Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3826-3831, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Secretion of Nucleoside Diphosphate Kinase by
Mucoid Pseudomonas aeruginosa 8821: Involvement of a
Carboxy-Terminal Motif in Secretion
Shilpa
Kamath,1
M. L.
Chen,2 and
A. M.
Chakrabarty1,*
Department of Microbiology and Immunology,
University of Illinois at Chicago College of
Medicine,1 and Research Resource
Center, University of Illinois at Chicago,2
Chicago, Illinois 60612
Received 7 January 2000/Accepted 10 April 2000
 |
ABSTRACT |
Nucleoside diphosphate kinase (Ndk) is a ubiquitous enzyme which
functions in balancing the nucleotide pool of the cell. We have
recently reported that in addition to being intracellular in both
mucoid and nonmucoid Pseudomonas aeruginosa, Ndk is also secreted into the extracellular environment by mucoid P. aeruginosa cells. This secreted Ndk has biochemical activity
similar to the intracellular Ndk and is 16 kDa in size. To demonstrate
that Ndk is indeed secreted and to localize the secretion motif, we
constructed an ndk knockout mutant, which lacks both
intracellular and extracellular forms of Ndk. In this study, we report
the construction of deletion derivatives made from the carboxy-terminal
region of Ndk. These deletion derivatives were introduced into the
ndk::Cm knockout mutant and were examined for the
intracellular and extracellular presence of Ndk. It was observed that
the carboxy-terminal 8-amino-acid region is required for the secretion
of Ndk into the extracellular region. This region has the sequence
DXXX, where X is a predominantly hydrophobic residue. Such sequences
represent a conserved motif in proteins secreted by the type I
secretory pathway in gram-negative microorganisms. To investigate the
significance of this motif in the secretion of Ndk, we constructed a
fusion protein of Ndk and the blue fluorescent protein (BFP) as well as
a fusion protein of mutated Ndk (whose DTEV motif has been changed to
AAAA) and the BFP. The presence of extracellular Ndk was detected only
in the ndk::Cm knockout mutant harboring the
wild-type BFP-Ndk protein fusion. We could not detect the presence of
extracellular Ndk in the ndk::Cm knockout mutant
containing the mutated BFP-Ndk protein fusion. In addition, we have
also used immunofluorescence microscopy to localize the wild-type and
mutated BFP-Ndk proteins in the cell. The significance of these
observations is discussed.
 |
INTRODUCTION |
Pseudomonas aeruginosa is
a gram-negative opportunistic pathogen which causes infection primarily
in patients with cystic fibrosis (CF) and in immunocompromised
patients. Chronic lung infections with P. aeruginosa are the
major cause of morbidity and mortality in CF patients (29).
One of the striking properties of the P. aeruginosa strain
encountered in the CF lung is its mucoid alginate-overproducing
phenotype. The emergence of mucoid variants occurs at variable times
upon the initial colonization with nonmucoid strains (9, 16)
and is linked to the establishment of chronic infections in CF
(22). Encapsulation of mucoid cells by alginate allows the
cells to somehow evade the host immune system, but this process is not
clearly understood (29, 31). Alginate biosynthesis requires
large amounts of GTP, and one of the enzymes implicated in supplying
GTP to the cell is nucleoside diphosphate kinase (Ndk). The role of Ndk
in alginate synthesis has recently been reviewed (5).
Mucoid P. aeruginosa harbors two forms of Ndk, a 16-kDa form
and a truncated 12-kDa form (32). This truncated 12-kDa form is generated by the proteolytic action of periplasmic elastase (20) and has been shown to allow predominant GTP synthesis
through complex formation with other proteins (6). It has
also been reported recently that mucoid strains of P. aeruginosa secrete a number of ATP-utilizing enzymes, including
Ndk, into the extracellular environment (39). Similarly, in
mammalian cells, Ndk has been shown to be present both as a
membrane-bound enzyme (21) and as an ectoenzyme in the
cell surface exposed to the outside medium (24). What is the
implication of the presence of Ndk as an ectoenzyme? It has become
apparent that mammalian cells extrude ATP into the extracellular fluid
in order to carry out various functions that require ATP (2,
17). Many cellular functions that are mediated by external
adenine nucleotides require the presence of specific receptors, called
the P2 purinergic receptors (10). Among the P2 receptors,
the P2Y and P2Z receptors are present on the surface of macrophages,
which are the first line of defense against infection by bacterial
pathogens. Macrophage-surface-associated P2Z receptors are known to
be involved in macrophage cell death when they are activated in the
presence of millimolar concentrations of external ATP (8,
23). Various ATP-utilizing ectoenzymes on the outer surface of
mammalian cells convert the ATP to various adenine nucleotides, thus
allowing activation of various purino receptors and maintaining a
balance of adenine nucleotides in the external medium (40).
It is interesting to note that many pathogens secrete ATP-utilizing
enzymes similar to the mammalian ectoenzymes so as to alter the level
of external ATP extruded by macrophages (38, 39). Such
ATP-utilizing enzymes secreted by mucoid P. aeruginosa 8821 have been shown to cause cytotoxicity in macrophages through both
P2Z-dependent and -independent pathways (39). Thus, the
secretion of these enzymes by mucoid strain 8821, but not by nonmucoid
strain PAO1, may be a factor conferring on mucoid P. aeruginosa cells protection from the host immune system
(39).
The exact mechanism by which ATP-utilizing enzymes are secreted is not
known. This report investigates the secretion of one of the
ATP-utilizing enzymes, Ndk, and discusses the possibility of Ndk being
secreted into the extracellular medium by virtue of the DXXX motif
present in its carboxy-terminal region.
 |
MATERIALS AND METHODS |
Bacterial strains and plasmids.
Bacterial strains and
plasmids used in this study are listed in Table
1. Escherichia coli and
P. aeruginosa strains were maintained in Luria-Bertani (LB)
and Pseudomonas isolation agar (Difco) media, respectively.
All strains were grown at 37°C in LB broth. For plasmid maintenance
in E. coli, ampicillin was used at a concentration of 100 µg/ml, and 500 µg of carbenicillin per ml or 500 µg of
chloramphenicol per ml was used for P. aeruginosa.
Isolation of the cell-free supernatant.
A P. aeruginosa 8821 ndk knockout
(ndk::Cm) mutant and complemented mutants
(ndk::Cm/pGWS95,
ndk::Cm/pSAK13,
ndk::Cm/pSAK14, and
ndk::Cm/pSAK15) were grown for 14 h
in LB medium containing carbenicillin. The cells were removed by
centrifugation at 5,000 × g for 10 min, and the
supernatants obtained were filtered through 0.2-µm-pore-size filters
and were used as the cell-free supernatants in subsequent experiments.
Isolation of the whole-cell extract and 45 to 70% ammonium
sulfate fraction.
P. aeruginosa 8821 ndk::Cm mutant, complemented mutant
(ndk::Cm/pGWS95), and
ndk::Cm/pSAK15 cells were harvested from 14-h-old cultures by centrifugation at 5,000 × g for 10 min and
were washed with cold sterile saline. The cells were suspended in
buffer A (50 mM Tris-HCl, pH 7.5; 10 mM MgCl2) and were
sonicated for four cycles of 30-s duration with a 15-s gap between
pulses. The sonicated suspension was centrifuged at 10,000 × g for 10 min. The supernatant was used as the whole-cell
extract. To isolate the 45 to 70% ammonium sulfate fraction, the
whole-cell extract was first subjected to a 45% ammonium sulfate
precipitation for 1 h. The pellet was removed by centrifugation,
and ammonium sulfate was added to the supernatant to a final
concentration of 70%. This suspension was stirred on ice for 1 h
and then centrifuged. The pellet obtained was suspended in buffer A and
dialyzed against the same buffer. This was used as the 45 to 70%
fraction for subsequent analysis. Cytoplasmic and membrane fractions
were isolated as reported earlier (20).
Construction of the 21-, 14-, and 8-amino-acid carboxy-terminal
deletions of Ndk.
The 63-, 42-, and 24-bp deletion constructs from
the 3' end of the ndk gene (33) were designed by
PCR by using the chromosomal DNA of wild-type P. aeruginosa
8821 as the template. A specific N-terminal primer with a
PstI site was designed, and the sequence was
TGCAGGACTAGCATAGGCCGCCC. The C-terminal primer sequences
used were TCAATCCGCGAAGAAGTGACGAT,
TCAGCGAGCGGCGGAAGCTTCGGA, and
TCAACCGTGGACGGCGTCTC. The PCR conditions used were one cycle
of 95°C for 5 min, 55°C for 5 min, and 72°C for 2 min followed by
30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min.
These products were cloned into the pGEMTeasy vector (Promega), were
excised by digestion with PstI and EcoRI, and
were gel purified. The PstI/EcoRI-digested PCR
fragments were then cloned into pMMB67HE to generate plasmids pSAK13,
pSAK14, and pSAK15 (Table 1). These plasmids were then introduced into
the P. aeruginosa 8821 ndk::Cm mutant
by triparental matings (13).
Polyacrylamide gel electrophoresis and immunoblotting.
Approximately 5 µg of purified protein was separated by sodium
dodecyl sulfate-15% polyacrylamide gel electrophoresis as described before (20) and was transferred onto a nitrocellulose
membrane. The transfer was performed in a buffer containing
Tris-glycine-methanol (25 mM Tris-HCl, pH 8.3; 192 mM glycine; 20%
methanol) at 0.3 A for 1.5 h. The nitrocellulose membrane was
first treated with TBST (10 mM Tris-HCl, pH 8.0; 50 mM NaCl; 0.05%
Tween 20) containing 5% skim milk at room temperature for 1 h.
The membrane was then incubated with anti-blue fluorescent protein
(BFP) monoclonal antibody (Clontech) at a dilution of 1:4,000 in TBST
at room temperature for 1 h. The blot was washed three times with
TBST and was incubated with anti-mouse immunoglobulin G coupled to
alkaline phosphatase at a dilution of 1:7,500 for 1 h. The blot
was washed three times with TBST and was developed in a solution
containing nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate
(BCIP) (Sigma).
Construction of the BFP-Ndk and mutated BFP-Ndk fusion.
The
ndk gene was amplified by PCR by using plasmid pGWS95 as the
template and NDKN (CTAGTCTAGAGCACTGCAACGC) and
NDKC (CGGGAATTCTCAGCGAATGCGCTC) as primers. The
first primer hybridizes to the 5' end of ndk gene and
contains an XbaI restriction site (underlined). The second primer contains the EcoRI restriction site (underlined) and
hybridizes to the 3' end of the ndk gene. The amplified DNA
was cloned into pGEMTeasy vector (Promega) and was excised by digestion
with XbaI and EcoRI and ligated into pUC19, which
was digested with XbaI and EcoRI. This clone was
used to create an in-frame gene fusion with bfp.
To construct plasmids that allow fusion of
bfp to the 5' end
of the
ndk gene, a fragment of
bfp gene was
amplified by PCR
by using plasmid pBFP2 (Clontech) as the template and
BFPN (ACAT
GCATGCGTACCGGTAGAAAAG)
and BFPC
(CTAG
TCTAGATTTGTATAGTTCATC) as primers. The
first primer
hybridizes to the 5' end of
bfp and contains
the
SphI restriction
site (underlined). The second primer
hybridizes to the 3' end
of the
bfp gene and contains an
XbaI restriction site (underlined).
The amplified DNA was
cloned into the pGEMTeasy vector (Promega)
and was excised out by
digestion with
SphI and
XbaI. This fragment
was
then ligated into the above clone (containing the
ndk gene)
at the
SphI and
XbaI sites to generate the
plasmid pSAK20. The
bfp-ndk gene fusion was then excised
from plasmid pSAK20 by digestion
with
SphI and
EcoRI and was cloned into the
Pseudomonas-compatible
vector pMMB67HE to generate the
plasmid pSAK22. This plasmid was
then introduced into
P. aeruginosa 8821
ndk::Cm mutant by triparental
matings.
Growth and processing of cells for protein localization
experiments.
To prepare cells for protein localization by
immunofluorescence, overnight cultures of the strains were grown in LB
medium containing carbenicillin at a concentration of 400 µg/ml. From the starting inoculum, the culture was inoculated into a flask containing fresh LB medium with 400 µg of carbenicillin per ml and 10 µM isopropyl-
-D-thiogalactopyranoside (IPTG). The
cells were harvested at various growth phases and were processed for immunofluorescence.
For immunofluorescence studies, the cells were fixed by a slight
modification of the procedure described by Weiss et al.
(
35).
A 1-ml sample of the cells was added directly to a
microfuge tube
containing 40 µl of 1 M Na
3PO
4
(pH 7.4) and 200 µl of 16% paraformaldehyde.
Fixation was for 15 min
at room temperature followed by 30 min
on ice. Fixed cells were washed
four times in 1 ml of phosphate-buffered
saline (PBS) and were then
resuspended in 500 µl of PBS. Cells
(10 µl) were applied to 15-well
multitest slides (ICN Biochemicals,
Aurora, Ohio) that had been
pretreated with poly-
L-lysine (Sigma,
St. Louis, Mo.).
After a 10-min interval to allow cells to adsorb
to the slide, the
wells were washed three times with 10 µl of
PBS for 5 min each wash.
To each well, 10 µl of blocking reagent
(2% bovine serum albumin in
PBS) was added and the cells were
incubated at room temperature for 20 min. To each well, 10 µl
of primary antibody at a dilution of 1:50
(monoclonal antibody
to BFP) was added and the cells were incubated at
4°C overnight
in a humid chamber. The cells were then washed three
times with
PBS at room temperature for 5 min each wash. The cells were
further
incubated with the secondary antibody conjugated to Texas Red
at a dilution of 1:100 at room temperature for 30 min. The wells
were
then washed three times with PBS at room temperature for
5 min each
wash, after which they were mounted in Vectashield
(Vector
Labs).
Confocal microscopy.
Images were acquired by using a Carl
Zeiss laser scanning confocal microscope LSM510 equipped with a 100×
oil immersion objective. A single 568-nm beam from an argon-krypton
laser was used for excitation. The emission from rhodamine
isothiocyanate (RITC) was detected through an LP590 filter. At the same
time, the differential interference contrast images were collected. The
collected images were processed by using Adobe Photoshop version 4.0 and were printed on a codonic printer (NP-1600).
 |
RESULTS |
The carboxy-terminal 8 amino acids of Ndk are essential for its
secretion into the extracellular medium.
We have reported recently
that mucoid cells of P. aeruginosa secrete the 16-kDa form
of Ndk into the extracellular environment (39). The amino
acid sequence of Ndk (33) lacks any N-terminal secretion
signal known to be present in proteins secreted by the general
secretory pathway (28). Consequently, it was of interest to
determine the nature of any signal that might be required for Ndk
secretion. In order to see if the carboxy-terminal region may be needed
for secretion, we constructed three carboxy-terminal deletion
derivatives of Ndk by PCR. These derivatives lack, respectively, 21, 14, and 8 amino acid residues from the carboxy terminus. These deletion
constructs were cloned into the plasmid pMMB67HE and were termed
pSAK13, pSAK14, and pSAK15, respectively (Table 1). All these
constructs, as well as pGWS95, which harbors the complete ndk gene as part of plasmid pMMB67HE, were then introduced
into the ndk::Cm knockout mutant. The strains
harboring these constructs were then checked for their ability to
secrete Ndk into the extracellular environment (Fig.
1). It should be noted that deletion of
several carboxy-terminal amino acids does not affect Ndk activity,
since the truncated 12-kDa Ndk, which has been postulated to have lost about 24 amino acids from the carboxy terminus, is fully functional in
generating nucleoside triphosphates (NTPs) from nucleoside diphosphates
(NDPs) (32). The results in Fig. 1 demonstrate that the
cell-free supernatant (growth medium) of either the
ndk::Cm mutant (lane 3) or the
ndk::Cm mutant harboring plasmid pSAK13, pSAK14,
or pSAK15 (lanes 4, 5, and 6) exhibits no Ndk activity with regard to
production of NTPs from NDPs. The ndk::Cm mutant harboring pMMB67HE (vector control) showed similar results. The band
comigrating with CTP is radioactive ADP produced by the combined activity of secreted adenylate kinase and 5' nucleotidase (phosphatase) enzymes (39). Introduction of pGWS95 harboring the intact
ndk gene, however, restores Ndk secretion (Fig. 1, lane 7).
Thus, truncation by a minimum of eight carboxy-terminal amino acid
residues completely inhibits Ndk secretion.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 1.
Lack of secretability of various truncated forms of Ndk
missing their C-terminal 8, 14, or 21 amino acids. All reactions
contained [ -32P]ATP and a mixture of 100 µM each
CDP, GDP, and UDP. Lane 1, [ -32P]ATP control; lane 2, purified cytoplasmic Ndk; lane 3, cell-free supernatant (growth medium)
of ndk::Cm mutant; lane 4, cell-free supernatant
of ndk::Cm mutant harboring plasmid pSAK13;
lane 5, cell-free supernatant of ndk::Cm mutant
harboring plasmid pSAK14; lane 6, cell-free supernatant of
ndk::Cm mutant harboring plasmid pSAK15; lane 7, cell-free supernatant of ndk::Cm mutant harboring
plasmid pGWS95 (wild-type ndk gene). Note that the band
migrating at the position of CTP in lanes 3, 4, 5, and 6 represents
[32P]ADP formed by the combined action of secreted 5'
nucleotidase (phosphatase) and adenylate kinase from the
ndk::Cm mutant on [ -32P]ATP
as reported earlier (39).
|
|
In order to confirm that our inability to detect extracellular Ndk was
not due to instability of the protein, we expressed
the mutant protein
and examined its stability in vitro in the
presence of the growth
medium of the
ndk::Cm mutant by Western
blotting.
No degradation of the enzyme was observed, suggesting
that the absence
of the mutant protein in the cell-free supernatant
was not due to a
lack of stability. We also checked intracellular
Ndk activity in the
ndk::Cm mutant harboring plasmid pSAK15 (lacking
8 amino acid residues) or pGWS95 (complete
ndk gene). While
the
ndk::Cm mutant has no intracellular Ndk
activity as measured in
the partially purified cell extract (Fig.
2, lane 2), considerable
Ndk activity is
present in partially purified cell extracts of
both
ndk::Cm/pSAK15 and
ndk::Cm/pGWS95 cells (Fig.
2, lanes 3
and 4).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of intracellular Ndk activity in the
ndk::Cm mutant harboring the
8-amino-acid-truncated form of Ndk and the complete Ndk. All reactions
contained [ -32P]ATP and a mixture of 100 µM each
CDP, GDP, and UDP. Lane 1, [ -32P]ATP control; lane 2, 45 to 70% ammonium sulfate fraction of the cell extract of
ndk::Cm mutant; lane 3, 45 to 70% ammonium
sulfate fraction of the cell extract of ndk::Cm
mutant expressing the truncated form of Ndk lacking its C-terminal 8 amino acids; lane 4, 45 to 70% ammonium sulfate fraction of the cell
extract of ndk::Cm mutant expressing the complete
Ndk protein. The 45 to 70% ammonium sulfate fraction was previously
shown to harbor Ndk activity during Ndk purification (33).
Equal amounts of proteins from the ammonium sulfate fractions were used
in lanes 2, 3, and 4.
|
|
A 4-amino-acid motif located in the carboxy terminus of Ndk is
required for its secretion.
Since the terminal 8 amino acid
residues were essential for Ndk secretion, we looked at this region to
see if it had any characteristic motif present. Recently, motifs
comprised of 4 amino acids (DXXX, where X is a predominantly
hydrophobic amino acid) located in the carboxy terminus of proteins
have been implicated in the secretability of proteins which are
secreted by the type I machinery. Examples of these proteins are the
Erwinia chrysanthemi metalloproteases PrtA, -B, and -C
(15) and the P. aeruginosa alkaline protease (18). Interestingly, Ndk appears to harbor such a motif,
which is DTEV, in its carboxy-terminal region (Fig.
3). In order to see if this motif was
essential for secretion of Ndk, we constructed two fusions at the 5'
end of the ndk gene with the BFP gene. The first construct
was the fusion of the wild-type ndk gene in frame with the
bfp gene. The second construct was the fusion of the mutated
ndk gene with the bfp gene. The mutated BFP-Ndk
fusion protein had the DTEV motif replaced with AAAA. These fusions
were then cloned into the plasmid pMMB67HE to generate plasmids pSAK22 (wild-type bfp-ndk) and pSAK30 (mutated bfp-ndk).
These constructs were then introduced into the
ndk::Cm mutant. These strains were assayed for the
presence of extracellular Ndk by measuring NTP-synthesizing activity.
The extracellular Ndk activity was detected in the
ndk::Cm mutant expressing the wild-type BFP-Ndk
fusion protein (Fig. 4A, lane 4), but
this activity was not detected in the ndk::Cm
mutant expressing the mutated BFP-Ndk fusion protein (Fig. 4B, lane 4). This indicates that the DTEV motif is important for secretion of Ndk.
The possibility that the DTEV mutant protein was unstable because of
defective folding was checked by incubating the mutant protein for 40 min with the cell-free supernatant. The enzyme was stable under such
conditions.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 3.
Presence of the DXXX motif in the C-terminal region of
Ndk. The complete amino acid sequence of Ndk (33) with two
such putative motifs, shown in bold letters, is depicted.
|
|

View larger version (118K):
[in this window]
[in a new window]
|
FIG. 4.
(A) Ability of the wild-type BFP-Ndk protein to be
secreted into the cell-free supernatant medium. All reactions contained
[ -32P]ATP and a mixture of 100 µM each CDP, GDP, and
UDP. Lane 1, [ -32P]ATP control; lane 2, purified
cytoplasmic Ndk; lane 3, cell-free supernatant of
ndk::Cm mutant; lane 4, cell-free supernatant of
ndk::Cm mutant expressing the wild-type BFP-Ndk
protein. (B) Inability of the C-terminally mutated BFP-Ndk protein to
be secreted into the cell-free supernatant medium. All reactions
contained [ -32P]ATP and a mixture of 100 µM each
CDP, GDP, and UDP. Lane 1, [ -32P]ATP control; lane
2, purified cytoplasmic Ndk; lane 3, cell-free supernatant of
ndk::Cm mutant; lane 4, cell-free supernatant of
ndk::Cm mutant expressing the mutated BFP-Ndk
protein.
|
|
Detection of intracellular wild-type and mutated BFP-Ndk fusion
proteins by immunoblotting.
To ensure that the fusion proteins are
indeed expressed and are stable, a Western blot analysis of the
intracellular extracts and extracellular supernatants of
ndk::Cm mutant/pSAK22 and
ndk::Cm mutant/pSAK30 was performed. As seen
in Fig. 5, lanes 3 and 5, a 43-kDa
BFP-Ndk fusion protein was detected in the supernatant and membrane
fractions of the ndk::Cm mutant expressing the
wild-type BFP-Ndk fusion protein. In contrast, the mutated 43-kDa
BFP-Ndk fusion protein was detected in the membrane fraction but not in the cell-free supernatant of the ndk::Cm
mutant expressing the mutated BFP-Ndk fusion protein (Fig. 5, lanes 8 and 6), as was demonstrated earlier by the NTP-synthesizing assay of
the mutated BFP-Ndk protein (Fig. 4B).

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 5.
Immunoblotting to detect the intracellular wild-type
BFP-Ndk and mutated BfP-Ndk proteins in the
ndk::Cm mutant harboring the plasmids pSAK22 and
pSAK30. To prepare cell extracts for protein detection by
immunoblotting, overnight cultures of the respective strains were grown
in LB medium containing carbenicillin at a concentration of 400 µg/ml. From this starting inoculum, 2% of the culture was inoculated
into a flask containing fresh LB medium with carbenicillin (400 µg/ml). The cells were induced with 1 mM IPTG at an optical density
at 600 nm of 0.6, and the cells were harvested 3 h after
induction. Lane 1, low-molecular-weight markers; lane 2, purified GFP
protein (the antibodies used for BFP and GFP are the same); lane 3, cell-free supernatant of ndk::Cm mutant/pSAK22;
lane 4, cytoplasmic fraction of ndk::Cm
mutant/pSAK22; lane 5, membrane fraction of
ndk::Cm mutant/pSAK22; lane 6, cell-free
supernatant of ndk::Cm mutant/pSAK30; lane 7, cytoplasmic fraction of ndk::Cm mutant/pSAK30;
lane 8, membrane fraction of ndk::Cm
mutant/pSAK30. About 5 µg of protein was loaded in each case.
|
|
Membrane localization of Ndk and secretion of Ndk are not
interdependent.
The detection of the BFP-Ndk fusion protein in the
membrane fraction (Fig. 5, lane 5) confirms our earlier observation
that Ndk exists in P. aeruginosa strain 8830 in the membrane
fractions, particularly at high cell density (32). Since our
previous observations suggested that the secreted Ndk is 16 kDa in size
(39), while the 12-kDa truncated form is obtained when the
membrane-associated Ndk is cleaved by the periplasmic elastase
(20), it was of interest to see if membrane association and
secretion of Ndk are coupled. To address this question, we performed
immunofluorescence microscopy with the ndk::Cm
mutant strains expressing the wild-type and mutated BFP-Ndk fusion
proteins taken from logarithmic and stationary phases of growth.
In both cases, the wild-type BFP-Ndk protein and the mutated BFP-Ndk
protein were seen to be localized to the membrane (Fig.
6). As a control, we also carried out
immunofluorescence microscopy
with the
ndk::Cm
mutant expressing only the
bfp gene. In this
case, BFP was
detected everywhere in the cell and was not localized
to any specific
region (data not shown). This suggests that secretion
and membrane
localization are independent events and that mutation
of the
carboxy-terminal DTEV motif inhibits secretion while having
no effect
on membrane localization of Ndk.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Immunofluorescence microscopy at different growth
stages of the ndk::Cm mutant expressing the
wild-type BFP-Ndk protein. The cells were processed for
immunofluorescence microscopy as described in Materials and Methods.
Only mid-log- to stationary-phase cultures are shown. On the top left
are the ndk::Cm mutant cells with wild-type
BFP-Ndk protein that fluoresces red because of Texas Red-conjugated
secondary antibody being bound to anti-BFP antibody cross-reacting with
the membrane-associated BFP-Ndk fusion protein. On the top right are
the pictures of the cells using differential interference contrast, and
in the bottom left, the red fluorescence is superimposed on the cells.
(B) Immunofluorescence microscopy at different growth stages of the
ndk::Cm mutant expressing the mutated BFP-Ndk
protein. The cells were processed for immunofluorescence microscopy as
described in Materials and Methods and explained in the legend to Fig.
6A.
|
|
 |
DISCUSSION |
The secretion of Ndk by mucoid P. aeruginosa 8821 but
not by the nonmucoid strain PAO1 (39) raises interesting
questions. We previously reported the membrane localization as well as
cytoplasmic location of Ndk in the mucoid strain 8821 (32).
An important question, therefore, is whether membrane localization is a
prerequisite for secretion. Since Ndk lacks a type II secretion signal
at the N-terminal end, we looked for other secretion motifs. We noted that the carboxy terminus of Ndk has the DXXX motif present in proteins which are secreted by the type I secretory pathway present in gram-negative organisms. These proteins lack the N-terminal signal
peptide and are usually transported by the signal-peptide-independent pathway and bypass the periplasm. The proteins secreted through this
signal-peptide-independent pathway lack extensive regions of homology
but share several common features. (i) Most of them possess a
glycine-rich repeated motif close to their COOH terminus (36), but the role of these repeats in secretion is quite
questionable. These repeats are not involved in secretion of small
proteins but might be required for secretion of high-molecular-weight
fusion proteins (27). (ii) They are secreted via similar
membrane transporters composed of two inner membrane proteins and an
outer membrane protein. (iii) There is a significant level of sequence
homology between the protein components of these secretion systems,
which are partially interchangeable (25). (iv) One of the
inner membrane components has a conserved ATP-binding cassette (ABC)
and is a member of a superfamily of transporters involved in the
translocation of diverse substrates across membranes in both
prokaryotes and eukaryotes (19). (v) In nearly all the cases
studied so far, deletion analysis demonstrated that the secretion
signal is located in the COOH-terminal part of these proteins (7,
14).
Similar to proteins secreted by a type I mechanism, deletion of the
carboxy-terminal 8 amino acids of Ndk results in complete inhibition of
secretion. Mutational alterations of these residues also result in
inhibition of secretion. It appears that the carboxy-terminal 8 amino
acids are essential for Ndk secretion. The upstream and downstream
regions of the ndk gene do not show the presence of any
genes coding for the ABC-type secretory components. It is possible that
Ndk uses a heterologous secretion machinery. Secretion of extracellular
proteins by heterologous secretion systems is a well-known phenomenon.
The Prt system, composed of PrtD-PrtE-PrtF, which promotes
E. chrysanthemi metalloprotease secretion
(25), has been reported to similarly promote the secretion
of Serratia marcescens PrtA and the P. aeruginosa
alkaline protease (11, 18, 26). The secretion of
Pseudomonas fluorescens lipase (34) is known to
be facilitated by the P. aeruginosa alkaline protease secretion pathway AprDEF (12). Some hybrid exporters, which are composed of parts of the Lip, Prt, and Has systems, have also been
reported to allow the secretion of secretory proteins, demonstrating that the secretion specificity depends largely on the ABC protein (1, 4).
The carboxy-terminal site-directed mutations of the ndk
gene, while inhibiting secretion, do not affect membrane localization of the Ndk protein. Thus, the motif might be involved in allowing secretion of Ndk after its membrane localization. The 16-kDa size of
the secreted Ndk suggests that the Ndk escapes cleavage by periplasmic
elastase (20), presumably by bypassing the periplasmic space
during secretion. Recently, there has been a report about dehalogenases
like LinA and LinB of Sphingomonas paucimobilis UT26 being
exported into the periplasm in a sec-independent mechanism (30). These proteins lack the N-terminal signal peptides
present in proteins which are secreted into the periplasmic space.
Thus, reports about proteins being secreted by novel secretion systems are being published, though the exact mechanism of secretion remains unknown. In addition, it has been shown that the flagellum export apparatus in Yersinia enterocolitica, consisting of only the
basal body and hook, is capable of functioning as a secretion system for export of virulence-associated enzymes (37). Based on
the results presented in this report, it is fair to speculate that Ndk
has a carboxy-terminal motif that makes it secretion competent. It
appears to resemble the motif present in proteins secreted by the type
I secretory system, though it is not present at the extreme C-terminal
end of the protein. Further investigation is needed to understand the
mechanism of secretion of Ndk or the involvement of chaperones such as
DnaK in the process (3).
 |
ACKNOWLEDGMENTS |
We thank Vinayak Kapatral for helpful discussions pertaining to
this study. We also thank Dianah Jones-James for her help in typing the manuscript.
This work was supported by Public Health Service grant AI 16790-20 from
the National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, M/C 790, University of Illinois College of
Medicine, 835 S. Wolcott Ave., Chicago, IL 60612. Phone: (312) 996-4586. Fax: (312) 996-6415. E-mail:
Ananda.Chakrabarty{at}uic.edu.
 |
REFERENCES |
| 1.
|
Akatsuka, H.,
R. Binet,
E. Kawai,
C. Wandersman, and K. Omori.
1997.
Lipase secretion by bacterial hybrid ATP-binding cassette exporters: molecular recognition of the LipBCD, PrtDEF, and HasDEF exporters.
J. Bacteriol.
179:4754-4760[Abstract/Free Full Text].
|
| 2.
|
Al-AwQati, Q.
1995.
Regulation of ion channels by ABC transporters that secrete ATP.
Science
269:805-806[Free Full Text].
|
| 3.
|
Barthel, T. K., and G. C. Walker.
1999.
Inferences concerning the ATPase properties of DnaK and other HSP70s are affected by the ADP kinase of copurifying nucleoside-diphosphate kinase.
J. Biol. Chem.
274:36670-36678[Abstract/Free Full Text].
|
| 4.
|
Binet, R., and C. Wandersman.
1995.
Protein secretion by hybrid bacterial ABC-transporters: specific functions of the membrane ATPase and the membrane fusion protein.
EMBO J.
14:2298-2306[Medline].
|
| 5.
|
Chakrabarty, A. M.
1998.
Nucleoside diphosphate kinase: role in bacterial growth, virulence, cell signalling and polysaccharide synthesis.
Mol. Microbiol.
28:875-882[CrossRef][Medline].
|
| 6.
|
Chopade, B. A.,
S. Shankar,
G. W. Sundin,
S. Mukhopadhyay, and A. M. Chakrabarty.
1997.
Characterization of membrane-associated Pseudomonas aeruginosa Ras-like protein, Pra, a GTP-binding protein that forms complexes with truncated nucleoside diphosphate kinase and pyruvate kinase to modulate GTP synthesis.
J. Bacteriol.
179:2181-2188[Abstract/Free Full Text].
|
| 7.
|
Delepelaire, P., and C. Wandersman.
1990.
Protein secretion in gram-negative bacteria. The extracellular metalloprotease B from Erwinia chrysanthemi contains a C-terminal secretion signal analogous to that of Escherichia coli -hemolysin.
J. Biol. Chem.
265:17118-17125[Abstract/Free Full Text].
|
| 8.
|
DiVirgilio, F.
1995.
The P2Z purino receptor: an intriguing role in immunity, inflammation and cell death.
Immunol. Today
16:524-528[CrossRef][Medline].
|
| 9.
|
Doggett, R. G.,
G. M. Harrison,
R. N. Stillwell, and E. S. Wallis.
1966.
An atypical Pseudomonas aeruginosa associated with cystic fibrosis of the pancreas.
J. Pediatr.
68:215-221[CrossRef].
|
| 10.
|
Dubyak, G. R., and C. El-Motassim.
1993.
Signal transduction via P2-purinergic receptors for extracellular ATP and other nucleotides.
Am. J. Physiol.
265:577-606.
|
| 11.
|
Duong, F.,
A. Lazdunski,
B. Cami, and M. Murgier.
1992.
Sequence of a cluster of genes controlling synthesis and secretion of alkaline protease in Pseudomonas aeruginosa: relationships to other secretory pathways.
Gene
121:47-54[CrossRef][Medline].
|
| 12.
|
Duong, F.,
C. Soscia,
A. Lazdunski, and M. Murgier.
1994.
The Pseudomonas fluorescens lipase has C-terminal secretion signal and is secreted by a three-component bacterial ABC-exporter system.
Mol. Microbiol.
11:1117-1126[CrossRef][Medline].
|
| 13.
|
Figurski, D. H., and D. R. Helinski.
1979.
Replication of an origin-containing derivative of plasmid RK2 dependent on plasmid function provided in trans.
Proc. Natl. Acad. Sci. USA
76:1648-1652[Abstract/Free Full Text].
|
| 14.
|
Ghigo, J.-M., and C. Wandersman.
1992.
Cloning, nucleotide sequence and characterization of the gene encoding the Erwinia chrysanthemi B374 PrtA metalloprotease: a third metalloprotease secreted via a C-terminal secretion signal.
Mol. Gen. Genet.
236:135-144[CrossRef][Medline].
|
| 15.
|
Ghigo, J.-M., and C. Wandersman.
1994.
A carboxy-terminal four-amino acid motif is required for the secretion of the metalloprotease PrtG through the Erwinia chrysanthemi protease secretion pathway.
J. Biol. Chem.
269:8979-8985[Abstract/Free Full Text].
|
| 16.
|
Govan, J. R. W., and J. Nelson.
1992.
Microbiology of lung infection in cystic fibrosis.
Br. Med. Bull.
48:912-930[Abstract/Free Full Text].
|
| 17.
|
Guidotti, G.
1996.
ATP transport and ABC proteins.
Chem. Biol.
3:703-706[CrossRef][Medline].
|
| 18.
|
Guzzo, J.,
F. Duong,
C. Wandersman,
M. Murgier, and A. Lazdunski.
1991.
The secretion genes of Pseudomonas aeruginosa alkaline protease are functionally related to those of Erwinia chrysanthemi proteases and Escherichia coli -haemolysin.
Mol. Microbiol.
5:447-453[Medline].
|
| 19.
|
Higgins, C. F.
1992.
ABC transporters from microorganisms to man.
Annu. Rev. Cell Biol.
8:67-113[CrossRef].
|
| 20.
|
Kamath, S.,
V. Kapatral, and A. M. Chakrabarty.
1998.
Cellular function of elastase in Pseudomonas aeruginosa: role in the cleavage of nucleoside diphosphate kinase and in alginate synthesis.
Mol. Microbiol.
30:933-942[CrossRef][Medline].
|
| 21.
|
Kimura, N., and N. Shimada.
1988.
Membrane-associated nucleoside diphosphate kinase from rat liver.
J. Biol. Chem.
263:4647-4653[Abstract/Free Full Text].
|
| 22.
|
Koch, C., and N. Hoiby.
1993.
Pathogenesis of cystic fibrosis.
Lancet
341:1065-1069[CrossRef][Medline].
|
| 23.
|
Lammas, D. A.,
C. Stober,
C. J. Harvey,
N. Kendrick,
S. Panchalingan, and D. S. Kumararatne.
1997.
ATP-induced killing of mycobacteria by human macrophages is mediated by purinergic P2Z (P2X7) receptors.
Immunity
7:433-444[CrossRef][Medline].
|
| 24.
|
Lazarowski, E. R.,
L. Homolya,
R. C. Boucher, and T. K. Harden.
1997.
Identification of an ecto-nucleoside diphosphokinase and its contribution to interconversion of P2 receptor agonists.
J. Biol. Chem.
272:20402-20407[Abstract/Free Full Text].
|
| 25.
|
Letoffe, S.,
P. Delepelaire, and C. Wandersman.
1990.
Protease secretion by Erwinia chrysanthemi: the specific secretion functions are analogous to those of Escherichia coli -haemolysin.
EMBO J.
9:1375-1382[Medline].
|
| 26.
|
Letoffe, S.,
P. Delepelaire, and C. Wandersman.
1991.
Cloning and expression in Escherichia coli of the Serratia marcescens metalloprotease gene: secretion of the protease from E. coli in the presence of Erwinia chrysanthemi protease secretion functions.
J. Bacteriol.
173:2160-2166[Abstract/Free Full Text].
|
| 27.
|
Letoffe, S., and C. Wandersman.
1992.
Secretion of CyaA-Prtb and HlyA-PrtB fusion proteins in Escherichia coli: involvement of the glycine-rich repeat domain of Erwinia chrysanthemi protease B.
J. Bacteriol.
174:4920-4927[Abstract/Free Full Text].
|
| 28.
|
Lory, S.
1998.
Secretion of proteins and assembly of bacterial surface organelles: shared pathways of extracellular protein targeting.
Curr. Opin. Microbiol.
1:27-35[CrossRef][Medline].
|
| 29.
|
May, T. B.,
D. Shinaberger,
R. Maharaj,
J. Kato,
L. Chu,
J. D. DeVault,
S. Roychoudhury,
N. A. Zielinski,
A. Berry,
R. K. Rothmel,
T. K. Misra, and A. M. Chakrabarty.
1991.
Alginate synthesis by Pseudomonas aeruginosa: a key pathogenic factor in chronic pulmonary infections in cystic fibrosis patients.
Clin. Microbiol. Rev.
4:191-206[Abstract/Free Full Text].
|
| 30.
|
Nagata, Y.,
A. Futamura,
K. Miyauchi, and M. Takagi.
1999.
Two different types of dehalogenases, LinA and LinB, involved in gamma-hexachlorocyclohexane degradation in Sphingomonas paucimobilis UT26 are localized in the periplasmic space without periplasmic processing.
J. Bacteriol.
181:5409-5413[Abstract/Free Full Text].
|
| 31.
|
Pier, G. B.
1998.
Pseudomonas aeruginosa: a key problem in cystic fibrosis.
ASM News
64:339-347.
|
| 32.
|
Shankar, S.,
S. Kamath, and A. M. Chakrabarty.
1996.
Two forms of nucleoside diphosphate kinase of Pseudomonas aeruginosa 8830: altered specificity of nucleoside triphosphate synthesis by the cell membrane-associated form of the truncated enzyme.
J. Bacteriol.
178:1777-1781[Abstract/Free Full Text].
|
| 33.
|
Sundin, G. W.,
S. Shankar,
S. A. Chugani,
B. Chopade,
A. Kavanaugh-Black, and A. M. Chakrabarty.
1996.
Nucleoside diphosphate kinase from Pseudomonas aeruginosa: characterization of the gene and its role in cellular growth and exopolysaccharide alginate synthesis.
Mol. Microbiol.
20:965-979[CrossRef][Medline].
|
| 34.
|
Tan, Y., and K. J. Miller.
1992.
Cloning, expression, and nucleotide sequence of a lipase gene from Pseudomonas fluorescens B52.
Appl. Environ. Microbiol.
58:1402-1407[Abstract/Free Full Text].
|
| 35.
|
Weiss, D. S.,
J. C. Chen,
J. M. Ghigo,
D. Boyd, and J. Beckwith.
1999.
Localization of FtsI (PBP3) to the septal ring requires its membrane anchor, the Z ring, FtsA, FtsQ, and FtsL.
J. Bacteriol.
181:508-520[Abstract/Free Full Text].
|
| 36.
|
Welch, R. A.
1991.
Pore forming cytolysins of gram negative bacteria.
Mol. Microbiol.
5:521-528[Medline].
|
| 37.
|
Young, G. M.,
D. H. Schmiel, and V. L. Miller.
1999.
A new pathway for the secretion of virulence factors by bacteria: the flagellar export apparatus functions as a protein-secretion system.
Proc. Natl. Acad. Sci. USA
96:6456-6461[Abstract/Free Full Text].
|
| 38.
|
Zaborina, O.,
X. Li,
G. Cheng,
V. Kapatral, and A. M. Chakrabarty.
1999.
Secretion of ATP-utilizing enzymes, nucleoside diphosphate kinase and ATPase, by Mycobacterium bovis BCG: sequestration of ATP from macrophage P2Z receptors?
Mol. Microbiol.
31:1333-1343[CrossRef][Medline].
|
| 39.
|
Zaborina, O.,
N. Misra,
J. Kostal,
S. Kamath,
V. Kapatral,
M. El-Azami El-Idrissi,
B. S. Prabhakar, and A. M. Chakrabarty.
1999.
P2Z-independent and P2Z receptor-mediated macrophage killing by Pseudomonas aeruginosa isolated from cystic fibrosis patients.
Infect. Immun.
67:5231-5242[Abstract/Free Full Text].
|
| 40.
|
Zimmermann, H.
1996.
Extracellular purine metabolism.
Drug Dev. Res.
39:337-352[CrossRef].
|
Journal of Bacteriology, July 2000, p. 3826-3831, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yilmaz, O.
(2008). The chronicles of Porphyromonas gingivalis: the microbium, the human oral epithelium and their interplay. Microbiology
154: 2897-2903
[Abstract]
[Full Text]
-
Punj, V., Zaborina, O., Dhiman, N., Falzari, K., Bagdasarian, M., Chakrabarty, A. M.
(2000). Phagocytic Cell Killing Mediated by Secreted Cytotoxic Factors of Vibrio cholerae. Infect. Immun.
68: 4930-4937
[Abstract]
[Full Text]