Department of Biological Sciences, University
of Alberta, Edmonton, Alberta, Canada T6G 2E9
 |
INTRODUCTION |
Conjugation is the horizontal
transfer of DNA from donor to recipient bacteria via plasmid-derived
transfer (tra) proteins and other host-encoded factors. F,
R1, and R100-1 (a derepressed mutant of R100 [7]) are
closely related members of the IncF group of self-transmissible
plasmids (19) which exhibit plasmid specificity
(53). The plasmids were differentiated at the level of
transcriptional control of the major tra operon as well as by properties associated with the conjugative pilus, including antigenicity, phage sensitivity, entry exclusion, and mating-pair stabilization (7). In addition, specificity at the level of DNA processing has also been described (17, 53).
TraY, encoded by the first gene in the traYI operon, binds
at two sites in F oriT (sbyA and sbyC [32,
34]) and one site in oriT of R100 (sbyA
[27]) (Fig. 1). The
relaxase, TraI, cleaves a single strand of DNA in oriT at a
site now called nic and covalently binds to the 5' end
(10, 29, 33, 36). In addition to relaxase activity, F TraI
also contains an ATP-dependent helicase activity in the large
carboxyl-terminal domain of the molecule (12). Integration
host factor (IHF) binds two sites in both the F (51) and the
R100 (14, 28) oriT regions. Both intrinsic bends
and bends induced by IHF (51) are proposed to fulfill the
three-dimensional structural requirements at oriT necessary
for cleavage at nic.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Diagram of the binding sites in oriT of the F
and R100-1 plasmids. The traM and traJ genes and
the traY-I operon are also shown (not to scale).
PM1, PM2, PJ, and PY
refer to promoters for the two traM transcripts,
traJ and traYI transcripts, respectively. See the
text for details.
|
|
In the F plasmid, IHF and TraY are required for the nicking reaction in
vitro (38), and assembly of the resulting "relaxosome" occurs in a specific order, with TraI binding after IHF and TraY (26). Similar characteristics have been shown for the
closely related plasmid R100 (3, 23). The determination of
the position of nic was established for F (47,
50) and R100-1 (29), which are equivalent except for a
2-bp difference in the sequence immediately adjacent to nic
(19). This difference occurs within the TraI binding site
(sbi) for R100-1 (3). TraI has been localized to the
cytoplasm (6), but upon overexpression in the presence of
TraD it has been shown to be associated with the inner membrane (12). TraD is proposed to be the coupling protein that links the relaxosome to the transferosome, a complex of proteins presumably located at the base of the pilus that forms the transport apparatus (45).
TraM is a cytoplasmic protein of 14.5 kDa which forms tetramers in
solution (20, 52). It binds to three sites in F
oriT (sbmA, -B, and -C [15]) and four sites
in oriT of R100 (sbmA to -D [1]). In F, one
of these sites, sbmC, is associated with transfer, while the other two,
sbmA and sbmB, are involved in the autoregulation of traM
transcription (40). Removal of sbmA and sbmB (Fig. 1)
decreases mating efficiency 100-fold, while the additional deletion of
sbmC results in a further 100-fold decrease in the efficiency of
mobilization of a plasmid containing a cloned version of
oriT (22). TraM from the F-like plasmids R100-1
and R1 also autoregulate their transcription (2, 46). The
amino-terminal region of TraM is responsible for DNA binding in a
plasmid-specific manner (31). The F and R100-1 TraM proteins are 127 amino acids long and are 88.9% identical and 95.3% similar, with 11 of the 14 differences occurring in the first 37 amino acids of
the proteins. TraM has also been shown to be associated with the inner
membrane (6, 15), possibly via the inner membrane protein
TraD (16).
Previous work had shown that TraM, TraY, and TraI from F, R100-1, and
R1 plasmids showed plasmid specificity for their homologous oriT regions (17, 53), with TraM and TraY thought
to have more specificity than TraI based on sequence variation and the number of alleles (19). Because of the clear differences
between the F and R100-1 mating-pair formation systems (7)
and the plasmid specificity exhibited by the transfer proteins that
bind oriT, chimeric plasmids that are hybrids of the F and
R100-1 oriT regions were constructed. These were used to
assay whether plasmid specificity is simply a function of DNA
recognition by the transfer proteins or whether protein-protein
interactions also affected nicking and transfer efficiency.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and growth conditions.
Plasmids
used in this study are listed in Table 1.
The following Escherichia coli strains were used in this
study: CS2198 (waaJ19::TnlacZ of
CS1999) (43); DH5
[
lacU169 (
80
lacZ
M15) supE44 hsdR17 recA1 endA1 gyrA96
(Nalr) thi-1 relA1] (8, 25); ED24
(F
Spcr Lac
) (54);
ED2149 [F
lac
U124
(nadA aroG gal
attL bio)] (13); JE2571-1 (30); and XK1200
[F
Nalr lac
U124
(nadA
aroG gal attL bio gyrA)] (37). Cells were grown in
Luria-Bertani (LB) medium (8) or on LB medium with 1.5% agar (Difco Laboratories) supplemented with the appropriate antibiotics at the following final concentrations: ampicillin, 50 µg/ml;
kanamycin, 25 µg/ml; and tetracycline, 10 µg/ml.
Recombinant DNA techniques.
Restriction enzymes and T4 DNA
ligase were supplied by Boehringer Mannheim and used according to
standard procedures (8) except as noted. Plasmids were
transformed using CaCl2-competent cells (44) or
by electroporation using a Bio-Rad Gene Pulser at 2.5 V, 25 µFD, and
200
. DNA fragments used to create plasmid constructs were isolated
from acrylamide by crushing the excised bands containing the fragments
and eluting them overnight in 300 µl of 500 mM ammonium acetate and 1 mM EDTA at 37°C, followed by phenol extraction and ethanol precipitation.
Construction of plasmids.
pNY300 (18) was
constructed by digesting F with BglII and inserting the
1,080-bp fragment into the BamHI site of pUC18 that contains
the F oriT (nic, IHFA, sbyA, and sbmABC) and the
F traM gene. pRF105, which is the R100-1 equivalent of
pNY300, was constructed using a serendipitous mutation in R100-1 which
created a BamHI site 135 bp upstream of nic
(19). Digestion with BamHI generated a 1,045-bp
fragment which was inserted into the BamHI site of pUC18.
Fortuitously situated DraI sites between sbyA and sbmC in F
and between nic and sbyA in R100-1 allowed construction of hybrid plasmids in which nic and sbyA, as well as the TraM
region, were shuffled. pRF315 was constructed by linking the F
nic and TraY binding site (sbyA) to the R100-1 TraM binding
sites (sbmABCD) and the traM gene. It was constructed by
digesting a PCR product generated from pRF105 using LFR51
(AAATAGAGAGTCGTTGGCGATCC) and reverse
(TCACACAGGAAACAGCTATGACCA) primers with EcoRI to
yield an 830-bp fragment. This was ligated to the 260-bp
DraI and HindIII fragment of pNY300 and
inserted into pUC18 digested with EcoRI and
HindIII. pRF315 had 1 bp missing from the
DraI site and an additional 2 bp near the beginning of sbmC
which did not affect its ability to be mobilized by pOX38-Km or
pOX38traMK3 compared to the mobilization frequency of
pNY300. pRF206 was constructed by linking the F nic to the
R100-1 TraY and TraM binding sites (sbyA and sbmABCD) and the
traM gene. It was constructed by digesting a PCR product
generated from pNY300 using the Universal (GGGTTTTCCCAGTCACGACG) and RFE4 (AAAACGTAAATCAGCAAAAACTTGTT) primers with
HindIII to give a 209-bp fragment. This was ligated to
an 888-bp fragment of pRF105 digested with EcoRI and
DraI and inserted into pUC18 digested with EcoRI
and HindIII. One base pair was removed from the
DraI site during construction, which did not affect its
mobilization frequency by R100-1 compared to pRF105. pKJ4 is an
EcoRV-EcoRI fragment containing traY
and traA cloned into pT7.4. This construct was created using
the EcoRV site in traJ (19) and an
EcoRI site engineered by PCR into the 3' end of
traA. All plasmids were sequenced to verify their construction.
Plasmid nicking assays.
Nicking assays for pOX38-Km and its
derivatives were done as previously described (21, 41). For
the chimeric plasmids, a primer was annealed to a sequence within pUC18
to generate a single-stranded product which terminated at either
nic or at a restriction enzyme site downstream from
nic. DraI was used to terminate the products for plasmids
pNY300 and pRF315 (91 bases from nic), while
HinfI was used for pRF206 and pRF105 (98 bases from
nic). For chimeric plasmids 3-ml cell cultures containing a
chimeric plasmid were grown to an optical density at 600 nm (OD600) of 0.4. Cells were lysed and plasmid DNA was
purified using the complete method of Birnboim and Doly (9).
DNA was dissolved in 30 µl of Milli-Q water. Then, 2 µl of this DNA
was completely digested with the appropriate restriction enzyme. The DNA was ethanol precipitated and dissolved in 10 µl of Milli-Q water.
Of this, 0.1 or 0.01 µl was added to the nicking reaction depending
on the DNA concentration. The nicking reaction mixture included 11.5 µl of a mixture containing 41.5 µl Milli-Q water, 5 µl of 10×
Thermopol Buffer, 1 µl of 10 mM deoxynucleoside triphosphate, 500 pmol of Universal primer, and 2 µl (ca. 20 µCi) of
[
-32P]dCTP (Amersham Pharmacia Biotech). Reactions
were denatured for 2 min at 94°C before the addition of 2 µl of
diluted Vent Polymerase (0.5 µl of polymerase with 8 µl of Milli-Q
water) (New England Biolabs). Reactions were amplified by using an MJ
Research MiniCycler at 94°C for 30 s, 61°C for 30 s, and
72°C for 1 min for 35 cycles. The reaction mixtures were then
removed, rolled on parafilm to remove the remaining mineral oil, and
ethanol precipitated. DNA was dissolved in 15 µl of Milli-Q water and
5 µl of Sequencing Stop Solution (USB Biochemicals). Next, 10 µl of
each reaction mixture was denatured at 85°C for 10 min and loaded
onto a 6% polyacrylamide gel containing 8 M urea. A dideoxy-sequencing
reaction of each plasmid using Universal primer was performed with
Sequenase (USB Biochemicals) and loaded as a standard.
Quantitation of nicking efficiency.
Gels containing the
nicking and sequencing reactions were exposed to a Molecular Dynamics
Phosphor Screen overnight and analyzed by a Molecular Dynamics
PhosphorImager 445-SI. Band intensities were quantitated using
ImageQuant version 4.2a. Bands located at nic were compared
to bands located at the DraI or HinfI restriction enzyme sites to determine the percentage of cleavage in each sample. Occasionally, other prominent bands were also found in a single lane,
and the values of these bands were added to those of the bands located
at the restriction enzyme sites. Background values were also subtracted
from both band intensities at nic and the restriction enzyme sites.
Mobilization efficiency assays.
Recipient and donor cells
were grown to early log phase (OD600 of 0.4) with
appropriate antibiotic selection. Cells were washed twice and
resuspended in the same volume of medium. Then, 100 µl each of donor
and recipient cells were added to 800 µl of medium and incubated at
37°C for 30 min. Cells were vortexed and placed on ice. Serial
dilutions of the mating cultures were made using 1× SSC (0.15 M sodium
chloride, 0.015 M sodium citrate; pH 7.0). A 10-µl portion of each
dilution was spot-dropped onto selective plates containing combinations
of antibiotics to select for transconjugants containing mobilizable
plasmids or self-transmissible plasmids, donors, or recipients. Plates
were dried and then incubated at 37°C overnight. Mating efficiency is
reported as the number of transconjugants per 100 donors. Mobilization
assays were done using pOX38-Km or pOX38-traMK3 in E. coli DH5
as donor cells and ED24 as recipient cells.
Mobilization assays in the presence of R100-1 used E. coli
JE2571-1/R100-1 as donor cells and CS2198 (Kmr) as
recipient cells.
 |
RESULTS |
Identifying factors required for cleavage in vivo.
The role of
TraM in promoting cleavage at nic was assessed using a
nicking assay with pOX38-Km and its derivatives pOX38-traMK3 (traM) and pOX38-traY244 (traY) in
E. coli XK1200 (Fig. 2).
Removal of TraY by mutation in plasmid pOX38-traY244
abolished cleavage at nic (Fig. 2, lane 9), while supplying
TraY in trans (pKJ4) restored cleavage (Fig. 2, lane 11).
The addition of the traI gene in trans (pRS31)
did not result in cleavage (Fig. 2, lane 12), suggesting that TraI
required TraY for both its expression and relaxase activity.

View larger version (71K):
[in this window]
[in a new window]
|
FIG. 2.
Nicking reactions of pOX38-Km and its derivatives.
Plasmids present in each experiment are listed above each lane. The
DraI site and the cleavage site (nic) are
indicated with arrows. The sequencing ladder is used to identify the
nic and DraI sites and was performed using the
same primer as in the nicking reactions. A nonspecific band is
identified with an arrow between nic and the DraI
site. The IHF binding site (IHFA) is designated by a vertical line next
to the G lane in the sequencing reaction.
|
|
The level of cleavage at nic in the traM mutant,
pOX38-traMK3, was equivalent to that of the wild-type
plasmid pOX38-Km (Fig. 2, lanes 1 and 2). A slight increase in the
level of cleavage was seen upon the addition of extra TraM in
trans (pLDLF007; traM transcribed from its own
promoters) compared to the vector control (pT7.4) (Fig. 2, lanes 3 and
4). A band was routinely found between nic and the
DraI site (Fig. 2, middle arrow) which was within the
AT-rich region containing IHFA, the first IHF binding site (51). The intensity of this band reflected the level of
cleavage at nic and was greatly reduced when TraY was absent
(Fig. 2, lane 9), suggesting that termination at this site is dependent
on relaxosome formation. In the absence of cleavage at nic,
the band located at the DraI site was intensified, as
expected (Fig. 2, lane 9), and was approximately equivalent to the sum
of the intensities of bands at nic, IHFA, and
DraI in other samples.
Mobilization assays of chimeric plasmids.
The chimeric
plasmids (Fig. 3) were tested for their ability to be mobilized by
R100-1, F (pOX38-Km), and an F traM mutant, pOX38-traMK3. They were also tested for their ability to
complement pOX38-traMK3, as well as their effect on the
transfer of the pOX38-Km plasmid (Tables
2 and 3).
pNY300 was mobilized in the presence of pOX38-Km and
pOX38-traMK3 (since pNY300 supplies F TraM) but not in the
presence of R100-1 (Table 2). Similarly, pRF105 was mobilized by R100-1
but not by pOX38-Km or pOX38-traMK3, a finding which is
consistent with the previously determined plasmid specificity of TraM
for its cognate oriT region (53) (Fig.
3).

View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
Sequences of the oriT regions of the chimeric
plasmids. Sequences are aligned at nic according to the
study of Frost et al. (19). Binding sites for F proteins and
IHF are shown above the pNY300 sequence, while the equivalent binding
sites for R100-1 are represented below the pRF105 sequence.
nic is identified by an arrow above the sequences. Sequences
were compared by PILEUP in GCG, and 100% homology is represented by
black boxes, 75% homology is represented by gray boxes with white
lettering, and 50% homology is represented by gray or white boxes with
black lettering. The DraI sites used for the cloning of
pRF315 and pRF206 are shown as dark gray lines above and below the
pNY300 and pRF105 sequences, respectively. Below the sequences is a
diagram of the F (clear boxes) and R100-1 (black boxes) sequences for
each chimeric oriT region.
|
|
pRF315 was mobilized efficiently only in the presence of pOX38-Km and
pOX38-traMK3 (51 and 6.7 transconjugants per 100 donors, respectively; Table 2). Since TraM is required for transfer, the R100-1
TraM supplied by pRF315 was able to bind to sbmABCD on pRF315 and
interact with the F tra proteins supplied by the pOX38
plasmids. The lack of mobilization of pRF315 by R100-1 (<0.01 transconjugants per 100 donors) suggests that the F nic and
sbyA sequences were not bound by R100-1 TraI and TraY or, if bound, were unable to function.
pRF206 was mobilized in the presence of pOX38-Km and R100-1 (71 and 6.4 transconjugants per 100 donors, respectively), suggesting that both F
and R100-1 are able to mobilize this construct at approximately the
same level at which they mobilized pNY300 and pRF105, respectively.
In a set of mating efficiency assays, pNY300 (supplying F TraM), but
not pRF315, pRF206, or pRF105 (supplying R100-1 TraM), was able to
complement the traM mutation in pOX38-traMK3
(Table 3), suggesting that TraM must bind in cis to
nic for transfer to occur. Since pOX38-Km transferred at
normal levels in the presence of all four chimeric plasmids, the
presence of R100-1 TraM did not appear to exert a dominant-negative
effect on F TraM function.
Nicking assays of chimeric plasmids.
The phenotypes of
cleavage and transfer have been used to define whether the relaxosome
is stable and whether it is able to interact with the transfer
machinery (transferosome) to effect DNA transfer (22). To
differentiate between these possibilities, nicking assays were
performed on the four chimeric plasmids in both F and R100-1
backgrounds (Fig. 4). An extra band
(hatched arrow, Fig. 4) immediately above nic and not
associated with the band at IHFA was routinely seen in all samples and
was considered to be an artifact of sample preparation using the
high-copy-number vector pUC18.

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 4.
Examples of nicking reactions using the chimeric
plasmids from Fig. 3. Lanes 1 to 4, 9 to 12, 17 to 20, and 23 to 26 show the sequencing reaction for each plasmid using the universal
primer (G, A, T, and C, respectively). Lanes 5 to 8 show the nicking
reactions for pNY300, and lanes 13 to 16 show the reactions for pRF315
in DH5 alone and with pOX38-Km, pOX38-traMK3, and R100-1,
respectively. Lanes 21 and 22 show the nicking reactions for pRF206
with pOX38-Km and R100-1, respectively. Data for pRF206 in the presence
of pOX38-traMK3 are not shown. Lanes 27 to 29 show the
nicking reactions of pRF105 with pOX38-Km, pOX38-traMK3, and
R100-1, respectively. The nic and restriction enzyme sites
are identified with arrows. An example of a nonspecific band is
identified with a hatched arrow.
|
|
In agreement with the mating efficiency results, pNY300 was cleaved at
nic in the presence of pOX38-Km and pOX38-traMK3
(approximately 15% of the plasmids) but not R100-1, while pRF105 was
cleaved only in the presence of R100-1 (2%). pRF315 was cleaved by
pOX38-Km (12%) and to a lesser extent by pOX38-traMK3
(4%), a finding which is in agreement with the mobilization results
for this plasmid (Table 2). Unexpectedly, pRF206 was cleaved
efficiently in the presence of R100-1 (3%), but cleavage was not
detectable in the presence of pOX38-Km or pOX38-traMK3. Some
cleavage of pRF206 was presumed to occur since mobilization of pRF206
was comparable to that of pNY300 and pRF315 in an F (pOX38-Km)
background (Table 2).
 |
DISCUSSION |
F TraM is not required for efficient cleavage at nic by
TraI, a finding which agrees with previous results. Everett and
Willetts (17) have shown that cleavage occurs in vivo in the
presence of a traM mutation using a lambda nicking assay,
while in vitro studies demonstrated that cleavage required TraI, TraY,
and IHF (26). Achtman et al. (5) showed that a
mutation in traM (JCFL102) affected transfer ability but not
phage sensitivity (pilus formation), which was interpreted as a
requirement for TraM in DNA metabolism during transfer. Kingsman and
Willetts (30) showed that the traM102 mutation
affected the initation of DNA synthesis in the donor after mating pair
formation had occurred. In the R1 plasmid, TraM has both a regulatory
role in the expression of pili (42) and in the level of
nicking (31), underscoring the interesting differences
between the F and R1 systems. Interestingly, supplying F TraM in
trans from a multicopy plasmid increased the amount of
cleavage at nic, suggesting that the equilibrium between
nicked and un-nicked DNA was shifted toward the relaxed species, as
seen in the R1 system (31).
The organization of the oriT region of the R100-1 plasmid
closely resembles that of the F plasmid, with plasmid specificity being
defined at the level of TraI, -M, and -Y binding at their cognate sites
within oriT. Once binding to the DNA has taken place, further specificity could be provided by protein-protein interactions between these proteins within the relaxosome as well as with other proteins involved in the transfer process. Thus, the level of relaxation at nic could reflect the ability of TraY to bind
the oriT region independently of TraI (altering the
conformation of the DNA near nic, thereby affecting TraI
function) or reflect the presence of direct interactions between TraY
and TraI. Similarly, the interaction of TraM with these proteins, as
well as interactions between TraM within the relaxosome and the
transfer apparatus, could also define plasmid specificity.
In the present study, the R100-1 TraM protein of pRF315, pRF206, and
pRF105 was not able to complement the traM mutation in the F
plasmid derivative pOX38-traMK3. This was not due to
decreased cleavage at nic since TraM is not required for
this step in F transfer. Since purified F TraM has a low affinity for
R100-1 TraM binding sites as measured by electrophoretic mobility shift assay (data not shown), R100-1 TraM might also have a correspondingly low affinity for F TraM binding sites. If this assumption is correct, TraM must be bound to sites in cis to nic for the
relaxosome complex for transfer to occur. This is further supported by
evidence that pOX38-traMK3 can in turn efficiently mobilize
pRF315, where R100-1 TraM is bound to its cognate sites on the chimeric
plasmid. Since the level of transfer of pOX38-Km was unaffected by the
presence of the chimeric plasmids supplying R100-1 TraM, there appeared to be no dominant-negative effect resulting from having both types of
TraM within the same cell. Either mixed oligomers are fully functional
or F TraM is preferentially selected to bind to F oriT, a
further example of plasmid specificity.
Cleavage of both pRF206 and pRF105 was barely detectable compared to
pRF315 or pNY300 in the presence of pOX38-Km. This is in contrast to
the mobilization data where pRF206 was efficiently mobilized by
pOX38-Km but mobilization was not detectable for pRF105. The only
differences between pRF206 and pRF105 are 2 bp adjacent to
nic which are within the TraI binding site for the R100-1
plasmid (3). Neither pRF206 nor pRF105 contain the F TraY
binding sites which are required for efficient cleavage in an F
background. The F TraI relaxase appeared to recognize its cognate
cleavage site on pRF206 at a low level and form a small number of
stable relaxosomes (TraI covalently bound to the 5' end of the cleaved
nic site) which could be mobilized efficiently.
Comparable results were obtained with the chimeric plasmids in an
R100-1 background with one exception. pRF315 was neither cleaved nor
transferred by R100-1, suggesting that the R100-1 TraI was not able to
form stable relaxosomes in the presence of the F nic and
TraY binding sites. Since R100-1 TraI cleaved F nic only if
R100-1 TraY was bound in cis to its cognate binding site
(pRF206), TraY apparently provides another level of specificity in the
R100-1 system.
A specific function for F TraM has not yet been defined. TraM is
essential for transfer (4, 40), and its ability to bind DNA
near nic and interact with TraD (16) suggests
that TraM may anchor the DNA to the membrane. TraM has also been
proposed to promote relaxosome formation via formation of a
nucleosome-like structure at oriT which adjusts the
superhelical density and promotes cleavage and unwinding in preparation
for transfer (31, 40). The presence of TraM in the inner
membrane in vivo has been demonstrated using multicopy clones of
traM (15), as has TraI in the presence of TraD
(39). Thus, three steps are required for stable
relaxosome formation, which is essential for interaction with the
transferosome prior to transfer. TraY binding appears to promote TraI
binding but cleavage requires the correct sequence within the TraI
binding site near nic. TraM must be bound in cis
to nic presumably to allow the complete relaxosome access to
the transferosome via TraD. Each of these steps contributes to plasmid specificity.
This research was supported by the Medical Research Council of Canada.
R.A.F. is supported by a studentship from the Alberta Heritage
Foundation for Medical Research.
| 1.
|
Abo, T.,
S. Inamoto, and E. Ohtsubo.
1991.
Specific DNA binding of the TraM protein to the oriT region of plasmid R100.
J. Bacteriol.
173:6347-6354[Abstract/Free Full Text].
|
| 2.
|
Abo, T., and E. Ohtsubo.
1993.
Repression of the traM gene of plasmid R100 by its own product and integration host factor at one of the two promoters.
J. Bacteriol.
175:4466-4474[Abstract/Free Full Text].
|
| 3.
|
Abo, T., and E. Ohtsubo.
1995.
Characterization of the functional sites in the oriT region involved in DNA transfer promoted by sex factor plasmid R100.
J. Bacteriol.
177:4350-4355[Abstract/Free Full Text].
|
| 4.
|
Achtman, M.,
N. Willetts, and A. J. Clark.
1971.
Beginning a genetic analysis of conjugational transfer determined by the F factor in Escherichia coli by isolation and characterization of transfer-deficient mutants.
J. Bacteriol.
106:529-538[Abstract/Free Full Text].
|
| 5.
|
Achtman, M.,
N. Willetts, and A. J. Clark.
1972.
Conjugational complementation analysis of transfer-deficient mutants of Flac in Escherichia coli.
J. Bacteriol.
110:831-842[Abstract/Free Full Text].
|
| 6.
|
Achtman, M.,
P. A. Manning,
C. Edelbluth, and P. Herrlich.
1979.
Export without proteolytic processing of inner and outer membrane proteins encoded by F sex factor tra cistrons in Escherichia coli minicells.
Proc. Natl. Acad. Sci. USA
76:4837-4841[Abstract/Free Full Text].
|
| 7.
|
Anthony, A. G.,
W. A. Klimke,
J. Manchak, and L. S. Frost.
1999.
Comparison of proteins involved in pilus synthesis and mating pair stabilization from the related plasmids F and R100-1: insights into the mechanism of conjugation.
J. Bacteriol.
181:5149-5159[Abstract/Free Full Text].
|
| 8.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and J. A. Struhl (ed.).
1987.
Current protocols in molecular biology and supplements.
John Wiley & Sons, Inc., New York, N.Y.
|
| 9.
|
Birnboim, H. C., and J. Doly.
1979.
A rapid alkaline extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Res.
7:1513-1523[Abstract/Free Full Text].
|
| 10.
|
Byrd, D. R., and S. W. Matson.
1997.
Nicking by transesterification: the reaction catalysed by a relaxase.
Mol. Microbiol.
25:1011-1022[CrossRef][Medline].
|
| 11.
|
Chandler, M., and D. J. Galas.
1983.
Cointegrate formation mediated by Tn9. II. Activity of IS1 is modulated by external DNA sequences.
J. Mol. Biol.
170:61-91[CrossRef][Medline].
|
| 12.
|
Dash, P. K.,
B. A. Traxler,
M. M. Panicker,
D. D. Hackney, and E. G. Minkley, Jr.
1992.
Biochemical characterization of Escherichia coli DNA helicase I.
Mol. Microbiol.
6:1163-1172[CrossRef][Medline].
|
| 13.
|
Dempsey, W. B., and N. S. Willetts.
1976.
Plasmid cointegrates of prophage lambda and R factor R100.
J. Bacteriol.
126:166-176[Abstract/Free Full Text].
|
| 14.
|
Dempsey, W. B., and B. E. Fee.
1990.
Integration host factor affects expression of two genes at the conjugal transfer origin of plasmid R100.
Mol. Microbiol.
4:1019-1028[CrossRef][Medline].
|
| 15.
|
Di Laurenzio, L.,
L. S. Frost, and W. Paranchych.
1992.
The TraM protein of the conjugative plasmid F binds to the origin of transfer of the F and ColE1 plasmids.
Mol. Microbiol.
6:2951-2959[CrossRef][Medline].
|
| 16.
|
Disque-Kochem, C., and B. Dreiseikelmann.
1997.
The cytoplasmic DNA-binding protein TraM binds to the inner membrane protein TraD in vitro.
J. Bacteriol.
179:6133-6137[Abstract/Free Full Text].
|
| 17.
|
Everett, R., and N. Willetts.
1980.
Characterisation of an in vivo system for nicking at the origin of conjugal DNA transfer of the sex factor F.
J. Mol. Biol.
136:129-150[CrossRef][Medline].
|
| 18.
|
Frost, L.,
S. Lee,
N. Yanchar, and W. Paranchych.
1989.
finP and fisO mutations in FinP anti-sense RNA suggest a model for FinOP action in the repression of bacterial conjugation by the Flac plasmid JCFL0.
Mol. Gen. Genet.
218:152-160[CrossRef][Medline].
|
| 19.
|
Frost, L. S.,
K. Ippen-Ihler, and R. A. Skurray.
1994.
Analysis of the sequence and gene products of the transfer region of the F sex factor.
Microbiol. Rev.
58:162-210[Abstract/Free Full Text].
|
| 20.
|
Frost, L. S.,
R. A. Fekete,
S. S. Penfold, and J. Manchak.
1997.
Factors that control TraM expression: the level of TraM defines F plasmid transfer proficiency.
Plasmid
37:220-221.
|
| 21.
|
Frost, L. S., and J. Manchak.
1998.
F phenocopies: characterization of expression of the F transfer region in stationary phase.
Microbiology
144:2579-2587[Abstract].
|
| 22.
|
Fu, Y. H.,
M. M. Tsai,
Y. N. Luo, and R. C. Deonier.
1991.
Deletion analysis of the F plasmid oriT locus.
J. Bacteriol.
173:1012-1020[Abstract/Free Full Text].
|
| 23.
|
Fukuda, H., and E. Ohtsubo.
1997.
Roles of TraI protein with activities of cleaving and rejoining the single-stranded DNA in both initiation and termination of conjugal DNA transfer.
Genes Cells
2:735-751[Abstract].
|
| 24.
|
Guyer, M. S.,
R. R. Reed,
J. A. Steitz, and K. B. Low.
1980.
Identification of a sex-factor-affinity site in E. coli as gamma delta.
Cold Spring Harbor Symp. Quant. Biol.
1:135-140.
|
| 25.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 26.
|
Howard, M. T.,
W. C. Nelson, and S. W. Matson.
1995.
Stepwise assembly of a relaxosome at the F plasmid origin of transfer.
J. Biol. Chem.
270:28381-28386[Abstract/Free Full Text].
|
| 27.
|
Inamoto, S., and E. Ohtsubo.
1990.
Specific binding of the TraY protein to oriT and the promoter region for the traY gene of plasmid R100.
J. Biol. Chem.
265:6461-6466[Abstract/Free Full Text].
|
| 28.
|
Inamoto, S.,
T. Abo, and E. Ohtsubo.
1990.
Binding sites of integration host factor in oriT of plasmid R100.
J. Gen. Appl. Microbiol.
36:287-293.
|
| 29.
|
Inamoto, S.,
Y. Yoshioka, and E. Ohtsubo.
1991.
Site- and strand-specific nicking in vitro at oriT by the TraY-TraI endonuclease of plasmid R100.
J. Biol. Chem.
266:10086-10092[Abstract/Free Full Text].
|
| 30.
|
Kingsman, A., and N. Willetts.
1978.
The requirements for conjugal DNA synthesis in the donor strain during Flac transfer.
J. Mol. Biol.
122:287-300[CrossRef][Medline].
|
| 31.
|
Kupelwieser, G.,
M. Schwab,
G. Hogenauer,
G. Koraimann, and E. L. Zechner.
1998.
Transfer protein TraM stimulates TraI-catalyzed cleavage of the transfer origin of plasmid R1 in vivo.
J. Mol. Biol.
275:81-94[CrossRef][Medline].
|
| 32.
|
Lahue, E. E., and S. W. Matson.
1990.
Purified Escherichia coli F-factor TraY protein binds oriT.
J. Bacteriol.
172:1385-1391[Abstract/Free Full Text].
|
| 33.
|
Lanka, E., and B. M. Wilkins.
1995.
DNA processing reactions in bacterial conjugation.
Annu. Rev. Biochem.
64:141-169[CrossRef][Medline].
|
| 34.
|
Luo, Y.,
Q. Gao, and R. C. Deonier.
1994.
Mutational and physical analysis of F plasmid traY protein binding to oriT.
Mol. Microbiol.
11:459-469[CrossRef][Medline].
|
| 35.
|
Maneewannakul, K.,
P. Kathir,
S. Endley,
D. Moore,
J. Manchak,
L. Frost, and K. Ippen-Ihler.
1996.
Construction of derivatives of the F plasmid pOX-tra715: characterization of traY and traD mutants that can be complemented in trans.
Mol. Microbiol.
22:197-205[CrossRef][Medline].
|
| 36.
|
Matson, S. W., and B. S. Morton.
1991.
Escherichia coli DNA helicase I catalyzes a site- and strand-specific nicking reaction at the F plasmid oriT.
J. Biol. Chem.
266:16232-16237[Abstract/Free Full Text].
|
| 37.
|
Moore, D.,
J. H. Wu,
P. Kathir,
C. M. Hamilton, and K. Ippen-Ihler.
1987.
Analysis of transfer genes and gene products within the traB-traC region of the Escherichia coli fertility factor, F.
J. Bacteriol.
169:3994-4002[Abstract/Free Full Text].
|
| 38.
|
Nelson, W. C.,
M. T. Howard,
J. A. Sherman, and S. W. Matson.
1995.
The traY gene product and integration host factor stimulate Escherichia coli DNA helicase I-catalyzed nicking at the F plasmid oriT.
J. Biol. Chem.
270:28374-28380[Abstract/Free Full Text].
|
| 39.
|
Panicker, M. M., and E. G. Minkley, Jr.
1992.
Purification and properties of the F sex factor TraD protein, an inner membrane conjugal transfer protein.
J. Biol. Chem.
267:12761-12766[Abstract/Free Full Text].
|
| 40.
|
Penfold, S. S.,
J. Simon, and L. S. Frost.
1996.
Regulation of the expression of the traM gene of the F sex factor of Escherichia coli.
Mol. Microbiol.
20:549-558[CrossRef][Medline].
|
| 41.
|
Perwez, T., and R. Meyer.
1996.
MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.
J. Bacteriol.
178:5762-5767[Abstract/Free Full Text].
|
| 42.
|
Polzleitner, E.,
E. L. Zechner,
W. Renner,
R. Fratte,
B. Jauk,
G. Hogenauer, and G. Koraimann.
1997.
TraM of plasmid R1 controls transfer gene expression as an integrated control element in a complex regulatory network.
Mol. Microbiol.
25:495-507[CrossRef][Medline].
|
| 43.
|
Pradel, E.,
C. T. Parker, and C. A. Schnaitman.
1992.
Structures of the rfaB, rfaI, rfaJ, and rfaS genes of Escherichia coli K-12 and their roles in assembly of the lipopolysaccharide core.
J. Bacteriol.
174:4736-4745[Abstract/Free Full Text].
|
| 44.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 45.
|
Sastre, J. I.,
E. Cabezon, and F. de la Cruz.
1998.
The carboxyl terminus of protein TraD adds specificity and efficiency to F-plasmid conjugative transfer.
J. Bacteriol.
180:6039-6042[Abstract/Free Full Text].
|
| 46.
|
Schwab, M.,
H. Reisenzein, and G. Hogenauer.
1993.
TraM of plasmid R1 regulates its own expression.
Mol. Microbiol.
7:795-803[CrossRef][Medline].
|
| 47.
|
Sherman, J. A., and S. W. Matson.
1994.
Escherichia coli DNA helicase I catalyzes a sequence-specific cleavage/ligation reaction at the F plasmid origin of transfer.
J. Biol. Chem.
269:26220-26226[Abstract/Free Full Text].
|
| 48.
|
Skurray, R. A.,
H. Nagaishi, and A. J. Clark.
1976.
Molecular cloning of DNA from F sex factor of Escherichia coli K-12.
Proc. Natl. Acad. Sci. USA
73:64-68[Abstract/Free Full Text].
|
| 49.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
| 50.
|
Thompson, T. L.,
M. B. Centola, and R. C. Deonier.
1989.
Location of the nick at oriT of the F plasmid.
J. Mol. Biol.
207:505-512[CrossRef][Medline].
|
| 51.
|
Tsai, M. M.,
Y. H. Fu, and R. C. Deonier.
1990.
Intrinsic bends and integration host factor binding at F plasmid oriT.
J. Bacteriol.
172:4603-4609[Abstract/Free Full Text].
|
| 52.
|
Verdino, P.,
W. Keller,
H. Strohmaier,
K. Bischof,
H. Lindner, and G. Koraimann.
1999.
The essential transfer protein TraM binds to DNA as a tetramer.
J. Mol. Biol.
274:37421-37428.
|
| 53.
|
Willetts, N., and J. Maule.
1986.
Specificities of IncF plasmid conjugation genes.
Genet. Res.
47:1-11[Medline].
|
| 54.
|
Willetts, N. S., and D. J. Finnegan.
1970.
Characteristics of E. coli K12 strains carrying both an F prime and an R factor.
Genet. Res.
16:113-122[Medline].
|
| 55.
|
Yoshioka, Y.,
H. Ohtsubo, and E. Ohtsubo.
1987.
Repressor gene finO in plasmids R100 and F: constitutive transfer of plasmid F is caused by insertion of IS3 into F finO.
J. Bacteriol.
169:619-623[Abstract/Free Full Text].
|