthesis of
low-molecular-weight
therapeutic agents (
20), and
neutralization of heparin in blood.
These enzymes do not have amino
acid homology to KflA although
they exhibit high pH optima similar to
the bacteriophage enzyme
(
21). KflA recognizes heparan
sulfate as a substrate, cleaving
the polymer at regions devoid of
iduronic acid and sulfation (K.
Lidholt, personal communication). Thus,
it is possible that the
recombinant KflA lyase may be of use as a tool
for structural
studies of heparin and heparan sulfate and production of
low-molecular-weight,
highly modified heparin-like
oligosaccharides.
In conclusion, the gene encoding a bacteriophage lyase
(
kflA) specific for the
E. coli K5 capsular
polysaccharide has been
cloned and sequenced, and a His-tagged KflA
fusion protein has
been overexpressed and purified to homogeneity in an
active form.
The KflA lyase is not encoded on the
E. coli
chromosome, and
kflA is distinct from the
elmA
polysaccharide lyase gene which is present
on the chromosome of a
subset of
E. coli serotypes. Therefore,
these two genes are
distinct and either have been derived from
separate progenitors or have
diverged from a common progenitor
for a considerable length of time. In
addition, evidence has been
provided which suggests that bacteriophage
K5A is a progenitor
to the
E. coli K1 capsule-specific
bacteriophage
K1E.
 |
ACKNOWLEDGMENTS |
This work was supported by a grant from the Cell Factories
Initiative of Framework IV of the European Commission and from the
B.B.S.R.C. of the United Kingdom. I.S.R. gratefully acknowledges the
support of the Lister Institute of Preventive Medicine.
We thank M. Rolinni for her help with this project.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Biological Sciences, 1.800 Stopford Building, University of Manchester,
Manchester M13 9PT, United Kingdom. Phone: 44 161 275 5601. Fax: 44 161 275 5656. E-mail: ISRobert{at}fs1.scg.man.ac.uk.
Present address: Department of Microbiology, Edo State University,
Ekpoma, Nigeria.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. L. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Bernstein, H.,
V. C. Yang,
C. L. Cooney, and R. Langer.
1988.
Immobilized heparin lyase system for blood deheparinization.
Methods Enzymol.
137:515-529[Medline].
|
| 3.
|
Cross, A.
1990.
The biological significance of bacterial encapsulation.
Curr. Top. Microbiol. Immunol.
150:87-95[Medline].
|
| 4.
|
Fallingborg, J.
1999.
Intraluminal pH of the human gastrointestinal tract.
Dan. Med. Bull.
46:183-196[Medline].
|
| 5.
|
Fehmel, F.,
U. Feige,
H. Niemann, and S. Stirm.
1975.
Escherichia coli capsule bacteriophages. VII. Bacteriophage 29-host capsular polysaccharide interactions.
J. Virol.
16:591-601[Abstract/Free Full Text].
|
| 6.
|
Gerardy-Schann, R.,
A. Bethe,
T. Brennecke,
M. Mühlenhoff,
M. Eckhardt,
S. Ziesing,
F. Lottspeich, and M. Frosch.
1995.
Molecular cloning and functional expression of bacteriophage PK1E-encoded endoneuraminidase Endo NE.
Mol. Microbiol.
16:441-450[CrossRef][Medline].
|
| 7.
|
Gross, R. J.,
T. Cheasty, and B. Rowe.
1977.
Isolation of bacteriophages specific for the K1 polysaccharide antigen of Escherichia coli.
J. Clin. Microbiol.
6:548-550[Abstract/Free Full Text].
|
| 8.
|
Gupta, D. S.,
B. Jann, and K. Jann.
1983.
Enzymatic degradation of the capsular K5-antigen of E. coli by coliphage K5.
FEMS Microbiol. Lett.
16:13-17.
|
| 9.
|
Gupta, D. S.,
B. Jann,
G. Schmidt,
J. R. Golecki,
I. Ørskov,
F. Ørskov, and K. Jann.
1982.
Coliphage K5, specific for E. coli exhibiting the capsular K5 antigen.
FEMS Microbiol. Lett.
14:75-78.
|
| 10.
|
Hallenbeck, P. C.,
E. R. Vimr,
F. Yu,
B. Bassler, and F. A. Troy.
1987.
Purification and properties of a bacteriophage-induced endo-N-acetylneuraminidase specific for poly- -2,8-sialosyl carbohydrate units.
J. Biol. Chem.
262:3553-3561[Abstract/Free Full Text].
|
| 11.
|
Hanfling, P.
1995.
Ph.D. thesis.
Max Planck Institut für Immunbiologie, Freiburg, Germany.
|
| 12.
|
Hänfling, P.,
A. S. Shashkov,
B. Jann, and K. Jann.
1996.
Analysis of the enzymatic cleavage ( elimination) of the capsular K5 polysaccharide of Escherichia coli by the K5-specific coliphage: a reexamination.
J. Bacteriol.
178:4747-4750[Abstract/Free Full Text].
|
| 13.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[CrossRef][Medline].
|
| 14.
|
Lee, N.
1980.
Molecular aspects of ara regulation, p. 389-410.
In
J. H. Miller, and S. Reznikoff (ed.), The operon. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 15.
|
Lee, N.,
C. Francklyn, and E. P. Hamilton.
1987.
Arabinose-induced binding of AraC protein to araI2 activates the araBAD operon promoter.
Proc. Natl. Acad. Sci. USA
84:8814-8818[Abstract/Free Full Text].
|
| 16.
|
Legoux, R.,
P. Lelong,
C. Jourde,
C. Feuillerat,
J. Capdevielle,
V. Sure,
E. Ferran,
M. Kaghad,
B. Delpech,
D. Shire,
P. Ferrara,
G. Loison, and M. Salomé.
1996.
N-Acetyl-heparosan lyase of Escherichia coli K5: gene cloning and expression.
J. Bacteriol.
178:7260-7264[Abstract/Free Full Text].
|
| 17.
|
Lindahl, U.
1997.
Heparan sulfate a polyanion with multiple messages.
Pure Appl. Chem.
69:1897-1902[CrossRef].
|
| 18.
|
Linhardt, R. J.,
A. Al-Hakim,
J. Liu,
D. Hoppensteadt,
J. Fareed,
G. Mascellani, and P. Bianchini.
1991.
Structural features of dermatin sulfates and their relationship to anticoagulant and antithrombotic activities.
Biochem. Pharmacol.
42:1609-1619[CrossRef][Medline].
|
| 19.
|
Linhardt, R. J.,
S. A. Ampofo,
J. Fareed,
D. Hoppensteadt,
J. B. Mulliken, and J. Folkman.
1992.
Isolation and characterization of human heparin.
Biochemistry
31:12441-12445[CrossRef][Medline].
|
| 20.
|
Linhardt, R. J.,
K. G. Rice,
Y. S. Kim,
J. Engelken, and J. Weiler.
1988.
Homogeneous, structurally defined heparin-oligosaccharides with low anticoagulant activity inhibit the generation of the amplification pathway C3 convertase in vitro.
J. Biol. Chem.
263:13090-13096[Abstract/Free Full Text].
|
| 21.
|
Lohse, D. L., and R. J. Linhardt.
1992.
Purification and characterization of heparin lyases from Flavobacterium heparinum.
J. Biol. Chem.
267:24347-24355[Abstract/Free Full Text].
|
| 22.
|
Long, G. S.,
J. M. Bryant,
P. W. Taylor, and J. P. Luzio.
1995.
Complete nucleotide sequence of the gene encoding bacteriophage E endosialidase: implications for K1E endosialidase structure and function.
Biochem. J.
309:543-550.
|
| 23.
|
Melton, D. A.,
P. A. Kreig,
M. R. Rebagliati,
T. Maniatis,
K. Zinn, and M. R. Green.
1984.
Efficient in vitro synthesis of biologically-active RNA and RNA hybridization probes from plasmids containing a bacteriophage-SP6 promoter.
Nucleic Acids Res.
12:7035-7057[Abstract/Free Full Text].
|
| 24.
|
Min, H., and M. K. Cowman.
1986.
Combined alcian blue and silver staining of glycosaminoglycans in polyacrylamide gels: application to electrophoretic analysis of molecular weight distribution.
Anal. Biochem.
155:275-285[CrossRef][Medline].
|
| 25.
|
Moxon, E. R., and J. S. Kroll.
1990.
The role of bacterial polysaccharide capsules as virulence factors.
Curr. Top. Microbiol. Immunol.
150:65-85[Medline].
|
| 26.
|
Ørskov, F., and I. Ørskov.
1992.
Escherichia coli serotyping and disease in man and animals.
Can. J. Microbiol.
38:699-704[Medline].
|
| 27.
|
Pelkonen, S.,
J. Häyrinen, and J. Finne.
1988.
Polyacrylamide gel electrophoresis of capsular polysaccharide of Escherichia coli K1 and other bacteria.
J. Bacteriol.
170:2646-2653[Abstract/Free Full Text].
|
| 28.
|
Petter, J. G., and E. R. Vimr.
1993.
Complete nucleotide sequence of the bacteriophage K1F tail gene encoding endo-N-acylneuraminidase (Endo-N) and comparison to an Endo-N homolog in bacteriophage PK1E.
J. Bacteriol.
175:4354-4363[Abstract/Free Full Text].
|
| 29.
|
Roberts, I. S.
1996.
Bacterial capsules in sickness and in health.
Microbiology
141:2023-2031[Free Full Text].
|
| 30.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 31.
|
Stark, M. J. R.
1987.
Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in Escherichia coli.
Gene
51:255-267[CrossRef][Medline].
|
| 32.
|
Stirm, S.
1968.
Escherichia coli bacteriophages. I. Isolation and introductory characterization of five Escherichia coli K bacteriophages.
J. Virol.
2:1107-1114[Abstract/Free Full Text].
|
| 33.
|
Stirm, S.,
W. Bessler,
F. Fehmel, and E. Freund-Mölbert.
1971.
Bacteriophage particles with endo-glycosidase activity.
J. Virol.
8:343-346[Abstract/Free Full Text].
|
| 34.
|
Stirm, S., and E. Freund-Mölbert.
1971.
Escherichia coli capsule bacteriophages. II. Morphology.
J. Virol.
8:330-342[Abstract/Free Full Text].
|
| 35.
|
Sutherland, I. W.
1995.
Polysaccharide lyases.
FEMS Microbiol. Rev.
16:323-347[CrossRef][Medline].
|
| 36.
|
Tatusovia, T. A., and T. L. Madden.
1999.
Blast 2 sequences a new tool for comparing protein and nucleotide sequences.
FEMS Microbiol. Lett.
174:247-250[CrossRef][Medline].
|
| 37.
|
Tomlinson, S., and P. W. Taylor.
1985.
Neuraminidase associated with coliphage E that specifically depolymerizes the Escherichia coli K1 capsular polysaccharide.
J. Virol.
55:374-378[Abstract/Free Full Text].
|
| 38.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 39.
|
Tsuchida, K.,
T. Lind,
H. Kitagawa,
U. Lindahl,
K. Sugahara, and K. Lidholt.
1999.
Purification and characterization of fetal bovine serum -N-acetyl-D-galactosaminyltransferase and -D-glucuronyltransferase involved in chondroitin sulfate biosynthesis.
Eur. J. Biochem.
264:461-467[Medline].
|
| 40.
|
Vann, W. F.,
M. A. Schmidt,
B. Jann, and K. Jann.
1981.
The structure of the capsular polysaccharide (K5 antigen) of urinary-tract-infective Escherichia coli O10:K5:H4. A polymer similar to desulfo-heparin.
Eur. J. Biochem.
116:359-364[Medline].
|
Journal of Bacteriology, July 2000, p. 3761-3766, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hafez, M., Hayes, K., Goldrick, M., Warhurst, G., Grencis, R., Roberts, I. S.
(2009). The K5 Capsule of Escherichia coli Strain Nissle 1917 Is Important in Mediating Interactions with Intestinal Epithelial Cells and Chemokine Induction. Infect. Immun.
77: 2995-3003
[Abstract]
[Full Text]
-
Hudson, T., Goldrick, M., Roberts, I. S.
(2009). The Escherichia coli K5 Capsule Is Not Synthesized in a Protected Compartment within the Cytoplasm. J. Bacteriol.
191: 1716-1718
[Abstract]
[Full Text]
-
Schwarzer, D., Stummeyer, K., Gerardy-Schahn, R., Muhlenhoff, M.
(2007). Characterization of a Novel Intramolecular Chaperone Domain Conserved in Endosialidases and Other Bacteriophage Tail Spike and Fiber Proteins. J. Biol. Chem.
282: 2821-2831
[Abstract]
[Full Text]
-
Taylor, C. M., Goldrick, M., Lord, L., Roberts, I. S.
(2006). Mutations in the waaR Gene of Escherichia coli Which Disrupt Lipopolysaccharide Outer Core Biosynthesis Affect Cell Surface Retention of Group 2 Capsular Polysaccharides. J. Bacteriol.
188: 1165-1168
[Abstract]
[Full Text]
-
Chen, Z., Schneider, T. D.
(2005). Information theory based T7-like promoter models: classification of bacteriophages and differential evolution of promoters and their polymerases. Nucleic Acids Res
33: 6172-6187
[Abstract]
[Full Text]
-
Murphy, K. J., Merry, C. L. R., Lyon, M., Thompson, J. E., Roberts, I. S., Gallagher, J. T.
(2004). A New Model for the Domain Structure of Heparan Sulfate Based on the Novel Specificity of K5 Lyase. J. Biol. Chem.
279: 27239-27245
[Abstract]
[Full Text]
-
Muhlenhoff, M., Stummeyer, K., Grove, M., Sauerborn, M., Gerardy-Schahn, R.
(2003). Proteolytic Processing and Oligomerization of Bacteriophage-derived Endosialidases. J. Biol. Chem.
278: 12634-12644
[Abstract]
[Full Text]
-
Broadbent, J. R., McMahon, D. J., Welker, D. L., Oberg, C. J., Moineau, S.
(2003). Biochemistry, Genetics, and Applications of Exopolysaccharide Production in Streptococcus thermophilus: A Review. J DAIRY SCI
86: 407-423
[Abstract]
[Full Text]
-
Deveau, H., Van Calsteren, M.-R., Moineau, S.
(2002). Effect of Exopolysaccharides on Phage-Host Interactions in Lactococcus lactis. Appl. Environ. Microbiol.
68: 4364-4369
[Abstract]
[Full Text]
-
Scholl, D., Adhya, S., Merril, C. R.
(2002). Bacteriophage SP6 Is Closely Related to Phages K1-5, K5, and K1E but Encodes a Tail Protein Very Similar to That of the Distantly Related P22. J. Bacteriol.
184: 2833-2836
[Abstract]
[Full Text]
-
Da Costa, A., Michaud, P., Petit, E., Heyraud, A., Colin-Morel, P., Courtois, B., Courtois, J.
(2001). Purification and Properties of a Glucuronan Lyase from Sinorhizobium meliloti M5N1CS (NCIMB 40472). Appl. Environ. Microbiol.
67: 5197-5203
[Abstract]
[Full Text]
-
Scholl, D., Rogers, S., Adhya, S., Merril, C. R.
(2001). Bacteriophage K1-5 Encodes Two Different Tail Fiber Proteins, Allowing It To Infect and Replicate on both K1 and K5 Strains of Escherichia coli. J. Virol.
75: 2509-2515
[Abstract]
[Full Text]