TEXT

Top Abstract Text References

The Escherichia coli starvation response is largely dependent on the activity of the alternative primary sigma factor ^S, encoded by the rpoS gene (5, 6, 9). Since the physiological adaptations of E. coli growing under starvation conditions are quite dramatic and require a major shift in gene expression (7), the commitment to initiate the starvation response is tightly regulated. Under conditions of nutrient sufficiency, ^S is rapidly degraded by the ClpXP protease (13, 17). However, once nutrients become limiting for growth, degradation ceases and there is a dramatic increase in ^S levels. This regulation of ^S stability in response to nutrient availability is dependent on the two-component response regulator SprE, also termed RssB, which promotes ClpXP-mediated degradation of ^S (10, 12). SprE specifically promotes ^S degradation without influencing the degradation of other ClpXP substrates (18). More recently, SprE has been shown to physically bind ^S in vitro (1), and through this interaction SprE promotes the specific degradation of ^S by ClpXP.

What remains unclear is the molecular nature of the signal(s) that regulates SprE activity in response to nutrient availability. Based on homology with other response regulators, it is likely that SprE activity is modulated by phosphorylation at the conserved aspartic acid residue D58 within the N-terminal receiver domain of SprE. Consistent with this hypothesis, it was observed in vitro that phosphorylated SprE was more efficient at binding ^S than unphosphorylated SprE (1). Thus far, acetyl phosphate is the only reported source of phosphate for SprE (2). The (ackA pta) mutant, which does not synthesize acetyl phosphate, has approximately 2.5-fold higher levels of ^S than the wild type during exponential growth (2). However, increased stabilization of ^S in response to starvation in the (ackA pta) mutants indicates that there is still significant regulation of SprE activity in the absence of acetyl phosphate (2).

A constitutive allele of sprE, sprE19::cam, which results from insertion of a Tncam element 22 bp upstream of the sprE open reading frame, has been described (12). This constitutive allele, which alters the expression level of sprE, promotes degradation of ^S irrespective of growth phase and any phosphorylation signal(s) that may regulate SprE activity. This suggested to us that there might be important growth phase regulation of sprE expression, which is overcome by the sprE19::cam allele. Experiments reported here directly test the hypothesis that SprE levels are responsive to the bacterial growth phase.

SprE levels are growth phase regulated in a ^S-dependent manner. Strains used in this study are listed in Table 1. To better understand the mechanism(s) behind growth phase regulation of SprE activity, we tested whether SprE levels varied in a growth phase-dependent manner with the idea that decreased levels during stationary phase could account in part for the decreased SprE activity observed. Therefore, we assayed SprE levels throughout the growth curve by Western blot analysis (Fig. 1a). In contrast to our expectation, we observed that SprE levels were minimal during exponential growth and increased dramatically as bacteria entered into stationary phase. In fact, we were unable to reliably detect SprE during mid-exponential phase because protein levels were so low. SprE levels were approximately threefold higher in the gain-of-function sprE19::cam mutant than in the wild type during both exponential (data not shown) and stationary phases (Fig. 1b). However, SprE levels in the sprE19::cam mutant still exhibited greater than 10-fold induction under starvation conditions (data not shown), suggesting that growth phase regulation was independent of sprE transcription.

View larger version (20K): [in this window] [in a new window]   FIG. 1.   Growth phase regulation of SprE as determined by Western blot analysis. Arrows, SprE and maltose-binding protein (MBP; internal loading control). Each strain was grown in LB broth (14) at 37°C with aeration, and 1-ml samples were taken at the indicated A600. Cells were pelleted and resuspended in a volume (in milliliters) of loading buffer (14) equal to A600/5. The resulting whole-cell lysate was used for sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (8), followed by Western blot analysis (16) with anti-SprE polyclonal antiserum used at a dilution of 1 µl per ml of blocking solution. Horseradish peroxidase-linked goat anti-rabbit secondary antibody (Amersham) was used at a dilution of 1 µl per 8 ml of blocking solution. The membrane was subsequently stripped and reprobed with anti-MBP polyclonal antiserum used at a dilution of 1 µl per 5 ml of blocking solution. Protein band intensities were analyzed with ImageQuant, version 5.0. (A) MC4100 (wild-type) growth curve with KEG423 (sprE::Tn10) as a negative control for SprE; (B) MC4100 and the indicated mutant derivatives grown to stationary phase at an A600 of ~2.0.

The sprE112'-lacZ⁺ transcription fusion is not regulated by ^S. Since SprE levels varied throughout the growth curve in a ^S-dependent manner, we constructed an sprE112'-lacZ⁺ transcription fusion (Fig. 2) to test whether this was the result of transcriptional regulation. This seemed an unlikely mechanism, as noted above, since the constitutive sprE19::cam allele was also subject to growth phase regulation. However, we wanted to test this more directly since little was known about sprE transcription. The pKEG3 fusion construct was recombined with RZ5, and the recombinant sprE112'-lacZ⁺ phage was lysogenized into MC4100 at the att site.

View larger version (11K): [in this window] [in a new window]   FIG. 2.   Construction of sprE fusions. The putative regulatory sequences required for sprE regulation were amplified by PCR from the MC4100 chromosome, with Taq polymerase (United States Biochemical Corp.) and the primers rssA390 (CTTGCTATTCGCGCATCATGC) and sprE112 (CCACCAGTACCGTTGTCG). The resulting PCR fragment was polished with Pfu polymerase (Stratagene) and blunt end ligated into SmaI-digested pRS415 (15) with T4 ligase (New England Biolabs). The resulting plasmid, pKEG3, contained a sprE112'-lacZ+ transcription fusion. The pKEG3 construct was recombined in vivo with RZ5 (11), and the recombinant Lac+ Ampr phage was integrated at the att site in MC4100. The sprE114 PCR fragment was amplified using primers rssA390 and sprE114 (TCCCCCGGGAGCCGCCAGTACCGTTGTCG), followed by SmaI digestion and Pfu polymerase polishing. The sprE984 PCR fragment was amplified using primers rssA390 and sprE1014 (CGTTTGCTCATTCTGC), followed by AccI digestion (New England Biolabs) and mung bean nuclease polishing (New England Biolabs). These blunt-ended PCR products were then ligated into the SmaI-digested pRS414 vector (15). The resulting fusions were recombined into the chromosome as described above. nt, nucleotides.

View this table: [in this window] [in a new window]   TABLE 2.   -Galactosidase activity of sprE'-lacZ fusions

SprE is subject to posttranscriptional ^S-dependent growth phase regulation. The above results indicated that SprE levels were regulated posttranscriptionally by ^S, at the level of either translation or protein stability. To test this directly, we constructed a set of protein fusions between the open reading frame of sprE and that of lacZ. The sprE114'-'lacZ translation fusion is analogous to the previous sprE112'-lacZ⁺ transcription fusion, with an additional 2 bp of the sprE open reading frame to allow an in-frame fusion with lacZ (Fig. 2). The sprE984'-'lacZ translation fusion contains nearly the entire open reading frame of sprE, the intent being to include all potential cis-acting regulatory sites (Fig. 2). The resulting pKEG5 and pKEG6 fusion constructs were recombined with RZ5 and introduced into the chromosome at the att site.

SprE translation is regulated by ^S. Based on the Lac phenotypes described in the previous section, it was clear that at least some of the ^S-dependent cis-acting sites were present in the sprE984'-'lacZ protein fusion. As discussed above, it appeared likely that ^S-dependent regulation was mediated through effects on either posttranscriptional synthesis of SprE or SprE protein stability. We assayed SprE984'-'LacZ in LB media throughout the growth curve by Western blot analysis and obtained results analogous to those shown for native SprE (data not shown). However, SprE984'-'LacZ and native SprE, expressed from the chromosome in M63 minimal media with 0.2% glucose, were undetectable by [S³⁵]methionine incorporation and immunoprecipitation with our antibodies (data not shown). For this reason, we probed the mechanism behind ^S-dependent regulation of SprE984'-'LacZ with strains containing the medium-copy-number plasmid pKEG4. We assayed SprE984'-'LacZ levels throughout the growth curve in rpoS⁺ and rpoS null strains by Western blotting and found that the fusion protein expressed from pKEG4 was regulated in a ^S-dependent manner (data not shown). Therefore, the information necessary for ^S-dependent regulation of SprE was present in this protein fusion and functioned within the plasmid construct.

View larger version (50K): [in this window] [in a new window]   FIG. 3.   Growth phase regulation of SprE984'-'LacZ synthesis. Stationary-phase synthesis and stability of SprE984'-'LacZ were determined by pulse-chase analysis (16) performed on stationary-phase (A600 = 1.5) cultures of KEG500 (MC4100 pKEG4) and KEG501 (KEG500 rpoS::kan). The strains were grown in M63 minimal media containing 0.2% glucose plus 25 µg of ampicillin/liter at 37°C with aeration. Three milliliters of cell culture was labeled with 100 µCi of [35S]methionine/ml for 2 min, followed by addition of 3 ml of minimal medium containing 0.2% glucose plus 0.8% cold methionine. One-milliliter samples were taken at the indicated times postchase, and total protein was precipitated with trichloroacetic acid. The labeled whole-cell lysate was added to 1 ml of immunoprecipitation buffer containing 4 µl of LacZ antiserum and 1 µl of ClpP antiserum. The immunoprecipitated proteins were pelleted and resuspended in 40 µl of protein sample buffer. Subsequently, the sample was boiled, and 12 µl was analyzed by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis and autoradiography (4).

Conclusions. Our results demonstrate ^S-dependent posttranscriptional regulation of SprE synthesis during the growth cycle. At present, the mechanism of this growth phase-dependent regulation of SprE remains unknown. However, both SprE'-'LacZ protein fusions were similarly regulated by ^S, suggesting that all the information necessary for this growth phase regulation is present in the shorter SprE114'-'LacZ fusion. Since ^S regulates promoter recognition and transcription initiation of core RNA polymerase, it likely alters SprE translation indirectly through the regulated expression of a small regulatory RNA or an RNA-binding protein. While ^S is required to regulate SprE translation, it is not sufficient when overexpressed during exponential growth, so another factor, whose concentration also responds to nutrient availability, must be involved. As noted above, we suspect that this unknown factor acts at the level of transcription. The precise nature of the starvation signal that promotes SprE translation is also unclear. We observe translational regulation of SprE in both rich LB broth and M63 minimal medium with glucose, but whether it occurs under other growth conditions remains to be determined.