Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3775-3783, Vol. 182, No. 13
Department of Microbiology, Eastman Dental
Institute for Oral Health Care Sciences, University College London,
London WC1X 8LD,1 and Microbiology and
Virology Clinical Group, St. Bartholomew's Hospital, West
Smithfield, London EC1A 7BE,3 United Kingdom,
and Bacterial Pathogenesis Research Group, Department of
Microbiology, Monash University, Victoria 3800, Australia2
Received 27 January 2000/Accepted 18 April 2000
Tn5397 is a conjugative transposon that was originally
isolated from Clostridium difficile. Previous analysis had
shown that the central region of Tn5397 was closely related
to the conjugative transposon Tn916. However, in this work
we obtained the DNA sequence of the ends of Tn5397 and
showed that they are completely different to those of
Tn916. Tn5397 did not contain the
int and xis genes, which are required for the
excision and integration of Tn916. Instead, the right end
of Tn5397 contained a gene, tndX, that appears
to encode a member of the large resolvase family of site-specific recombinases. TndX is closely related to the TnpX resolvase from the
mobilizable but nonconjugative chloramphenicol resistance transposons,
Tn4451 from Clostridium perfringens and
Tn4453 from C. difficile. Like the latter
elements, inserted copies of Tn5397 were flanked by a
direct repeat of a GA dinucleotide. The Tn5397 target sites were also shown to contain a central GA dinucleotide. Excision of the element in C. difficile completely
regenerated the original target sequence. A circular form of the
transposon, in which the left and right ends of the element were
separated by a GA dinucleotide, was detected by PCR in both
Bacillus subtilis and C. difficile. A
Tn5397 mutant in which part of tndX was deleted was constructed in B. subtilis. This mutant was
nonconjugative and did not produce the circular form of
Tn5397, indicating that the TndX resolvase has an essential
role in the excision and transposition of Tn5397 and is
thus the first example of a member of the large resolvase family of
recombinases being involved in conjugative transposon mobility.
Finally, we showed that introduction of Tn916 into a strain
containing Tn5397 induced the loss of the latter element in
95.6% of recipients.
Conjugative transposons are genetic
elements that encode their own transfer from the genome of a donor cell
to the genome of a recipient cell. These elements are remarkably
promiscuous and are capable of being transferred across large
phylogenetic distances. They are important clinically because they are
one of the major vectors involved in the spread of antibiotic
resistance among bacterial pathogens. The most intensively studied
conjugative transposon is the 18.3-kb element Tn916. This
transposon was originally isolated from the chromosome of
Enterococcus faecalis DS16, where it mediated tetracycline
resistance via the tet(M) gene (12). There are
several reviews describing the properties of conjugative transposons
(9, 26, 32, 35).
The first step in the conjugative transposition of Tn916 and
its closely related elements is excision from the donor DNA. This
process is followed by circularization of the element and its
subsequent transfer to a new host, where the transposon inserts into a
new DNA target site. The products of the transposon-encoded genes
int and xis are required for excision
(24). Int is a site-specific recombinase of the integrase
family and is essential for the excision of Tn916 (24,
31, 38, 39). Xis has also been shown to be required for excision
in gram-positive hosts. Recent work has shown that both Xis and Int are
required for excision but that only Int is required for integration. In
fact, the presence of Xis may inhibit integration of the transposon
(19). The excision of Tn916 from the donor has
been compared with the excision of In addition to these insertion and excision functions, members of the
Tn916 family encode their own conjugative transfer. The
complete DNA sequence of Tn916 has been obtained
(11). Open reading frames (ORFs) that have the
potential to encode polypeptides with sequence similarity to
proteins known to be involved in conjugation (e.g., the
anti-restriction protein Ard of plasmid Collb-P9 and the MbeA
mobilization protein of plasmid ColE1) have been identified. A
functional oriT site has also been located (15),
and there is evidence that this site is involved in single-stranded DNA transfer to the recipient (36).
We have identified a conjugative transposon, Tn5397, from
the gram-positive anaerobic pathogen Clostridium difficile
(21, 22). Tn5397 was shown to be transferred by a
conjugation-like process from C. difficile strain 630 to
Bacillus subtilis strain CU2189 and back to C. difficile, as well as between C. difficile strains
(21). Furthermore, Tn5397 has also been shown to
be capable of transfer in a model oral biofilm community, indicating that the element is likely to be able to transfer in natural
environments (28). Physical and genetic analysis indicates
that Tn5397 is related to Tn916 (14, 21,
22). However, there are some differences between the two
elements, as members of our group have recently shown that
Tn5397 contains a group II intron inserted into a gene almost identical to orf14 from Tn916
(22).
In this paper we show that the ends of Tn5397 are not
related to those of Tn916 and that the int and
xis regions of Tn916 have been replaced by a gene
that has the potential to encode a site-specific recombinase,
tndX, that is related to the large resolvase family of
recombinases. We demonstrate that this gene is related to the resolvase
genes (tnpX) from the nonconjugative, mobilizable
chloramphenicol resistance transposons Tn4451 and Tn4453 (2, 16). This is the first time that such
a gene has been found on a conjugative transposon. The target sites of
Tn5397 in C. difficile and B. subtilis
have also been determined, which has allowed us to develop a model for
the integration and excision of Tn5397.
Bacterial strains, growth media, and plasmids.
All the
bacterial strains and plasmids used in this study together with their
relevant properties are shown in Table 1.
The C. difficile and B. subtilis strains were
grown on brain heart infusion (BHI) agar or in BHI broth (Oxoid,
Basingstoke, United Kingdom), and Escherichia coli strains
were grown in Luria-Bertani agar or broth (33). Where
appropriate, the medium was supplemented with ampicillin (100 µg
ml
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Characterization of the Ends and Target Sites of the Novel
Conjugative Transposon Tn5397 from Clostridium
difficile: Excision and Circularization Is Mediated by the
Large Resolvase, TndX
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
phage as both proceed by a
mechanism that involves staggered cuts at both ends of the element,
followed by circularization and transfer to a new host (25).
However, the recombination sites of are homologous, while those of
Tn916 are not. Tn916 excision involves the
Int-mediated production of 5'-protruding staggered endonucleolytic
cuts. One strand is cut six bases from the end of the transposon, and
the other is cut immediately adjacent to the other end (17, 30,
40). The resulting single strand overhangs that flank the
transposon are then ligated to form a covalently closed circle
(4). As Tn916 does not duplicate its integration
target (8), the two overhangs are not usually complementary and the resulting joint between the two ends of the conjugative transposon may be a heteroduplex. However, in E. faecalis
only a homoduplex joint has been found in the circular intermediate (18).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1), chloramphenicol (30 µg ml1),
erythromycin (100 µg ml1), tetracycline (10 µg
ml1), or rifampin (15 µg ml1). All
C. difficile strains were grown at 37°C in an anaerobic chamber (Don Whitley Scientific Ltd.) with an atmosphere of 80% N2, 10% H2, 10% CO2. B. subtilis and E. coli strains were grown at 37°C
aerobically.
TABLE 1.
Bacterial strains and plasmids
Strategy for obtaining the DNA sequence of the ends of Tn5397. Previous subcloning and hybridization analysis has allowed the identification of the right end of Tn5397 (21, 22, 23). The complete DNA sequence of the right end of Tn5397 was determined.
A PCR-based strategy was used to amplify the ligated ends of the circular form of the transposon (see Fig. 2). Primer 2 (5' ACAACCAGCAGGAAAACAGG 3') was designed from the left end of Tn916. Primer 3 (5' ACGTGTATCAAGCAGAGGGAATCGGTAAA 3') was designed from the sequence of the right end of Tn5397. This primer bound to Tn5397, 90 bp from the right end of the transposon. The 1,265-bp PCR product produced with primers 2 and 3 was sequenced on both strands to gain an unambiguous sequence. Based on the sequence of the left end of Tn5397, a primer reading out of the transposon (primer 5 [5' CCACTTGATATGAAAAATCAAATGGCTC 3']) was designed (see Fig. 2). Primers 3 and 5 were used to prime genomic DNA sequencing of C. difficile 630 DNA. The resulting genomic DNA sequence was used to design primers reading into the transposon from the flanking genomic region, specifically, primers 1 (5' GAAAACTGCTTGGATTCAGAAG 3') and 4 (5' GATATTGAAAACTCCTTGAAAGTATCATATCC 3'). These primers were used to prime genomic DNA sequencing reactions in strains that contained Tn5397 and isogenic strains that did not carry the element. Primer pairs (primers 1 and 2 and primers 3 and 4) were used to amplify the junction regions, and another primer pair (primers 1 and 4) was used to amplify the target sequence in strains that did not contain Tn5397.Construction of the tndX mutant
tndX
cat.
To generate the deletion mutant of
tndX (tndXcat) the region from bp 285 to bp
1281 (bp 1 is the first base in the ORF [see Fig. 1D]) of the
tndX gene was replaced with the catP gene from pJIR62 (37). Primers 5' TTGTTAAAACAGCAAGC 3' and
5' CCCACTTCGACTGCACTCCCCCACATAGTACATGAATAGTGC 3' were used
to amplify bp 1 to 285, primers 5'
GCACTATTCATGTACTATGTGGGGGAGTGCAGTCGAAGTGGG 3' and 5'
GCATTTTGCTCTATAAGTTTGGGGTCTTTGTACTAACCTGTGG 3' were used to
amplify the catP gene, and primers 5'
CCACAGGTTAGTACAAAGACCCCAAACTTATAGAGCAAAATGC 3' and 5'
TATCAATGAGACACTGC 3' were used to amplify bp 1281 to 1599 from
tndX. These PCR products were joined together by subsequent PCR reactions. The resulting recombinant was cloned into the pGEM-T Easy vector (Promega) to generate pPPM122. To replace the
tndX allele with tndXcat, pPPM122 was used to
transform the B. subtilis strain BS6A
(CU2189::Tn5397), and selection for
chloramphenicol-resistant transformants was done. Transformation of
B. subtilis was carried out using the method of
Anagnostopoulos and Spizizen (1). One transformant, in which
tndXcat had replaced tndX and no vector sequences were present, as verified by PCR and DNA sequencing, was
designated BS11A and chosen for further study.
DNA manipulations. Plasmid constructions (with the exception of those described above) were all carried out essentially as previously described (33). Genomic DNA from C. difficile and B. subtilis was prepared using a gram-positive DNA isolation kit (Puregene). Plasmid DNA was prepared using a plasmid Miniprep kit (Qiagen, Crawley, United Kingdom).
Sequencing methods. Genomic sequencing was carried out with a reaction mixture containing 8 µl of Big Dye Mix (ABI), 15 to 30 pmol of primer, 3 to 6 µg of purified genomic DNA, and 1 µl of ThermoFidelase (Fidelity Systems, Inc.), with water added to obtain a final volume of 20 µl. The thermocycling conditions were as follows: 95°C for 5 min, followed by 99 cycles of a rapid thermal ramp to 95°C, 95°C for 30 sec, a rapid thermal ramp to 55°C, 55°C for 20 sec, and a rapid thermal ramp to 65°C, 65°C for 4 min. This was followed by a rapid thermal ramp to 4°C, and the mixture was held at that temperature. These samples were ethanol precipitated and analyzed on an ABI PRISM 310 genetic analyzer. For all PCR-based sequencing, the DNA sequences of the leading and lagging strands were determined with products from independent PCR experiments.
PCR. The PCR reaction consisted of 30 cycles of denaturation (94°C, 1 min), annealing (50°C, 1 min), and extension (72°C, 1 to 3 min). The products were stored at 4°C until ready for analysis. The Taq polymerase was obtained from Promega, and reactions were carried out in buffer provided by the manufacturer.
Filter matings. Both B. subtilis and C. difficile were grown on BHI agar plates for 18 h. The cells were scraped off the plates and resuspended in 20 ml of BHI broth. The cultures were grown at 37°C until mid-exponential phase (optical density at 600 nm of 0.45). Cultures of donor and recipient were mixed and centrifuged in an anaerobic environment to form a cell pellet. The pellet was resuspended in 1 ml of BHI broth, and 100 µl was spread on nitrocellulose 0.45-µm-pore-size filters on BHI agar plates which were incubated for 18 h at 37°C in an anaerobic environment. The filters were removed from the agar plates and placed in 20-ml bottles containing (each) 1 ml of sterile BHI broth (at 37°C) and vortexed for 10 to 20 s. When C. difficile was the recipient, 100-µl aliquots were spread on BHI agar supplemented with the appropriate antibiotics and incubated anaerobically for 48 h. When B. subtilis was the recipient, 100-µl aliquots were spread on BHI agar supplemented with the appropriate antibiotics and incubated aerobically for 48 h, with checking for growth at 24 and 48 h.
Excision assays.
The ability of TndX to promote the excision
of the Tn4451 derivative Tn4451tnpX
(2) was determined as follows. The tndX gene was
amplified by PCR from C. difficile 630 using the primers 5' CGTGATAATGATACTCC 3' and 5' ATATGTCCTTCTGTTGCTGA 3'.
The resulting PCR fragment was filled using T4 DNA polymerase
(Boehringer Mannheim) and ligated into the pUC18 SmaI site
to generate pJIR1508. The region containing tndX was
subcloned into the EcoRI-XbaI site of pSU39 to
generate pJIR1537. The excision assays were performed essentially as
previously described (2, 10), with some modifications. The
target plasmid carrying Tn4451tnpX in these assays was
pJIR683 (Apr Cmr), which is a pBluescript
derivative (2). Therefore, the strains constructed for
analysis were DH12S sublines carrying pJIR683 together with either
pSU39 (the negative control) or pJIR1537 (the
tndX+ test plasmid). The DH12S sublines were
exposed to 2 mM isopropyl-
-D-thiogalactopyranoside (IPTG) for 3 h prior to the extraction of plasmid DNA in order to
induce expression of tndX. Miniprep DNA was prepared and
subsequently used to transform DH5
to ampicillin resistance. Loss of
the transposon was then monitored by plating onto media containing chloramphenicol.
Nucleotide sequence accession numbers. In this study, the complete DNA sequence of the right end (GenBank accession number AF193610) and the sequence of the left end (GenBank accession number AF193609) of Tn5397 were determined, as was the DNA sequence surrounding the C. difficile insertion site in the transconjugants FM168 and FM30 (559 bp) (GenBank accession number AF249883).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Genetic organization of the ends of Tn5397.
Previous
hybridization analysis of Tn5397 had shown that the central
region of the element was very closely related to
Tn916 but that the ends of the two elements were different
(22, 23). To determine the nature of these differences,
the ends of Tn5397 were completely sequenced on both
strands. The regions where the two transposons diverge are shown
schematically in Fig.
1A. Analysis of the
first 328 bp of the left end of Tn5397 (Fig. 1B) showed that
the first 201 bp of Tn916 was absent and was replaced by 180 bp of unrelated DNA sequence in Tn5397. Thereafter, the two transposons are closely related, although there are some insertions and
deletions (Fig. 1B). In addition, there is an inverted repeat, 5'
AAATAG 3', (Fig. 1B) on either side of the regions where the two
transposons diverge.
|
Determination of site specificity of Tn5397 in C. difficile and B. subtilis.
To determine the target
site specificity of Tn5397 we determined the sequence of the
transposon-host genome junctions from C. difficile strain
630, the original donor strain (Fig. 2
shows the strategy used), and two independently isolated C. difficile CD37 transconjugants, FM168 and FM30 (Table 1). These
sequences were identical (Fig. 3A). The
DNA sequence surrounding the C. difficile insertion site in
these strains was also determined. It was found that Tn5397
inserted into an ORF that was predicted to encode a polypeptide that
has limited homology to the pilin gene inverting protein PivNM-2 from
Neisseria meningitidis (accession number AE0025251). The
insertion sites in four independently isolated B. subtilis
strains were also sequenced, in this host Tn5397 had inserted into different sites. At each site the transposon was flanked
by a directly repeated GA dinucleotide (Fig. 3A). The sites of
insertion in the B. subtilis genome are also shown in Fig.
3. It is of interest to note that two insertions in different regions
of the padC gene were isolated.
|
|
Tn5397 is found in a circular form in C. difficile. Given that the conjugative transposon Tn916 and the mobilizable transposons from Clostridium perfringens and C. difficile, Tn4451 and Tn4453, respectively, have been shown to produce circular forms (2, 16, 36), we decided to see if Tn5397 also has a circular form. PCR with outward firing primers 2 and 3 (Fig. 2) would yield a PCR product only if the left and right ends of the transposon were ligated together. Products of the appropriate size (1265 bp) were produced when DNA from the C. difficile strains 630 and FM168 (each contains a single copy of Tn5397) were used as templates. No products were observed when DNA from the conjugation recipients CD37 or FM48 (CD37::Tn916) were used as templates (results not shown).
Five independently derived PCR products were cloned and sequenced. The sequence obtained from each recombinant was identical. The termini of Tn5397 could be seen in an orientation consistent with the formation of a circular molecule. The two ends of the transposon were separated by a GA dinucleotide at the circular form joint (Fig. 3B).Introduction of Tn5397 into a C. difficile
strain containing Tn916E induces the loss of
Tn916E and vice versa.
When the B. subtilis strain BS2 (CU2189::Tn5397) was used
as the donor and C. difficile strain FM123
(CD37::Tn916E) was used as the recipient in
filter mating experiments, tetracycline-resistant strains arose at a
frequency of 2 × 107 transconjugants per donor
cell. Only 65% (91 of 140) of the transconjugants were found to be
resistant to erythromycin. When B. subtilis BS19 (CU2189::Tn916E) was used as the donor and C. difficile FM30 (CD37::Tn5397) was used as the
recipient, erythromycin-resistant transconjugants arose at a frequency
of 3 × 107 per donor cell but only 4.3% (6 of
141) of the transconjugants were found to be tetracycline resistant.
Both Tn5397 and Tn916E were stable, i.e.,
after daily subculture for 14 days all of 100 colonies from the final
subculture were tetracycline resistant and/or erythromycin resistant,
respectively. This result agrees with previous work that shows that
Tn5397 is stably inherited in C. difficile
(21).
E). Tetracycline-resistant
transconjugants were obtained at a frequency of 2 × 107 per donor cell. All of the 365 transconjugants tested
from this mating were resistant to erythromycin, the nonselected
marker. Therefore, introducing a second copy of Tn916 into
C. difficile did not induce the loss of the resident
Tn916E element.
To investigate if doubly resistant transconjugants contained two
functional elements, FM149 (CD37::Tn916E
Tn5397) was tested for its ability to transfer erythromycin
and tetracycline resistance to B. subtilis. All of
the transconjugants selected on erythromycin were
tetracycline sensitive (142 of 142 transconjugants), and those
selected on tetracycline were erythromycin sensitive (192 of 192 transconjugants), showing that Tn5397 and
Tn916E transferred separately and independently. The
transconjugants from these matings could also transfer either
Tn916E or Tn5397 in a further round of mating,
indicating that both transposons are still functionally intact.
Tn5397 excises precisely from its genomic target, regenerating the original target sequence. The experiments described above provided us with the opportunity of investigating the target site after the excision of Tn5397 in C. difficile. Genomic DNA was prepared from two of the strains which had lost Tn5397, FM128 and FM136, and used in a PCR reaction with primers 1 and 4 (Fig. 2). A product of 400 bp, i.e., the size expected if Tn5397 had excised from the genome, was obtained (results not shown). The DNA sequence of the PCR product was obtained, and the DNA sequence was identical to that of the C. difficile CD37 target site (Fig. 3). These results demonstrate that upon excision, Tn5397 precisely regenerates the original target site.
Identification of a potential site-specific recombinase TndX.
Database searches with the TndX sequence revealed that it is related to
TnpX (37% identity and 61% similarity), a site-specific recombinase
from the C. perfringens chloramphenicol resistance transposon Tn4451 (2). In common with TnpX, TndX
contains amino acid residues in the N-terminal domain that are highly
conserved within the resolvase/invertase family of site-specific
recombinases. The conserved TnpX resolvase residues previously shown to
be required for TnpX function (10) are also present in TndX
(Fig. 4). Most members of the resolvase
family of proteins are less than half the size of TndX and in their
C-termini contain a helix-turn-helix motif which is not found in
TndX or TnpX. TndX and TnpX are members of a new family of large
resolvase/invertase proteins (Fig. 4). These proteins have sequence
similarity to typical resolvase/invertases in their N-terminal domains
but have greatly extended C-terminal domains (10, 41).
|
TndX is required for excision of Tn5397.
Analysis of the
DNA sequence of several Tn5397 target sites suggested that
the element integrated and excised by using a method typical of
resolvases, i.e., strand exchange occurs by a concerted four-strand
break-and-rejoining mechanism involving 2-bp-staggered ends. To
demonstrate that TndX was required for the conjugative transposition of
Tn5397, a portion (bp 285 to 1281) of the tndX gene was replaced with a chloramphenicol resistance gene
(catP) by allelic replacement in B. subtilis;
the resulting mutant allele was designated tndXcat.
That the expected homologous recombination reaction had occurred was
verified by PCR on DNA extracted from BS6A (parent strain) and BS11A
(mutant containing tndXcat) (results not shown),
demonstrating unambiguously that tndXcat had
replaced the tndX gene in BS11A. Subsequent conjugation
experiments showed that strain BS11A could not act as a donor for
the transfer of Tn5397 to C. difficile
strain CD37 in filter mating experiments. By contrast, the
parent strain BS6A yielded 2 × 107
tetracycline-resistant transconjugants per donor cell. Moreover, the
circular form of the transposon could not be amplified from BS11A but
could be amplified from the parent strain BS6A (results not shown).
These results indicate that TndX is required for formation of the
circular form of Tn5397, presumably by catalyzing transposon excision.
TndX cannot replace TnpX in a trans complementation
assay.
TndX and TnpX are related at the amino acid sequence level,
and both appear to excise their respective transposons by a similar resolvase-mediated mechanism. Therefore, TndX was used in a
trans complementation assay in E. coli to see if
it could excise a derivative of Tn4451,
Tn4451tnpX1, in which an internal fragment of
tnpX had been deleted (2). Although transposon
excision was detected when this derivative was complemented with a
plasmid (pJIR639) carrying a wild-type tnpX gene, no
excision was detected when we used a similar plasmid (pJIR1537)
carrying a wild-type tndX gene (data not shown). Evidence
that the cloning procedure had not introduced a mutation in
tndX was confirmed by completely sequencing the
tndX gene in pJIR1537. Expression of TndX in cells containing pJIR1537 was confirmed by Western blotting (results not shown).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In this paper, we have examined the ends of Tn5397 in
detail. At the right end of Tn5397, the xis and
int genes that are present in the equivalent positions in
Tn916 have been replaced by tndX, which appears
to encode a protein related to the large resolvase family of
site-specific recombinases. The members of this family include enzymes
involved in excision of DNA during spore formation (34),
heterocyst development (5), excision of transposons (2,
10, 16), and the integration and excision of bacteriophage genomes (41). Each of these proteins has the
resolvase/invertase catalytic domain at its N terminus, but they are
much larger than typical resolvase/invertase proteins, being greatly
extended in the C-terminal region. TndX is most closely related the
TnpX resolvase, which promotes the excision of the C. perfringens transposon Tn4451 and the closely related
C. difficile transposon Tn4453 (2, 10,
16). All of the residues that Crellin and Rood (10) showed were essential for TnpX function were also present in TndX. However, we demonstrated in this work that TndX could not promote the
excision of Tn4451tnpX. Previous work demonstrated that
TnpX efficiently excises Tn4451tnpX under the same
conditions (2).
The difference in activity between two proteins probably reflects sequence differences and differences in the target site specificity of the TndX and TnpX enzymes, specifically the sequences of the transposon ends and insertion sites. With the exception of the GA dinucleotide at the ends of the elements and at the center of the target sites, there is no obvious sequence similarity between the ends of Tn5397 and Tn4451 or between the target sites of the two transposons. However, the target sites of both transposons, at least in their clostridial hosts, resemble the ends of their cognate transposon (see reference 10 for the Tn4451 sites in C. perfringens). For Tn5397 in C. difficile, 8 out of 10 bases of the target to the right of the GA are identical to the right end of the transposon and 5 out of 10 bases to the left of the GA are identical to the left end of the transposon. However, in B. subtilis Tn5397 can insert at sites that do not resemble the ends of the transposon and the only obvious requirement is the GA dinucleotide at the centre of the target site. Interestingly, a search of the B. subtilis genome revealed that the target site found in C. difficile is not present in B. subtilis, which may account for the ability of Tn5397 to insert into different sites in this host.
We have shown that Tn5397, in addition to existing in an integrated form, produces a circular molecule. Production of the circular form was dependent on TndX since a mutant of Tn5397 in which part of tndX had been deleted could not produce this circular molecule. Furthermore, the tndX mutant was not capable of conjugative transfer. In the related conjugative transposon, Tn916, a circular form was shown to be the transposition intermediate (36). Tn4451 and Tn4453 also produce circular forms (2, 16) which have now been shown to be the transposition intermediates (D. Lyras and J. I. Rood, unpublished results). Other large resolvase-like proteins have been shown to catalyze the formation of circular DNA molecules (41). Taken together, these results strongly suggest that the circular form of Tn5397 is the transposition intermediate.
On the basis of the above discussion we propose that TndX is responsible for the insertion and excision of Tn5397. The available information indicates that TndX mediates the excision of Tn5397 by introducing 2-bp-staggered cuts at the 3' ends of the directly repeated GA dinucleotides at the ends of the transposon. Strand exchange occurs, resulting in excision of the transposon as a circular molecule and regeneration of the original target site. The circular form can then be transferred to a new host cell by conjugation and can transpose into the new genome. Integration occurs by TndX recognizing a suitable target site that contains a central GA dinucleotide and promoting site-specific recombination with the joint of the circular form. Strand exchange and ligation result in the insertion of Tn5397 flanked by directly repeated GA dinucleotides.
Tn5397 can induce the loss of Tn916 when introduced into a C. difficile cell by conjugation and vice versa. The mechanism of this interaction is not known. However, recent work has allowed a model to be proposed for the regulation of Tn916 transcription by tetracycline (6). These authors identified at least three possible trans-acting regulatory proteins, the positive regulators encoded by orf7 and orf8 and the putative negative regulator encoded by orf9. When Tn916 is transferred to C. difficile, these proteins are presumably synthesized and have an effect on the stability of the resident copy of Tn5397. The fact that the introduction of a marked copy of Tn916 does not induce the loss of a resident Tn916 element in C. difficile must reflect differences in the regulation of the int and xis genes in Tn916 and the tndX gene in Tn5397.
We propose that Tn5397 was produced by a recombination event between different mobile genetic elements. In this process there was an exchange of recombination modules, resulting in Tn5397 retaining a Tn916-like conjugation system but acquiring a completely different resolvase-mediated integration and excision system. The recent finding in C. difficile of a nonconjugative transposon closely related to Tn4451 (i.e., Tn4453 [16]) indicates that there is a clear possibility for interaction between Tn916-like elements and transposons containing TnpX genes in C. difficile. However, the resolvase gene from Tn5397 has diverged significantly from those of Tn4451 and Tn4453, suggesting that the formation of Tn5397 was not a relatively recent genetic event.
As well as swapping of modules, conjugative transposons have been shown to associate with each other and other mobile elements to produce composite transposons (20, 27). This type of cooperation between different mobile elements is a powerful means of generating rapid evolutionary change. In Tn5397 we have seen the generation of a novel conjugative transposon with different mechanisms of integration/excision and target site preferences to the ancestral Tn916-like element. Tn5397 is also a composite element as it has acquired a group II intron which is very likely to be mobile (22).
In conclusion, we have shown that Tn5397 is a modular mobile element, with the central portion of the element, the region involved in conjugation, being very closely related to the promiscuous enterococcal element Tn916 and the ends of the element, which are involved in integration and excision, being unique to Tn5397 but closely related to the recombination region of the nonconjugative mobilizable clostridial transposons Tn4451 and Tn4453. Tn5397 inserts and excises from the host replicon by the action of an enzyme of the large resolvase/invertase family. Although Tn4451 and Tn4453 can be mobilized, they are not conjugative. Tn5397 is the only conjugative transposon discovered so far whose translocation appears to be dependent on resolvase-mediated site-specific recombination events.
| |
ACKNOWLEDGMENTS |
|---|
H.W. and A.P.R. contributed equally to the work.
We thank the Wellcome Trust for supporting the work in one of our laboratories (P.M.) and facilitating the collaboration between P.M. and J.I.R. A.P.R. was the recipient of a BBSRC research studentship. Work in one of our laboratories (J.I.R.) was supported by grants from the Australian National Health and Medical Research Council.
We thank Don Clewell for pAM120 and Craig Rubens for pCER110. We thank Diane Massie for her excellent assistance with some of the DNA sequencing.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Eastman Dental Institute for Oral Health Care Sciences, University College London, 256 Gray's Inn Rd., London WC1X 8LD, United Kingdom. Phone: 44 020 7915 1223. Fax: 44 020 7915 1127. E-mail: p.mullany{at}eastman.ucl.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Anagnostopoulos, G., and J. Spizizen.
1961.
Requirements for transformation in Bacillus subtilis.
J. Bacteriol.
81:741-746 |
| 2. | Bannam, T. L., P. K. Crellin, and J. I. Rood. 1995. Molecular genetics of the chloramphenicol-resistance transposon Tn4451 from Clostridium perfringens: the TnpX site-specific recombinase excises a circular transposon molecule. Mol. Microbiol. 16:535-551[Medline]. |
| 3. | Bartolome, B., Y. Jubete, E. Martinez, and F. de la Cruz. 1991. Construction and properties of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75-78[CrossRef][Medline]. |
| 4. | Caparon, M. G., and J. R. Scott. 1989. Excision and insertion of the conjugative transposon Tn916 involves a novel recombination mechanism. Cell 59:1027-1034[CrossRef][Medline]. |
| 5. |
Carrasco, C. D.,
K. S. Ramaswamy,
T. S. Ramasubramanian, and J. W. Golden.
1993.
Anabaena xisF gene encodes a developmentally regulated site-specific recombinase.
Genes Dev.
8:74-83 |
| 6. | Celli, J., and P. Trieu-Cuot. 1998. Circularisation of Tn916 is required for expression of the transposon-encoded transfer functions: characterisation of long tetracycline-inducible transcripts reading through the attachment site. Mol. Microbiol. 28:103-117[CrossRef][Medline]. |
| 7. |
Christie, P. J.,
R. Z. Korman,
S. A. Zahler,
J. C. Adsit, and G. M. Dunny.
1987.
Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis.
J. Bacteriol.
169:2529-2536 |
| 8. |
Clewell, D. B.,
S. E. Flannagan,
Y. Ike,
J. M. Jones, and C. Gawron-Burke.
1988.
Sequence analysis of the termini of conjugative transposon Tn916.
J. Bacteriol.
170:3046-3052 |
| 9. | Clewell, D., S. A. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 229:229-236. |
| 10. |
Crellin, P. K., and J. I. Rood.
1997.
The resolvase/invertase domain of the site-specific recombinase TnpX is functional and recognises a target sequence that resembles the junction of the circular form of the Clostridium perfringens transposon Tn4451.
J. Bacteriol.
179:5148-5156 |
| 11. | Flannagan, S. E., L. A. Zitzow, Y. A. Su, and D. B. Clewell. 1994. Nucleotide sequence of the 18 kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32:350-354[CrossRef][Medline]. |
| 12. |
Franke, A. E., and D. B. Clewell.
1981.
Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of "conjugal" transfer in the absence of a conjugative plasmid.
J. Bacteriol.
145:494-502 |
| 13. |
Gawron-Burke, C., and D. B. Clewell.
1984.
Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in E. coli: strategy for targeting and cloning of genes from gram-positive bacteria.
J. Bacteriol.
159:214-221 |
| 14. |
Hachler, H.,
F. H. Kayser, and B. Berger-Bachi.
1987.
Homology of a transferable tetracycline resistance determinant of Clostridium difficile with Streptococcus (Enterococcus) faecalis transposon Tn916.
Antimicrob. Agents Chemother.
31:1033-1038 |
| 15. |
Jaworski, D. D., and D. B. Clewell.
1995.
A functional origin of transfer (oriT) on the conjugative transposon Tn916.
J. Bacteriol.
177:6644-6651 |
| 16. | Lyras, D., C. Storie, A. S. Huggins, P. K. Crellin, T. L. Bannam, and J. I. Rood. 1998. Chloramphenicol resistance in Clostridium difficile is encoded on Tn4453 transposons that are closely related to Tn4451 from Clostridium perfringens. Antimicrob. Agents Chemother. 23:784-786. |
| 17. |
Manganelli, R.,
S. Ricci, and G. Pozzi.
1996.
Conjugative transposon Tn916: evidence for excision with formation of 5'-protruding termini.
J. Bacteriol.
178:5813-5816 |
| 18. | Manganelli, R., S. Ricci, and G. Pozzi. 1997. The joint of Tn916 circular intermediate is a homoduplex in Enterococcus faecalis. Plasmid 38:71-78[CrossRef][Medline]. |
| 19. | Marra, D., and J. R. Scott. 1999. Regulation of excision of the conjugative transposon Tn916. Mol Microbiol 31:609-621[CrossRef][Medline]. |
| 20. | McDougal, L. K., F. C. Tenover, L. N. Lee, J. Kamile, J. E. Patterson, J. H. Jorgensen, and D. J. LeBlanc. 1998. Detection of Tn916-like sequences within a Tn916-like conjugative transposon (Tn3872) in erythromycin-resistant isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother 42:2321-2318. |
| 21. |
Mullany, P.,
M. Wilks,
I. Lamb,
C. Clayton,
B. Wren, and S. Tabaqchali.
1990.
Genetic analysis of a tetracycline resistance determinant from Clostridium difficile and its conjugal transfer to and from Bacillus subtilis.
J. Gen. Microbiol.
136:1343-1349 |
| 22. | Mullany, P., M. Pallen, M. Wilks, and S. Tabaqchali. 1996. A group II intron in a conjugative transposon from the Gram-positive bacterium, Clostridium difficile. Gene 174:145-150[CrossRef][Medline]. |
| 23. |
Mullany, P.,
M. Wilks, and S. Tabaqchali.
1991.
Transfer of Tn916 and Tn916E into Clostridium difficile: demonstration of a hot-spot for these elements in the C. difficile genome.
FEMS Microbiol. Lett.
79:191-194[CrossRef].
|
| 24. | Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1989. Molecular characterisation of two proteins involved in the excision of the conjugative transposon Tn1545: homologies with other site-specific recombinases. EMBO J. 8:2425-2433[Medline]. |
| 25. | Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1990. The integration-excision system of the conjugative transposon Tn1545 is structurally and functionally related to those of the lamboid phages. Mol Microbiol 4:1513-1521[Medline]. |
| 26. |
Rice, L. B.
1998.
Tn916 family of conjugative transposons and dissemination of antimicrobial resistance determinants.
Antimicrob. Agents Chemother
42:1871-1877 |
| 27. |
Rice, L. B., and L. L. Carias.
1998.
Transfer of Tn5385, a composite multiresistance chromosomal element from Enterococcus faecalis.
J. Bacteriol.
180:714-721 |
| 28. | Roberts, A. P., J. Pratten, M. Wilson, and P. Mullany. 1999. Transfer of a conjugative transposon, Tn5397 in a model oral biofilm. FEMS Microbiol. Lett. 177:63-66[CrossRef][Medline]. |
| 29. |
Rubens, C. E., and L. M. Heggen.
1988.
Tn916E: a Tn916 transposon derivative expressing erythromycin resistance.
Plasmid
20:137-142[CrossRef][Medline].
|
| 30. |
Rudy, C. K., and J. R. Scott.
1994.
Length of the coupling sequence of Tn916.
J. Bacteriol.
176:3386-3388 |
| 31. |
Rudy, C. K.,
J. R. Scott, and G. Churchward.
1997.
DNA binding by the Xis protein of the conjugative transposon Tn916.
Nucleic Acids Res.
25:4061-4066 |
| 32. |
Salyers, A. A.,
N. B. Shoemaker,
A. M. Stevens, and L. Lhing-Yew.
1995.
Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.
Microbiol. Rev.
59:579-590 |
| 33. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 34. |
Sato, M.
1990.
The cisA cistron of Bacillus subtilis spoliation gene spoIVC encodes a protein homologous to a site-specific recombinase.
J. Bacteriol.
172:1092-1098 |
| 35. | Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[CrossRef][Medline]. |
| 36. | Scott, J. R., F. Bringel, D. Marra, G. Van Alstine, and C. K. Rudy. 1994. Conjugative transposition of Tn916: preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular intermediate. Mol. Microbiol. 11:1099-1108[CrossRef][Medline]. |
| 37. | Sloan, J., T. A. Warner, P. T. Scott, T. L. Bannam, D. I. Berryman, and J. I. Rood. 1992. Construction of a sequenced Clostridium perfringens-Escherichia coli shuttle plasmid. Plasmid 27:207-219[CrossRef][Medline]. |
| 38. |
Storrs, M. J.,
C. Poyart-Salmeron,
P. Trieu-Cuot, and P. Courvalin.
1991.
Conjugative transposition of Tn916 requires the excisive and integrative activities of the transposon encoded integrase.
J. Bacteriol.
173:4347-4352 |
| 39. | Su, Y. A., and D. B. Clewell. 1993. Characterisation of the left 4 kb of conjugative transposon Tn916: determinants involved in excision. Plasmid 30:234-250[CrossRef][Medline]. |
| 40. |
Taylor, K. L., and G. Churchward.
1997.
Specific DNA cleavage mediated by the integrase of conjugative transposon Tn916.
J. Bacteriol.
179:1117-1125 |
| 41. |
Thorpe, H. M., and M. C. M. Smith.
1998.
In vitro site-specific integration of bacteriophage DNA catalysed by a recombinase of the resolvase/invertase family.
Proc. Natl. Acad. Sci. USA
95:5505-5510 |
Journal of Bacteriology, July 2000, p. 3775-3783, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ray, J. L., Harms, K., Wikmark, O.-G., Starikova, I., Johnsen, P. J., Nielsen, K. M.
(2009). Sexual Isolation in Acinetobacter baylyi Is Locus-Specific and Varies 10,000-Fold Over the Genome. Genetics
182: 1165-1181
[Abstract] [Full Text] -
Bellanger, X., Roberts, A. P., Morel, C., Choulet, F., Pavlovic, G., Mullany, P., Decaris, B., Guedon, G.
(2009). Conjugative Transfer of the Integrative Conjugative Elements ICESt1 and ICESt3 from Streptococcus thermophilus. J. Bacteriol.
191: 2764-2775
[Abstract] [Full Text] -
Earl, A. M., Losick, R., Kolter, R.
(2007). Bacillus subtilis Genome Diversity. J. Bacteriol.
189: 1163-1170
[Abstract] [Full Text] -
Billington, S. J., Jost, B. H.
(2006). Multiple Genetic Elements Carry the Tetracycline Resistance Gene tet(W) in the Animal Pathogen Arcanobacterium pyogenes. Antimicrob. Agents Chemother.
50: 3580-3587
[Abstract] [Full Text] -
Wang, H., Smith, M. C. M., Mullany, P.
(2006). The Conjugative Transposon Tn5397 Has a Strong Preference for Integration into Its Clostridium difficile Target Site. J. Bacteriol.
188: 4871-4878
[Abstract] [Full Text] -
Agerso, Y., Pedersen, A. G., Aarestrup, F. M.
(2006). Identification of Tn5397-like and Tn916-like transposons and diversity of the tetracycline resistance gene tet(M) in enterococci from humans, pigs and poultry. J Antimicrob Chemother
57: 832-839
[Abstract] [Full Text] -
Rocco, J. M., Churchward, G.
(2006). The Integrase of the Conjugative Transposon Tn916 Directs Strand- and Sequence-Specific Cleavage of the Origin of Conjugal Transfer, oriT, by the Endonuclease Orf20. J. Bacteriol.
188: 2207-2213
[Abstract] [Full Text] -
Spigaglia, P., Carucci, V., Barbanti, F., Mastrantonio, P.
(2005). ErmB Determinants and Tn916-Like Elements in Clinical Isolates of Clostridium difficile. Antimicrob. Agents Chemother.
49: 2550-2553
[Abstract] [Full Text] -
Hussain, H. A, Roberts, A. P, Mullany, P.
(2005). Generation of an erythromycin-sensitive derivative of Clostridium difficile strain 630 (630{Delta}erm) and demonstration that the conjugative transposon Tn916{Delta}E enters the genome of this strain at multiple sites. J Med Microbiol
54: 137-141
[Abstract] [Full Text] -
Lancaster, H., Roberts, A. P., Bedi, R., Wilson, M., Mullany, P.
(2004). Characterization of Tn916S, a Tn916-Like Element Containing the Tetracycline Resistance Determinant tet(S). J. Bacteriol.
186: 4395-4398
[Abstract] [Full Text] -
Roberts, A. P., Cheah, G., Ready, D., Pratten, J., Wilson, M., Mullany, P.
(2001). Transfer of Tn916-Like Elements in Microcosm Dental Plaques. Antimicrob. Agents Chemother.
45: 2943-2946
[Abstract] [Full Text] -
Whittle, G., Hund, B. D., Shoemaker, N. B., Salyers, A. A.
(2001). Characterization of the 13-Kilobase ermF Region of the Bacteroides Conjugative Transposon CTnDOT. Appl. Environ. Microbiol.
67: 3488-3495
[Abstract] [Full Text] -
Breuner, A., Hammer, K.
(2001). Resolvase-like recombination performed by the TP901-1 integrase. Microbiology
147: 2051-2063
[Abstract] [Full Text] -
Roberts, A. P., Johanesen, P. A., Lyras, D., Mullany, P., Rood, J. I.
(2001). Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet(M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology
147: 1243-1251
[Abstract] [Full Text] -
Roberts, A. P., Braun, V., von Eichel-Streiber, C., Mullany, P.
(2001). Demonstration that the Group II Intron from the Clostridial Conjugative Transposon Tn5397 Undergoes Splicing In Vivo. J. Bacteriol.
183: 1296-1299
[Abstract] [Full Text] -
Wang, H., Mullany, P.
(2000). The Large Resolvase TndX Is Required and Sufficient for Integration and Excision of Derivatives of the Novel Conjugative Transposon Tn5397. J. Bacteriol.
182: 6577-6583
[Abstract] [Full Text] -
Santagati, M., Iannelli, F., Oggioni, M. R., Stefani, S., Pozzi, G.
(2000). Characterization of a Genetic Element Carrying the Macrolide Efflux Gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
44: 2585-2587
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»