Previous Article | Next Article 
Journal of Bacteriology, July 2000, p. 3920-3923, Vol. 182, No. 14
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Promoter Region Binding Protein and DNA Gyrase
Regulate Anaerobic Transcription of nifLA in
Enterobacter cloacae
Biao
Hu,
Jiabi
Zhu,
San Chiun
Shen, and
Guan-qiao
Yu*
Laboratory of Molecular Genetics, Shanghai
Institute of Plant Physiology, The Chinese Academy of Sciences,
Shanghai, China 200032
Received 13 December 1999/Accepted 26 April 2000
 |
ABSTRACT |
Our work provides evidence that a sequence characteristic of FNR
binding sites, when interacted with by a trans-acting
factor, activates anaerobic transcription of the nifLA
operon in Enterobacter cloacae. DNA gyrase activity has
been found to be important for the anaerobic transcription of the
nifLA promoter. Our results suggest that anaerobic
regulation of the nifLA operon is mediated through
the control of the promoter region-binding trans-acting factor at the transcriptional level, while DNA supercoiling functions in providing a topological requirement for the activation of transcription.
 |
INTRODUCTION |
In the nitrogen-fixing
(nif) enteric bacteria Klebsiella pneumoniae and
Enterobacter cloacae, the nif genes are regulated by the activity of the ntrC, ntrA,
nifA, and nifL genes at the transcriptional level
(2, 3, 4, 24). nifL and nifA constitute an operon which is regulated by the product of
ntrC or autoregulated by the product of nifA,
NifA (5, 9). NifA acts as a positive regulator in
conjunction with NtrA to activate nif genes (19),
while the product of nifL, NifL, acts as a repressor of
nif genes under oxygen or in an excess of fixed nitrogen
(13).
Our previous investigations showed that the nifLA promoter
is highly sensitive to oxygen and that NifA is inactivated by NifL under oxygen (5, 15, 23). Accordingly, we hypothesized that
nif regulation by oxygen is mediated at two different
levels. First, at the transcriptional level, the oxygen sensitivity of the nifLA promoter ensures that the nifLA
promoter and, hence, all other nif promoters are repressed
by oxygen; second, at the posttranslational level, NifL interacts with
NifA in the presence of oxygen. As the result of a shortage of active
NifA, the expression of other nif genes is blocked.
Direct interaction of NifL and NifA has been demonstrated by the
two-hybrid system test (16, 23). As to the question of aerial regulation of the nifLA promoter, most investigators
have claimed that neither FNR nor the oxrC gene product is
involved in the expression of nifLA in response to oxygen
(14). Since the activity of the K. pneumoniae
nifLA promoter can be prevented by inhibition of DNA gyrase
activity, they thus held that aerobic-anaerobic regulation of the
nifLA promoter is mainly mediated through the level of DNA
supercoiling (6, 8). Our present work demonstrated that an
upstream sequence of the nifLA promoter characteristic of
the FNR binding sequence, when bound by the trans-acting
factor from the bacterial cells, activates anaerobic expression of the nifLA operon. We also proved that DNA gyrase is
truly important for anaerobic transcription of the nifLA
promoter. A mechanism for aerobic regulation of the nifLA
promoter is proposed.
 |
MATERIALS AND METHODS |
Strains and plasmids.
The bacterial strains and plasmids
used in this work are listed in Table 1.
DNA manipulations.
Preparation of plasmids DNA, endonuclease
digestion, ligation, and transformation were carried out essentially as
described by Sambrook et al. (21).
Construction of nifLA promoter mutants.
Initially, the E. cloacae nifLA promoter (Fig.
1) was cloned in vector M13mp19. The
resultant clone is referred to as M13mp19-nifLAp. The
M13mp19-nifLAp DNA was digested with BglI and
HpaI, filled in with Klenow polymerase, and ligated to yield
M13mp19-nifLAp-D, where the FNR site consensus sequence
upstream of the nifLA promoter was deleted. Promoter mutant
clones M13mp19-nifLAp-m1 and M13mp19-nifLAp-m2, with a mutation in the FNR site consensus sequence, were constructed by
oligonucleotide-mediated mutagenesis as described by Sambrook et al.
using a 0.5-kb BamHI-to-HindIII fragment of
the nifLA promoter region carried in
M13mp19-nifLAp as a target (21). A 26-mer mutant
primer (5'AACAGGCGTTAACAGGGCCCAGATCG3') complementary to bases
63 to
38 with the four most conserved bases mismatched with
respect to the FNR consensus was synthesized and used to construct
M13mp19-nifLAp-m1. Another 24-mer mutant primer
(5'ACAGGCGTTAACATCGATCCAGAT3') complementary to bases
62
to
39 with one most conserved base mismatched was synthesized and
used to construct M13mp19-nifLAp-m2. The 26-mer primer and
the 24-mer primer create a unique restriction ApaI or
ClaI endonuclease site in each case. It can be used to screen the desired mutants.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence of the E. cloacae nifLA
promoter region. The NtrC binding site is shown as a dashed box, the
consensus sequence of the FNR site is boxed, the NifA binding site is
shadowed, the 54-RNA polymerase recognition site is
double underlined, the transcription start site is indicated by the
arrow, and the restriction endonuclease site is underlined. The
conserved sequence of the FNR site is indicated by the star.
|
|
Promoter mutant clone pUC18-nifLAp-mc, with alteration of
base pairs outside the FNR site consensus, was constructed by PCR (1). The first-round PCR was performed with mutant primer
5'GGCGGGCGCTGCAGACGAAATCTGCTGGCG3', which complements bases
99 to
128 upstream of the nifLA transcription start
site, and primer 5'AGCGGATAACAATTTCACACAGGA3', which
complements phage M13. The double-stranded product was purified and
used as one of the primers in the second-round PCR along with primer
5'GTAAAACGACGGCCAGT3', which anneals to the other side of
M13. M13mp19-nifLAp double-stranded DNA was used as the template in
both PCR rounds. The final PCR product containing the mutations was
then cloned in vector pUC18 to give rise to pUC18-nifLAp-mc.
All of the mutants obtained as described above were rescreened by DNA
sequencing. nifLAp-lacZ translational fusions
pPW926, pPW-D926, pAP926, pCL926, and pST926, respectively, were
constructed by digesting M13mp19-nifLAp,
M13mp19-nifLAp-D, M13mp19-nifLAp-m1, M13mp19-nifLAp-m2, and pUC18-nifLAp-mc with
BamHI and HindIII. The resultant 0.5-kb
fragments, each of which contains the nifLA promoter region,
were then cloned into the same restricted plasmid, pGD926.
Assay of
-galactosidase.
Bacteria were grown aerobically
for 24 h at 28°C in nitrogen-free minimal medium supplemented
with 0.01% casein hydrolysate, 1 mg of vitamin B1 per
liter, 20 mg of glutamine per liter, and appropriate antibiotics
(5). Cells were pelleted, washed, and resuspended in the
same medium and then grown under aerobic or anaerobic (flashing with
nitrogen) conditions for 8 h.
-Galactosidase activity was
assayed as described by Miller (17).
DNA binding assay.
Binding of protein to the FNR site
consensus sequence was monitored by measuring the reduction in the
electrophoretic mobility of the labeled probe DNA fragments as
described by Fried and Crothers (11). In a 20-µl total
sample volume, 3.5 pmol of an [
-32P]dATP-labeled
double-stranded probe was incubated with 14 µg of protein extracts
containing 3 µg of calf DNA for 25 min at 25°C. A DNA fragment with
the sequence 5'TTAATGCCGTCGAATACCGATCTGGATCAATGTTAACGCCTGTT3', followed by the nifLA promoter containing the FNR
binding site consensus sequence, and a DNA fragment with the sequence
5'TTAATGCCGTCGAATACCGATCTGGGGCCCTGTTAACGCCTGTT3', followed
by the nifLA promoter with the FNR binding site consensus sequence mutated, were synthesized as probes. Protein-DNA complexes were separated by 12% polyacrylamide gel electrophoresis and then autoradiographed.
 |
RESULTS AND DISCUSSION |
A sequence upstream of the nifLA promoter and its role
in the activity of the nifLA operon.
As
reported previously for E. cloacae E26, there are three
cis-acting elements residing in the region upstream of the
nifLA operon: the
54-RNA polymerase
recognition site at
24 to
12, the NtrC binding site at
171 to
135, and the NifA binding site at positions +44 to +59 from the
transcription start site (TSS) (5). Through analysis of the
DNA sequence of the nifLA promoter, we found a sequence,
CCGAT-N4-ATCAA, at positions
69 to
48 from the TSS (Fig. 1) which is characteristic of the sequence of an FNR binding site
(10, 22). In order to know the role of this defined sequence in the activity of the nifLA operon under anaerobic
conditions, we constructed a promoter mutant with a 48-bp
BglI-to-HpaI fragment including the consensus FNR
binding site upstream of the TSS deleted and cloned it into plasmid
pGD926 to form a nifLAp
-lacZ translational fusion. After it was introduced into E. cloacae E26 or
Escherichia coli YMC9, the
-galactosidase activity of the
fusion was measured. As shown in Table 2,
deletion of the consensus FNR binding site caused a marked decrease in
the activity of the nifLA promoter under anaerobic
conditions. Furthermore, we made promoter mutants by
site-directed mutagenesis. One mutant contains the
sequence CCGAT CTGG GGCCC, where the conserved sequence ATCAA was
changed to GGCCC, and another mutant contains the sequence CCGAT CTGG ATCGA, where the ATCAA sequence was changed to ATCGA. In
addition, a mutant with base pairs T
111,
C
112, and C
121 outside the FNR binding site
consensus sequence changed to G
111, T
112,
and G
121 was constructed and used as a control. After
these mutants were cloned into pGD926 to form
nifLAp-lacZ fusions, their activities were
measured. Data in Table 2 show that either deletion or alteration of
the sequence of the consensus FNR site produced low activity under
anaerobic conditions, whereas mutation at sites outside of this
sequence did not affect the anaerobic expression of the fusion (Table
2). These results substantiate the evidence that the consensus FNR site
upstream of the nifLA promoter is important for regulation
of the nifLA operon.
A trans-acting factor binds to the defined sequence
upstream of the nifLA promoter.
To test if there is a
trans-acting factor bound to the defined sequence upstream
of the nifLA promoter which enhances the anaerobic
expression of the nifLA operon, a gel mobility
shift assay was conducted. The fragments encompassing the consensus FNR
site or its variants were incubated with the soluble protein extracts
from E. cloacae or E. coli and assayed for
DNA-protein complex formation. As shown in Fig.
2, a slower-migrating complex was
detected following incubation of the probe containing the FNR site
consensus sequence with the cell extracts. In contrast, no complex was
detected following incubation of the probe containing the mutated
consensus sequence of the FNR site with the cell extracts. We thus
concluded that a trans-acting factor binding to the FNR consensus sequence is present in E. cloacae and also in
E. coli.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Gel mobility shift assay of a DNA fragment containing
the FNR site consensus sequence incubated with protein extracts from
E. cloacae E26 (lanes 2 to 5), E. coli YMC9
(lanes 7 and 9), and E. coli JRG2865 (lane 6). Lanes: 1 and
8, labeled DNA fragment; 2, 3, 6, and 7, labeled DNA fragment incubated
with protein extract from anaerobic culture; 4, labeled DNA fragment
incubated with protein extract from aerobic culture; 5 and 9, labeled
DNA fragment containing mutated FNR site consensus sequence incubated
with protein extract from an anaerobic culture. The reaction mixture in
lane 2 also contained 300 pmol of unlabeled probe DNA as a specific
competitor.
|
|
When plasmid pPW926 carrying the E. cloacae
nifLAp-lacZ fusion was transferred to E. coli
fnr mutant strain JRG2865, which fails to produce FNR, the fusion
was just as active as it was in the wild-type E. coli strain
(Table 2). As assessed by a gel mobility shift assay using the DNA
fragment encompassing the FNR site consensus sequence, followed by
incubation with protein extract of E. coli fnr mutant strain
JRG2865, a DNA-protein complex was also consistently formed, as it was
when the DNA fragment was incubated with the protein extract of the
wild-type strain of E. coli (Fig. 2). From these results, we
concluded that a trans-acting factor other than FNR binds to
the putative FNR site and operates in the expression of the
nifLA promoter in E. coli. However, we cannot
exclude the possibility that FNR is capable of binding to the consensus
sequence of the FNR site to activate the nifLA promoter in
E. cloacae.
Superhelical status of DNA and activity of the nifLA
promoter.
Before the identification of a regulatory factor
responding to oxygen status, it has been reported that the K. pneumoniae nifLA promoter requires a specific degree of negative
supercoiling for expression, which is only possible under anaerobic
conditions (6, 8). To examine this possibility, we tested
influence of gyrase activity on the transcription of the E. cloacae nifLA promoter by introducing the
nifLAp-lacZ fusion into an E. coli DH5
gyrA mutant or into gyrA+
strains of E. coli and E. cloacae in the presence
of a gyrase inhibitor. The known gyrase-dependent K. pneumoniae
nifLAp-lacZ fusion (6, 8) was also run as a
control. The results showed that expression of the
nifLAp-lacZ fusion has been markedly halted both
in the gyrA mutant and in the gyrA+
strains with the presence of the gyrase inhibitors under aerobic or
anaerobic conditions (Tables 2 and 3).
When a plasmid carrying constitutively expressed gyrA was
introduced into the gyrA DH5
mutant harboring the
nifLAp-lacZ fusion, the activity of the fusion was restored. However, a gyrB clone did not have the same
effect (Table 2). Curiously, the nifH operon of
Rhizobium meliloti, which is known to be insensitive to
oxygen (unpublished data), appears to be DNA gyrase dependent too.
These results confirm the earlier inference that DNA gyrase activity is
crucial for transcription of the nifLA operon and
possibly other nif genes.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Effects of coumermycin A1 and novobiocin on
-galactosidase activities of nifLAp-lacZ
translation fusions
|
|
These findings have significantly advanced our understanding of the
mechanism of oxygen regulation of nifLA transcription. The
trans-acting factor, which responds to the redox status,
activates the nifLA promoter when bound to the defined
sequence upstream of the nifLA promoter, while DNA
supercoiling produced by the activity of gyrase functions in providing
a topological requirement for the bound trans-acting
factors, presumably through the process of looping of DNA between the
sites of the NtrC and the trans-acting factors, thus
enhancing the cooperative interaction between those bound
trans-acting factors for activation of transcription.
 |
ACKNOWLEDGMENTS |
We thank J. R. Guest for the gift of JRG2865.
This work was supported by grants from the Commission of the European
Communities, the National High Technology "863" Programs of China,
and the National Natural Sciences Foundation of China.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Molecular Genetics, Shanghai Institute of Plant Physiology, The Chinese Academy of Sciences, 300 Fenglin Rd., Shanghai, China 200032. Phone:
86-21-64042090-4319. Fax: 86-21-64042385. E-mail:
gqyu{at}iris.sipp.ac.cn.
 |
REFERENCES |
| 1.
|
Barik, S.
1993.
Site-directed mutagenesis by double polymerase chain reaction: megaprimer methods, p. 277-286.
In
B. A. White (ed.), PCR protocols: current methods and applications. Humana Press, Totowa, N.J.
|
| 2.
|
Buchanan-Wollaston, V.,
M. C. Cannon,
J. L. Beynon, and F. C. Cannon.
1981.
Role of the nifA gene product in the regulation of nif expression in Klebsiella pneumoniae.
Nature (London)
294:776-778[CrossRef][Medline].
|
| 3.
|
Buchanan-Wollaston, V.,
M. C. Cannon, and F. C. Cannon.
1981.
The use of cloned nif (nitrogen fixation) DNA to investigate transcriptional regulation of nif expression in Klebsiella pneumoniae.
Mol. Gen. Genet.
184:102-106[CrossRef][Medline].
|
| 4.
|
De Bruijn, F. J.,
U. Hilgert,
J. Stigter,
M. Schneider,
M. A. Heiner,
U. Klosse, and K. Pawlowski.
1990.
Regulation of nitrogen fixation and assimilation genes in the free living versus symbiotic state, p. 33-44.
In
P. M. Gresshof (ed.), Nitrogen fixation: achievements and objectives. Chapman & Hall, New York, N.Y.
|
| 5.
|
Deng, X. B., and S. C. Shen.
1995.
Structure and oxygen sensitivity of the nifL promoter of Enterobacter cloacae.
Sci. China
38:60-65.
|
| 6.
|
Dimri, G. P., and H. K. Das.
1988.
Transcriptional regulation of nitrogen fixation genes by DNA supercoiling.
Mol. Gen. Genet.
212:360-363[CrossRef].
|
| 7.
|
Ditta, G.,
T. Schmidhauser,
E. Yakobson,
P. Lu,
X. W. Liang,
D. R. Finlay,
D. Guiney, and D. R. Helinski.
1985.
Plasmids related to the broad host range vector, pRK290: useful for gene cloning and for monitoring gene expressing.
Plasmid
13:129-153[CrossRef][Medline].
|
| 8.
|
Dixon, R. A.,
N. C. Henderson, and S. Austin.
1988.
DNA supercoiling and aerobic regulation of transcription from the Klebsiella pneumoniae nifLA promoter.
Nucleic Acids Res.
16:9933-9946[Abstract/Free Full Text].
|
| 9.
|
Drummond, M.,
J. Clements,
M. Merrick, and R. Dixon.
1983.
Positive control and autogenous regulation of the nifLA promoter in Klebsiella pneumoniae.
Nature (London)
301:301-307.
|
| 10.
|
Eiglmeier, K.,
N. Honore,
S. Luchi,
E. C. C. Lin, and S. T. Cole.
1989.
Molecular genetics analysis of FNR-dependent promoters.
Mol. Microbiol.
3:869-878[Medline].
|
| 11.
|
Fried, M., and D. M. Crothers.
1981.
Equilibria and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis.
Nucleic Acids Res.
9:6505-6525[Abstract/Free Full Text].
|
| 12.
|
Green, J., and J. R. Guest.
1993.
Regulation of transcription at ndh promoter of Escherichia coli by FNR and novel factors.
Mol. Microbiol.
12:433-444[CrossRef].
|
| 13.
|
Hill, S.,
C. Kennedey,
E. Kavanagh,
R. B. Goldberg, and R. Hanau.
1981.
Nitrogen fixation gene (nifL) involved in oxygen regulation of nitrogenase synthesis in K. pneumoniae.
Nature (London)
290:424-426[CrossRef][Medline].
|
| 14.
|
Hill, S.
1985.
Redox regulation of enteric nif expression is independent of the fnr gene product.
FEMS Microbiol. Lett.
29:5-9.
|
| 15.
|
Kong, Q.-T.,
Q.-L. Wu,
Z.-F. Ma, and S.-C. Shen.
1986.
Oxygen sensitivity of the nifL promoter of Klebsiella pneumoniae.
J. Bacteriol.
166:353-356[Abstract/Free Full Text].
|
| 16.
|
Lei, S.,
L. Pulakat, and N. Gavini.
1999.
Genetic analysis of nif regulatory genes by utilizing the yeast two-hybrid system detected formation of a NifL-NifA complex that is implicated in regulated expression of nif genes.
J. Bacteriol.
181:6535-6539[Abstract/Free Full Text].
|
| 17.
|
Miller, J. H.
1972.
Experiment in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 18.
|
Mizuuchi, K.,
M. Mizuuchi,
H. M. O'Dea, and M. Gellert.
1984.
Cloning and simplified purification of Escherichia coli DNA gyrase A and B proteins.
J. Biol. Chem.
259:9199-9201[Abstract/Free Full Text].
|
| 19.
|
Ow, D. W., and F. M. Ausubel.
1983.
Regulation of nitrogen metabolism genes by nifA gene product in Klebsiella pneumoniae.
Nature (London)
301:307-313[CrossRef][Medline].
|
| 20.
|
Qiu, Y. S.,
S. P. Zhou,
X. Z. Mo,
S. G. Ye,
X. W. Cai,
C. L. Ma,
C. A. Mao,
Y. H. Chen,
S. Y. He, and R. F. Deng.
1981.
Study of nitrogen fixation bacteria associated with rice root: the characteristics of nitrogen fixation by Alcaligenes faecalis strain A15 and Enterobacter cloacae strain E26.
Acta Microbiol. Sin.
21:473-475.
|
| 21.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 22.
|
Sawers, G.,
M. Kaiser,
A. Sirko, and M. Freundlich.
1997.
Transcriptional activation by FNR and CRP: reciprocity of binding-site recognition.
Mol. Microbiol.
23:835-845[CrossRef][Medline].
|
| 23.
|
Xiao, H.,
J. Zhu, and S. C. Shen.
1998.
NifL, an antagonistic regulator of NifA interacting with NifA.
Sci. China
41:303-308.
|
| 24.
|
Zhu, J.-B.,
Z.-G. Li,
L.-W. Wang,
S.-S. Shen, and S.-C. Shen.
1986.
Temperature sensitivity of a nifA-like gene in Enterobacter cloacae.
J. Bacteriol.
166:357-359[Abstract/Free Full Text].
|
Journal of Bacteriology, July 2000, p. 3920-3923, Vol. 182, No. 14
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Yee, N., Ma, J., Dalia, A., Boonfueng, T., Kobayashi, D. Y.
(2007). Se(VI) Reduction and the Precipitation of Se(0) by the Facultative Bacterium Enterobacter cloacae SLD1a-1 Are Regulated by FNR. Appl. Environ. Microbiol.
73: 1914-1920
[Abstract]
[Full Text]
-
Egener, T., Sarkar, A., Martin, D. E., Reinhold-Hurek, B.
(2002). Identification of a NifL-like protein in a diazotroph of the {beta}-subgroup of the Proteobacteria, Azoarcus sp. strain BH72. Microbiology
148: 3203-3212
[Abstract]
[Full Text]