Previous Article
Journal of Bacteriology, July 2000, p. 3881-3884, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Mycobacterium smegmatis Has Two
Pyrazinamidase Enzymes, PncA and PzaA
Ming
Guo,
Zhonghe
Sun, and
Ying
Zhang*
Department of Molecular Microbiology and
Immunology, School of Hygiene and Public Health, Johns Hopkins
University, Baltimore, Maryland 21205
Received 9 February 2000/Accepted 31 March 2000
 |
ABSTRACT |
The Mycobacterium smegmatis pncA gene, encoding
nicotinamidase/pyrazinamidase, was identified. While it was similar to
counterparts from other mycobacteria, the M. smegmatis PncA
had little homology to the other M. smegmatis
pyrazinamidase/nicotinamidase, encoded by the pzaA gene.
Transformation of Mycobacterium bovis strain BCG with
M. smegmatis pncA or pzaA conferred
susceptibility to pyrazinamide.
| |
TEXT |
Pyrazinamide (PZA), an important
frontline tuberculosis drug, is a structural analog of nicotinamide.
Nicotinamide and PZA are converted to nicotinic acid and pyrazinoic
acid (POA), respectively, by the same enzyme,
nicotinamidase/pyrazinamidase (PZase) (6, 13), although the
enzyme converts the latter less efficiently, at least in the case of
Mycobacterium tuberculosis (18). PZA is a prodrug
that must be converted to the active form POA by the bacterial PZase in
order to inhibit M. tuberculosis (6, 13). Loss of
this enzyme activity is closely associated with development of PZA
resistance in M. tuberculosis (6, 9, 11, 20). We
have identified the nicotinamidase/PZase gene pncA, encoding
a 20-kDa protein (13), and have shown that mutation in
pncA is the major mechanism of PZA resistance in clinical
isolates of M. tuberculosis (2, 15, 16). This
finding has been confirmed by other studies (5, 7, 8, 10).
To identify the PZase that is involved in PZA susceptibility, Boshoff
and Mizrahi identified a PZase/nicotinamidase gene, pzaA,
from naturally PZA resistant Mycobacterium smegmatis
(1). The pzaA gene encodes a 50-kDa protein that
does not have significant homology to the 20-kDa mycobacterial PncA
proteins. Overexpression of PzaA on a multicopy plasmid conferred
increased susceptibility to PZA in M. smegmatis. However,
mutant strains of M. smegmatis with inactivated
pzaA genes still had residual PZase activity (1),
indicating the presence of some other PZase enzyme(s) in this organism.
To account for the additional PZase activity in M. smegmatis, in this study, we identified the pncA gene,
encoding a second nicotinamidase/PZase in M. smegmatis.
Identification of two PZase activities in M. smegmatis.
Protein extracts from M. smegmatis strain mc26
(kindly provided by Bill Jacobs) were prepared as described elsewhere
(23). Soluble protein extracts were loaded on a Bio-Gel P100
(Bio-Rad) size exclusion column, which was washed with 20 mM potassium
phosphate buffer (pH 7.2) containing 1 mM EDTA. Various fractions were
collected and assayed for PZase activity as described elsewhere
(18). Molecular masses of enzymes were determined according
to a standard curve established with known molecular weight markers
(Bio-Rad). Two distinct PZase activities with molecular masses of 20 and 100 kDa in M. smegmatis were identified (Fig.
1). The 100-kDa PZase activity was about
five- to sixfold higher than the 20-kDa enzyme activity in the soluble
extracts as assessed by densitometry of autoradiography. The 100-kDa
activity is most likely a dimer form of the PzaA enzyme with a monomer
molecular mass of 50 kDa (1). Protein sequencing of the
20-kDa activity was unsuccessful. The 20-kDa PZase activity
cross-reacted with a polyclonal antiserum raised against the M. tuberculosis PncA protein (data not shown). The cross-reactivity
with the antiserum against M. tuberculosis PncA and the
concordant molecular mass suggest that the 20-kDa activity is the PncA
enzyme of M. smegmatis. However, the 20-kDa PZase activity
was not identified in a previous study (1), probably because
a 30-kDa cutoff was used in the purification scheme such that the
20-kDa PncA of M. smegmatis (see below) was missed.
View larger version (44K):
[in this window]
[in a new window]
|
FIG. 1.
Two PZase activities in M. smegmatis. Various
fractions from the Bio-Gel P100 column were tested for PZase activity
using [14C]PZA followed by thin-layer chromatography and
autoradiography as described elsewhere (18). Two distinct
PZase activities were identified in M. smegmatis extracts.
|
|
Cloning and sequence analysis of the M. smegmatis pncA
gene.
To identify the M. smegmatis pncA gene, we
amplified a partial pncA DNA fragment (about 394 bp) by PCR
from M. smegmatis strain mc26 genomic DNA, using
degenerate primers. The forward primer (5'CARAAYGAYTTYTGYGARGG3') was designed according to conserved amino acid sequence QNDFCEG at positions 10 to 16 of the mycobacterial PncA proteins
(18). The reverse primer
(5'GCCGACSACRTCSACMTCGTC3') was designed according to
conserved amino acid sequence DEVDVVG at positions 126 to 132. PCR was
performed as described elsewhere (12); conditions were as
follows: 95°C for 5 min, followed by 35 cycles of 95°C for 1 min,
50°C for 1 min, and 72°C for 1 min. Sequence analysis indicated that the PCR product had a high degree of homology to the known mycobacterial PncA proteins (data not shown). The M. smegmatis pncA PCR product was used as a probe to screen an M. smegmatis 
ZAPII phage DNA library to obtain the complete
pncA gene. A positive clone with a 2.6-kb DNA insert
containing the M. smegmatis pncA gene was identified. The
2.6-kb insert was obtained by PCR using T7 and T3 primers complementary
to the ZAPII vector and was subcloned into the pCR2.1 vector
(Invitrogen) for DNA sequencing.
Sequence analysis indicated that the
M. smegmatis pncA gene
encoded a protein of 187 amino acids with a predicted mass of
19,785.91 Da. The
M. smegmatis PncA had 75, 71, 69, and 33% amino
acid identities to its counterparts from
M. tuberculosis,
Mycobacterium kansasii,
Mycobacterium avium, and
Escherichia coli, respectively.
It is interesting that while
M. smegmatis PncA and PzaA both have
PZase and
nicotinamidase activities, they share little homology.
The overall
amino acid identity between the two proteins is 16.2%.
A Block Maker
homology search (Baylor College of Medicine search
launcher) identified
four regions of homology between
M. smegmatis PncA and PzaA
protein sequences (Fig.
2), which may be
the basis
for the PZase and nicotinamidase activities of both enzymes.
Comparative
crystallography studies are needed to understand the common
mechanistic
feature of the two enzymes.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Regions of conservation between M. smegmatis
PncA and PzaA. Block Maker analysis of M. smegmatis PncA and
PzaA shows the conserved amino acid residues in the two enzymes.
|
|
Presence of pncA homologs in mycobacteria.
Mycobacterial genomic DNA was digested with BamHI and
subjected to Southern blot analysis as described elsewhere
(21). The DNA probe used was the 394-bp M. smegmatis
pncA PCR product labeled with [32P]dCTP. After
hybridization, the blot was washed under low stringency. The M. smegmatis pncA probe hybridized with a 1.6-kb BamHI
fragment from M. avium (ATCC 25291) (Fig.
3, lane 4). In a previous study (17), hybridization of M. tuberculosis pncA with
genomic DNA from M. smegmatis was not detected, presumably
because the hybridization condition was too stringent for detection of
any hybridization signal. However, with very low stringency washing at
room temperature, the M. smegmatis pncA probe hybridized
faintly with a 5-kb fragment from Mycobacterium bovix
BCG-Pasteur and M. tuberculosis strains H37Ra and H37Rv
(Fig. 3, lanes 1 to 3). The M. smegmatis pncA probe
hybridized strongly with a fragment of more than 10 kb (lane 6) with
M. smegmatis itself but failed to hybridize to genomic DNA
from M. kansasii (ATCC 12478) (lane 5).
View larger version (94K):
[in this window]
[in a new window]
|
FIG. 3.
Southern blot analysis of pncA homologs in
mycobacteria using an M. smegmatis pncA probe. Lanes: 1, M. bovis BCG-Pasteur; 2, M. tuberculosis H37Ra;
3, M. tuberculosis H37Rv; 4, M. avium; 5, M. kansasii; 6, M. smegmatis.
|
|
Transformation of BCG with M. smegmatis pncA or
pzaA produced functional PZase and nicotinamidase
activities and restored PZA susceptibility.
The pncA
and pzaA plasmid constructs for transformation of M. bovis BCG were made as follows. The PCR forward primer
(5'GGAGGTACCTCTACGCGCAGACGTGATGCTCGC3') was from
248 to 221 bp upstream of M. smegmatis pncA. The reverse primer (5'GCTGGTACCGGTGTTGCAATCATCACCCG3') was
from 16 bp downstream of the M. smegmatis pncA stop codon.
These pncA primers produced a PCR product of 839 bp. The
1,688-bp DNA fragment containing the M. smegmatis pzaA gene
(GenBank accession no. AF058285) and its promoter was amplified by PCR
using a forward primer
(5'GAGGGTACCAGCGAGGAGACCCATGTCCG3') from 145 bp
upstream of the pzaA start codon and a reverse primer (5'CCGGGTACCCAGGCCGGTGCCGAGCGCCA3') from 25 bp
downstream of the pzaA stop codon. KpnI sites
(underlined) were incorporated into the PCR primers. The 839- or
1,688-bp PCR fragment containing M. smegmatis pncA or
pzaA, respectively, was cloned into the KpnI site
of the hygromycin mycobacterial shuttle vector p16R1 (4). The p16R1-M. smegmatis pncA and pzaA constructs
and the same vector harboring the M. tuberculosis pncA gene
on a 3.2-kb DNA fragment (13, 17), along with the vector
control, were transformed into naturally PZA resistant M. bovis BCG-Pasteur as described elsewhere (22).
BCG is known to be a natural mutant of PncA with no apparent PZase
activity due to a single change of C to G at nucleotide
169 causing an
amino acid change of His in the
M. tuberculosis enzyme to
Asp in the
M. bovis BCG enzyme (
13,
14). This
feature
allowed us to examine the relative PZase and nicotinamidase
activities
of
M. smegmatis PncA and PzaA, using BCG. The BCG
vector control
had negligible PZase or nicotinamidase activity. The
M. smegmatis pncA and
pzaA constructs produced
5.7- and 4.3-fold higher, respectively,
nicotinamidase activity than
PZase activity in BCG. While the
pzaA construct produced
somewhat less nicotinamidase activity
than the
M. smegmatis
pncA construct, it produced more PZase activity
in BCG (Table
1). However, the difference in PZase
activity of
the
pzaA and
pncA constructs in BCG
(less than twofold) is less
than that for the two enzymes in the
M. smegmatis protein extract
(about five- to sixfold) (Fig.
1). This difference is most likely
due to different promoter activities
of the two constructs in
BCG versus
M. smegmatis. On the
other hand, while the
M. tuberculosis pncA construct
exhibited nicotinamidase activity similar to that
of the
M. smegmatis pncA or
pzaA construct, it produced over
10-fold
less PZase activity than the
M. smegmatis pncA or
pzaA construct
(Table
1).
Transformation of BCG with
M. smegmatis pncA or
pzaA conferred susceptibility to PZA (Table
1). The
susceptibility to PZA
was determined on 7H11 agar plates (pH 5.5)
containing 3.1, 6.2,
12.5, 25, 50, 100, or 500 µg of PZA per ml as
described elsewhere
(
18). It is interesting that BCG
transformed with the
M. smegmatis pncA construct became
highly susceptible to PZA, with an MIC of
3.1 µg/ml, whereas BCG
transformed with the
pzaA construct was
susceptible to 25 µg of PZA per ml. However, the degree of susceptibility
to PZA for
the two constructs did not correlate with the amount
of PZase activity
expressed in BCG (Table
1). It is possible
that the liquid-grown
cultures used for measurement of PZase activity
had bacterial
populations that did not overexpress PZase activity,
which could result
in a difference in the amount of PZase from
the plate-grown bacteria
for determining the MIC. Alternatively,
this may reflect different
effects of overexpression of PzaA versus
PncA on the viability of the
organism in addition to the ability
to convert PZA to
POA.
In this study, we found that
M. smegmatis has a second PZase
activity of 20 kDa encoded by the
pncA gene in addition to
the
50-kDa PZase encoded by the
pzaA gene (
1).
Despite ample PZase
activities,
M. smegmatis is highly
resistant to PZA. We have shown
that this natural PZA resistance of
M. smegmatis relates to its
highly active efflux mechanism
for POA (
23). In contrast, the
susceptible
M. tuberculosis has only a single PZase enzyme encoded
by the
pncA gene. Despite the presence of several PzaA homologs
(AmiD, AmiC, AmiB2, and GatA) in
M. tuberculosis
(
3), they
apparently do not have PZase activity and are not
involved in
PZA action since PZA-resistant
M. tuberculosis
strains with
pncA mutations lack PZase (
6,
9,
11,
20). Mutations of
pncA render
M. tuberculosis deficient in PZase activity and lead to
acquired PZA
resistance because of impaired ability of the enzyme
to convert PZA to
active POA. The unique susceptibility of
M. tuberculosis to
PZA correlates with its defective POA efflux mechanism
(
23).
While overexpressing PzaA on a multicopy plasmid in
M. smegmatis could cause increased susceptibility in this organism
(MIC from over 2,000 to 150 µg of PZA per ml) (
1), we have
shown here that similarly overexpressing PzaA or PncA conferred
much
higher PZA susceptibility in the POA efflux-deficient
M. tuberculosis complex organism BCG (MICs of 25 and 3.1 µg/ml).
Nucleotide sequence accession number.
The M. smegmatis
pncA sequence has been assigned GenBank accession no. AF117900.
| |
ACKNOWLEDGMENTS |
This study was supported by NIH grants (AI40584 and AI44063) and
the Potts Memorial Foundation.
We acknowledge receipt of the ZAPII M. smegmatis genomic
DNA library and [14C]PZA from the NIH AIDS Reagents
Program (Rockville, Md.).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Microbiology and Immunology, School of Hygiene and Public
Health, Johns Hopkins University, 615 N. Wolfe St., Baltimore, MD
21205. Phone: (410) 614-2975. Fax: (410) 955-0105. E-mail:
yzhang{at}jhsph.edu.
| |
REFERENCES |
| 1.
|
Boshoff, H. I. M., and V. Mizrahi.
1998.
Purification, gene cloning, targeted knockout, overexpression, and biochemical characterization of the major pyrazinamidase from Mycobacterium smegmatis.
J. Bacteriol.
180:5809-5814[Abstract/Free Full Text].
|
| 2.
|
Cheng, S. J.,
L. Thibert,
T. Sanchez,
L. Heifets, and Y. Zhang.
2000.
pncA mutations as a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis: spread of a monoresistant strain in Quebec, Canada.
Antimicrob. Agents Chemother.
44:528-532[Abstract/Free Full Text].
|
| 3.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris,
S. V. Gordon,
K. Eiglmeier,
S. Gas,
C. E. Barry,
F. Tekaia,
K. Badcock,
D. Basham,
D. Brown,
T. Chillingworth,
R. Connor,
R. Davies,
K. Devlin,
T. Feltwell,
S. Gentles,
N. Hamlin,
S. Holroyd,
T. Hornsby,
K. Jagels, and B. G. Barrell.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[CrossRef][Medline].
|
| 4.
|
Garbe, T.,
J. Barathi,
S. Barnini,
Y. Zhang,
C. Abou-Zeid,
D. Tang,
R. Mukherjee, and D. Young.
1994.
Transformation of mycobacterial species using hygromycin resistance as selectable marker.
Microbiology
140:133-138[Abstract/Free Full Text].
|
| 5.
|
Hirano, K.,
M. Takahashi,
Y. Kazumi,
Y. Fukasawa, and C. Abe.
1997.
Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis.
Tuber. Lung Dis.
78:117-122[CrossRef][Medline].
|
| 6.
|
Konno, K.,
F. M. Feldman, and W. McDermott.
1967.
Pyrazinamide susceptibility and amidase activity of tubercle bacilli.
Am. Rev. Respir. Dis.
95:461-469[Medline].
|
| 7.
|
Lemaitre, N.,
W. Sougakoff,
C. Truffot-Pernot, and V. Jarlier.
1999.
Characterization of new mutations in pyrazinamide-resistant strains of Mycobacterium tuberculosis and identification of conserved regions important for the catalytic activity of the pyrazinamidase.
Antimicrob. Agents Chemother.
43:1761-1763[Abstract/Free Full Text].
|
| 8.
|
Marttila, H. J.,
M. Marjamaki,
E. Vyshnevskaya,
B. I. Vishnevskiy,
T. F. Otten,
A. V. Vasilyef, and M. K. Viljanen.
1999.
pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis isolates from northwest Russia.
Antimicrob. Agents Chemother.
43:1764-1766[Abstract/Free Full Text].
|
| 9.
|
McClatchy, J. K.,
A. Y. Tsang, and M. S. Cernich.
1981.
Use of pyrazinamidase activity in Mycobacterium tuberculosis as a rapid method for determination of pyrazinamide susceptibility.
Antimicrob. Agents Chemother.
20:556-557[Abstract/Free Full Text].
|
| 10.
|
Mestdagh, M.,
P. A. Fonteyne,
L. Realini,
R. Rossau,
G. Jannes,
W. Mijs,
K. A. L. De Smet,
F. Portaels, and E. Van Den Eeckhout.
1999.
Relationship between pyrazinamide resistance, loss of pyrazinamidase activity, and mutations in the pncA locus in multidrug-resistant clinical isolates of Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
43:2317-2319[Abstract/Free Full Text].
|
| 11.
|
Miller, M.,
L. Thibert,
F. Desjardins,
S. Siddiqi, and A. Dascal.
1995.
Testing of susceptibility of Mycobacterium tuberculosis to pyrazinamide: comparison of Bactec method with pyrazinamidase assay.
J. Clin. Microbiol.
33:2468-2470[Abstract].
|
| 12.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 13.
|
Scorpio, A., and Y. Zhang.
1996.
Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.
Nat. Med.
2:662-667[CrossRef][Medline].
|
| 14.
|
Scorpio, A.,
D. Collins,
D. Whipple,
D. Cave,
J. Bates, and Y. Zhang.
1997.
Rapid differentiation of bovine and human tubercle bacilli based on a characteristic mutation in the bovine pyrazinamidase gene.
J. Clin. Microbiol.
32:106-110.
|
| 15.
|
Scorpio, A.,
P. Lindholm-Levy,
L. Heifets,
R. Gilman,
S. Siddiqi,
M. H. Cynamon, and Y. Zhang.
1997.
Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
41:540-543[Abstract].
|
| 16.
|
Sreevatsan, S.,
X. Pan,
Y. Zhang,
B. Kreiswirth, and J. M. Musser.
1997.
Mutations associated with pyrazinamide resistance in pncA of Mycobacterium tuberculosis complex organisms.
Antimicrob. Agents Chemother.
41:636-640[Abstract].
|
| 17.
|
Sun, Z. H.,
A. Scorpio, and Y. Zhang.
1997.
The pncA gene from the naturally pyrazinamide-resistant Mycobacterium avium encodes pyrazinamidase and confers pyrazinamide susceptibility to resistant M. tuberculosis complex organisms.
Microbiology
143:3367-3373[Abstract/Free Full Text].
|
| 18.
|
Sun, Z. H., and Y. Zhang.
1999.
Reduced pyrazinamidase and the natural resistance of Mycobacterium kansasii to the antituberculosis drug pyrazinamide.
Antimicrob. Agents Chemother.
43:537-542[Abstract/Free Full Text].
|
| 19.
|
Tanigawa, Y.,
M. Shimoyama, and I. Ueda.
1980.
Nicotinamide deamidase from Flavobacterium peregrinum.
Methods Enzymol.
66:132-136[Medline].
|
| 20.
|
Trivedi, S. S., and S. G. Desai.
1987.
Pyrazinamidase activity of Mycobacterium tuberculosis a test of sensitivity to pyrazinamide.
Tubercle
68:221-224[CrossRef][Medline].
|
| 21.
|
Zhang, Y.,
M. J. Garcia,
R. Lathigra,
B. Allen,
C. Moreno,
J. D. A. van Embden, and D. Young.
1992.
Alterations in the superoxide dismutase gene of an isoniazid-resistant strain of Mycobacterium tuberculosis.
Infect. Immun.
60:2160-2165[Abstract/Free Full Text].
|
| 22.
|
Zhang, Y.,
T. Garbe, and D. Young.
1993.
Transformation with katG restores isoniazid sensitivity in Mycobacterium tuberculosis isolates resistant to a range of drug concentrations.
Mol. Microbiol.
8:521-524[Medline].
|
| 23.
|
Zhang, Y.,
A. Scorpio,
H. Nikaido, and Z. Sun.
1999.
Role of acid pH and deficient efflux of pyrazinoic acid in the unique susceptibility of Mycobacterium tuberculosis to pyrazinamide.
J. Bacteriol.
181:2044-2049[Abstract/Free Full Text].
|
Journal of Bacteriology, July 2000, p. 3881-3884, Vol. 182, No. 13
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Boshoff, H. I., Mizrahi, V., Barry, C. E. III
(2002). Effects of Pyrazinamide on Fatty Acid Synthesis by Whole Mycobacterial Cells and Purified Fatty Acid Synthase I. J. Bacteriol.
184: 2167-2172
[Abstract]
[Full Text]
-
Boshoff, H. I. M., Mizrahi, V.
(2000). Expression of Mycobacterium smegmatis Pyrazinamidase in Mycobacterium tuberculosis Confers Hypersensitivity to Pyrazinamide and Related Amides. J. Bacteriol.
182: 5479-5485
[Abstract]
[Full Text]
Top
Abstract
Text
