Previous Article | Next Article ![]()
Journal of Bacteriology, August 2000, p. 4137-4145, Vol. 182, No. 15
Department of Microbiology and Molecular
Genetics, The University of Texas
Received 28 January 2000/Accepted 8 May 2000
The Agrobacterium tumefaciens VirB11 ATPase is a
component of a type IV transporter dedicated to T-DNA delivery to plant
cells. In this study, we tested a prediction from genetic findings that VirB11 self-associates in vivo. A chimeric protein composed of VirB11
fused to the DNA binding domain of The T-DNA transfer system of
Agrobacterium tumefaciens is a member of the recently named
type IV, or adapted conjugation, secretion systems in gram-negative
bacteria (2, 5, 28, 40). These transporters share the
property of having evolved from ancestral conjugation systems for novel
purposes during the course of infection. Two subfamilies of the type IV
transporters can be distinguished on the basis of the exported
substrate(s). One subfamily is dedicated to the conjugal transfer
of DNA as a nucleoprotein particle. This is a cell contact-dependent
event, and transfer can occur across kingdom boundaries, as exemplified by A. tumefaciens-mediated delivery of T-DNA to plant cells
and of other DNA to yeast, Neurospora, and other fungi
(4, 8, 11).
The second subfamily exports effector proteins into the extracellular
milieu or directly into the cytosols of eukaryotic target cells.
Identified in a rapidly expanding number of bacterial pathogens, these
transporters are proposed to play diverse roles associated with
virulence. The type IV Ptl system of Bordetella pertussis directs the six-subunit pertussis toxin, assembled in the periplasm, across the bacterial outer membrane to the extracellular milieu (2). Very recently, Helicobacter pylori was
reported to use a type IV transporter encoded by the cag pathogenicity
island to deliver the 145-kDa Cag protein directly to the mammalian
host cell (31, 33). CagA undergoes tyrosine phosphorylation,
forms a cylindrical structure, and appears to induce cytoskeletal
rearrangements upon transfer to the host cell (31).
Facultative intracellular pathogens including Legionella
pneumophila, Rickettsia prowazekii, Brucella
spp., and Bartonella spp. are thought to export factors that
promote survival within macrophages, contribute to phagolysosome fusion, and/or contribute to macrophage killing (23, 32,
35).
Significant progress has been made toward definition of the structure
and function of the A. tumefaciens T-DNA transfer system (4, 8, 40). Composed of the VirB proteins, the T-DNA
transporter likely assembles as a transenvelope channel
through which T-DNA is translocated and a pilus for establishing
productive interactions with target cells. A subset of VirB protein
interactions, key early steps in transporter biogenesis, major and
minor pilin subunits, and the pilus structure have been identified
(4, 8, 13, 21, 29).
Our laboratory has been investigating the roles of the cytoplasmic
membrane ATPases VirB4 and VirB11 in T-DNA transfer (1, 4, 6, 7,
26, 38). VirB11 is related throughout its length to proposed
subunits of other type IV transporters and to a number of archaeal
proteins of unknown function. In addition, a region of VirB11 that
spans the conserved Walker A and B nucleotide binding motifs and an
adjacent His box is closely related to corresponding regions of the
type II secretion pathway GspE family of proteins (27).
Mutations of the conserved Walker A motifs of the VirB11 and GspE
family members invariably abolish activities of the cognate systems,
and ATP binding and hydrolysis has been confirmed for purified VirB11
(6) and VirB11-like proteins associated with conjugation
including TrwD (20a, 27), TrbB, and H. pylori
HP0525 (20a). Therefore, these proteins most probably share
the general property of supplying energy from ATP hydrolysis to drive
organellar assembly or substrate translocation at the gram-negative
cell envelope.
Mutations of the VirB11 Walker A motif are recessive (26).
However, a screen of virB11 alleles generated by PCR
mutagenesis resulted in the isolation of 11 dominant alleles
(38). Of considerable interest, these alleles fell into two
classes, one that coded for nonfunctional VirB11 proteins and a second
that coded for fully functional proteins when synthesized in the
absence of native VirB11. Isolation of this latter mutant class, which
exhibit a phenotype only when synthesized in the presence of native
VirB11, prompted a model that a functional T-complex transport system is composed of more than one VirB11 subunit (38). In the
present report, we supply further biochemical and molecular genetic
evidence for VirB11 self-association in vivo.
Enzymes, chemicals, and reagents.
Restriction endonucleases
were purchased from Promega (Madison, Wis.), New England Biolabs
(Beverly, Mass.), or Gibco-BRL (Grand Island, N.Y.). Klenow
fragment of Escherichia coli DNA polymerase I and
T4 DNA ligase were from Promega.
Isopropyl- Bacterial strains, plasmids, phages, and growth conditions.
The bacterial strains, plasmids, and phages used in this study and
their relevant characteristics are listed in Table
1. Except where noted,
ColE1 plasmids ligated to an IncP plasmid for introduction into
A. tumefaciens were given the ColE1 plasmid name plus a
"B" to designate broad-host-range. E. coli strains were
maintained on Luria-Bertani (LB) medium. A. tumefaciens
strains were maintained on MG/L or on AB minimal salts medium
(15). Media were supplemented with antibiotics
(concentration in micrograms per milliliter) as follows:
chloramphenicol for E. coli (35), carbenicillin (50),
kanamycin (50), tetracycline (5), carbenicillin (100), and kanamycin
(100).
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Self-Assembly of the Agrobacterium tumefaciens VirB11
Traffic ATPase


Houston Health Sciences Center,
Houston, Texas 77030
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
cI repressor protein formed
dimers, as shown by immunity of Escherichia coli to
superinfection. An allele encoding VirB11 fused at its C terminus to
the green fluorescent protein (GFP) exerted strong negative dominance
when synthesized in wild-type A. tumefaciens
cells. Dominance was suppressed by overproduction of native VirB11,
suggestive of titrating or competitive interactions between VirB11 and
VirB11::GFP. In support of the titration model, a complex of
native VirB11 and VirB11::GFP was recovered by precipitation
with anti-GFP antibodies from detergent-solubilized A. tumefaciens cell extracts. VirB11 was shown by cI repressor fusion and immunoprecipitation assays to interact with VirB11 derivatives encoded by (i) 11 dominant negative alleles, (ii) recessive
alleles bearing codon substitutions or deletions in the Walker A
nucleotide binding motif, and (iii) alleles corresponding to the 5' and
3' halves of virB11. Further immunoprecipitation studies
showed a hybrid protein composed of the N-terminal half of VirB11 fused
to GFP interacted with mutant proteins exerting dominant effects and
with a recessive Walker A deletion mutant (
GKT174-176). By contrast,
a hybrid protein composed of the C-terminal half fused to GFP
interacted with mutants exerting dominant effects but not the Walker A
mutant protein. Together, these studies establish that VirB11 assembles
as homomultimers in vivo via domains residing in each half of the
protein. Furthermore, ATP binding appears to be critical for C-terminal
interactions required for assembly of productive homomultimers.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-D-thiogalactopyranoside, (IPTG),
phenylmethylsulfonyl fluoride, carbenicillin, kanamycin, Triton X-100
(TX-100), Coomassie brilliant blue R250, p-nitroblue tetrazolium, and 5-bromo-4-chloro-3-indolylphosphate were purchased from Sigma Chemical Co. (St. Louis, Mo.). Acetosyringone
(3',5'-dimethoxy-4'-hydroxyacetophenone; AS) was from Aldrich
(Milwaukee, Wis.). Alkaline phosphatase-conjugated goat anti-rabbit
immunoglobulin G (IgG) and a Bradford protein assay kit were from
Bio-Rad Laboratories (Hercules, Calif.). Protein A-Sepharose CL-4B
beads were from Pharmacia Biotech (Piscataway, N.J.).
TABLE 1.
Bacterial strains, phages, and plasmids used
Recombinant DNA techniques.
All procedures for plasmid DNA
isolation and manipulation were performed as previously described
(14, 15). PCR amplification was performed with a
Perkin-Elmer Cetus DNA thermocycler with Taq DNA polymerase
from Perkin-Elmer (Madison, Wis.). Oligonucleotides were synthesized
with a BioSearch 8600 DNA synthesizer. Plasmids were introduced into
A. tumefaciens strains by electroporation with a Bio-Rad
electroporator. For plasmid pXZ41, the
48 reverse primer
and an oligonucleotide (CCGTCTAGAGCATGTCAATCAGTG) were used
along with pSR5 as a template for PCR amplification of a 450-bp
fragment of virB11 coding for amino acids 157 to 302. For
pXZ42, an oligonucleotide (TTGCTGGGCCATATGCGCGAC) and the T3
primer were used along with pSR1 as a template for PCR amplification of
a 755-bp fragment coding for amino acids 245 to 343. The cycling parameters were 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s. Amplified virB11[157-302] and
virB11[245-343] were cloned as an
NdeI-XbaI and NdeI-XhoI
fragments, respectively, in pBSK+.NdeI. To
introduce virB11.343::gfp at the
virB11 locus of the Ti plasmid by Campbell-type
recombination, A348 cells were transformed by electroporation with
pXZ2, which cannot replicate autonomously in A. tumefaciens.
Carbenicillin-resistant transformants with pXZ2 integrated into the Ti
plasmid coexpressed virB11.343::gfp from the native virB promoter and virB11 from a
separate virB promoter as a result of the recombination event.
Protein analysis and immunoblotting. Protein concentrations were determined with a Bradford protein assay kit, using bovine serum albumin (Sigma) as the standard. Protein samples were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes, and proteins were visualized by development of blots with anti-VirB11 antiserum and goat anti-rabbit antibodies conjugated to alkaline phosphatase. Purified His6-VirB11 was used for raising anti-VirB11 antiserum in New Zealand White rabbits by Cocalico Biologicals, Inc. (Reamstown, Pa.). Anti-VirB11 antibodies were purified by passing the antiserum through an immunoaffinity column of His6-VirB11 immobilized on cyanogen bromide-activated Sepharose 4B beads (Pharmacia Biotech). Anti-green fluorescent protein (GFP) antiserum was kindly provided by W. Margolin.
Virulence assays. A. tumefaciens strains were tested for virulence on uniformly wounded Kalanchoe daigremontiana leaves. Controls for the tumorigenesis assays included coinoculation of the same leaf with wild-type A348 and the virB11 gene deletion strain, PC1011. Virulence was scored in terms of tumor size and time course of tumor appearance. Assays were repeated at least four times for each strain on separate leaves. Tumors were photographed 4 to 5 weeks after inoculation.
Phage immunity assay.
E. coli AG1688 strains
expressing wild-type or chimeric repressors were cross-streaked against
~107 PFU of the lytic phage
KH54 spread on half of the
surface of LB agar plates. After overnight incubation at 37°C,
cross-streaks were examined visually for bacterial growth in the
presence of the phage. Immunity was determined as the ability of
strains to grow in the presence of phage. As a control for efficient
phage infection, strains were cross-streaked against phage
imm21c (17, 18).
Overexpression of His6-VirB11.
One hundred
microliters of an overnight culture of E. coli BL21(
DE3,
pPC9119) was inoculated into 50 ml of LB medium with 50 µg of
carbenicillin/ml. The culture was grown with shaking at 37°C for
2 h to an OD600 of ~0.4. Expression of
his6-virB11 from the T7 lac promoter
was induced with 1 mM IPTG for 3 h. Rifampin (200 µg/ml) was
added to inhibit transcription from the host RNA polymerase. Cells were
then collected by centrifugation at 10,000 × g for 10 min at 4°C. Cell pellets were washed twice with ice-cold 25 mM HEPES
pH 8.0 (HEPES buffer), and the cell pellets were stored at
70°C.
Purification of His6-VirB11 by IMAC. Cell pellets were thawed on ice and resuspended in 2.4 ml of HEPES buffer supplemented with 12.5% sucrose, DNase (0.2 mg/ml), and RNase (0.2 mg/ml). An equal volume of 2× radioimmunoprecipitation assay buffer (50 mM HEPES [pH 8.0], 300 mM NaCl, 0.2% SDS, 2% NP-40, 2% sodium deoxycholate) was added, and the cell suspension was incubated for 1 h at 4°C. The cell lysates were centrifuged at 14,000 × g for 45 min. Pelleted material was resuspended in 3 ml of 5 M urea-5 mM imidazole-0.5 M NaCl-25 mM HEPES (pH 8.0) and incubated at room temperature for 1 h with shaking. Unsolubilized material was removed by centrifugation at 14,000 × g for 15 min. VirB11 was purified by immobilized metal ion affinity chromatography (IMAC) as instructed by the manufacturer (Novagen, Madison, Wis.). Purified protein was obtained at a yield of 0.10 to 0.15 mg of induced culture/ml.
Immunoprecipitation under nondenaturing conditions.
AS-induced cultures (500 ml) at an OD600 of 0.7 to 0.8 were
pelleted, and cell pellets were washed twice in ice-cold HEPES buffer.
Cells were resuspended in 3.5 ml of HEPES buffer supplemented with 20%
sucrose, 0.2 mM dithiothreitol, DNase (0.2 mg/ml), and RNase (0.2 mg/ml). Lysozyme was added to a final concentration of 0.4 mg/ml, and
cells were incubated for 15 min on ice. Cells were disrupted by three
passages through a French press at 14,000 lb/in2, and the
volume of the cell lysate was brought up to 5 ml with HEPES buffer. The
lysate was centrifuged twice at 14,000 × g for 30 and
15 min, respectively, to remove unbroken cells and cell debris. The
concentration of the total cellular protein was adjusted to 1 mg of
protein/ml by addition of HEPES buffer. Membranes were solubilized by
addition of an equal volume of 2% TX-100-25 mM HEPES (pH 8.0) or 2%
TX-100-300 mM NaCl-25 mM HEPES (pH 8.0), followed by incubation at
4°C for 4 h with constant inversion. The solubilized lysates
were spun at 100,000 × g for 1 h in a model
TL-100 ultracentrifuge (Beckman Instruments, Fullerton, Calif.).
Anti-GFP antiserum was added to 1 ml of the cleared supernatant at a
titer of 1:1,000, and the mixture was incubated for 2 h at 4°C
with shaking. Protein A-Sepharose beads (3 mg/sample) presoaked in
solubilization buffer were added, and incubation was continued for
2 h at 4°C with shaking. Beads were pelleted by centrifugation at 20,000 × g for 30 s, washed three times in
solubilization buffer, resuspended in 50 µl of 2× protein sample
buffer (3% SDS, 5%
-mercaptoethanol, 0.1% bromphenol blue, 20%
glycerol, 50 mM HEPES [pH 6.8]), and boiled for 5 min. Beads were
pelleted by centrifugation at 20,000 × g for 30 s, and supernatants were analyzed by SDS-PAGE and immunoblotting.
| |
RESULTS |
|---|
|
|
|---|
Dominance of virB11.343::gfp and
suppression by VirB11 overproduction.
To assay for VirB11
self-association in vivo, we fused full-length VirB11 to GFP for
use in immunoprecipitation studies. In preliminary studies, we
determined that virB11.343::gfp exerts negative dominance, resulting in severely attenuated virulence of cells
coexpressing virB11.343::gfp and wild-type
virB11 (Fig. 1).
virB11.343::gfp expression failed to restore
virulence of the
virB11 mutant, PC1011. This allele
therefore is a member of the class II dominant virB11
alleles that code for nonfunctional VirB11 mutants
(38). A348(pXZB63) expressing gfp
exhibited wild-type virulence, showing that GFP does not interfere with
T-DNA transport. A. tumefaciens cells carrying pXZB2
synthesized a protein of ~58 kDa, the expected size of the
VirB11.343::GFP fusion protein, that coreacted with anti-VirB11 and
anti-GFP antiserum (Fig. 2A, lanes 1, 3, 5, 6, and 11). The anti-VirB11
and anti-GFP antisera did not cross-react with native GFP (lanes 7 and
8) and VirB11 (lanes 9 and 10), respectively.
|
|
VirB11.343::GFP and VirB11 form a mixed multimer. To test for interactions between VirB11.343::GFP and VirB11, anti-GFP antiserum was used to immunoprecipitate GFP-containing complexes from lysates of A348 and PC1000 strains synthesizing VirB11, VirB11.343::GFP, and/or GFP. As shown in Fig. 2B, native VirB11 coprecipitated with VirB11.343::GFP when these proteins were synthesized both in the presence and in the absence of other transfer system components (lanes 1 and 3). By contrast, VirB11 was not detected in precipitates when synthesized in the absence of the fusion protein (lanes 2 and 4) or when cosynthesized with GFP (lanes 7 and 8). Preimmune GFP antiserum did not precipitate either the fusion protein or native VirB11 (lanes 9 and 10). Together, these findings demonstrate that VirB11 and VirB11.343::GFP form mixed multimers independent of the presence of other VirB proteins. We attempted to further confirm VirB11 multimerization by coexpressing alleles for native VirB11 and a functional, N-terminally His-tagged form of VirB11 in A. tumefaciens. Upon detergent solubilization of membranes and IMAC, we reproducibly detected abundant levels of both the 38-kDa VirB11 and 40-kDa His-VirB11 species in the column eluates. However, a low level of native VirB11 also was retained on Ni2+ or Co2+ affinity columns upon chromatography of extracts from cells expressing wild-type virB11 in the absence of his-virB11. This residual binding of native VirB11 to the columns prevented use of IMAC to confirm VirB11 multimerization (data not shown).
VirB11 confers dimerization of the
cI repressor
DNA-binding domain.
To gain independent evidence for VirB11
self-association, we used the
cI repressor fusion system. cI
repressor protein functions as a homodimer, each monomer consisting of
an N-terminal DNA binding and a C-terminal dimerization domain.
The N-terminal domain (cI') by itself binds operator sites poorly and
is ineffective in preventing expression of early lytic pathway genes.
The C-terminal domain, or substitutions of this domain with
heterologous dimerizing proteins or domains, strongly promotes cI
dimerization and operator site binding and thus confers immunity to
superinfection (17, 18).
KH54. Bacterial cells carrying
pSR66 or pJH157 were immune to infection by
KH54, whereas those
carrying pKH101 or pZ150 were sensitive (Fig.
3A). To test for the presence of the
phage receptor, strains were cross-streaked against phage
imm21c, a phage derivative with a
substitution of the immunity region such that the cI repressor cannot
repress its lytic development (Fig. 3B). The sensitivity of strains to
imm21c confirmed the expression of
the
phage receptor in the cells. We attempted to inhibit cI dimer
formation by synthesis of native VirB11 from a compatible IncP replicon
but were unable to reproducibly detect conversion of host cells to
KH54 sensitivity. One explanation is that the abundance of the
native protein was insufficient for titrating the cI'::VirB11
fusion proteins. Another possibility consistent with chemical
cross-linking data (25) and results of a recent study of the
VirB11 homolog TrbB (20) is that VirB11 assembles as
higher-order homo-oligomers in vivo. If so, higher-order mixed
multimers of VirB11 and cI'::VirB11 might retain the capacity to
bind efficiently to cI operator sites.
|
Self-interaction of VirB11 mutants.
VirB11 requires an intact
Walker A motif for function in DNA export. Alleles with Walker A codon
substitutions or deletions are recessive, which could be due to a
failure of these mutant proteins to oligomerize. To examine whether
nucleoside triphosphate binding or hydrolysis is required for VirB11
self-assembly, the K175Q and
GKT174-176 alleles were
coexpressed with virB11.343::gfp in PC1000
cells, and the resulting cell lysates were subjected to
immunoprecipitation with anti-GFP antiserum. We also fused the K175Q
and
GKT174-176 alleles at their 3' ends to gfp and coexpressed these chimeric genes with the K175Q and
GKT174-176 alleles, respectively. As summarized in Table
2, the Walker A mutant proteins
coprecipitated with VirB11.343::GFP. In addition, the K175Q
and
GKT174-176 mutant proteins coprecipitated with the
K175Q::GFP and
GKT174-176::GFP fusion proteins,
respectively. The Walker A mutant proteins were not detected in
material precipitated from strains lacking the GFP fusion proteins
(Table 2) (25).
|
GKT174-176 to
self-associate with the cI repressor fusion system. E. coli AG1688 strains with pSR68 expressing
cI'::virB11K175Q and pSR69 expressing
cI'::virB11
GKT174-176 each grew in the
presence of phage
KH54, suggesting that the Walker A mutants mediate
cI repressor dimerization (Table 2) (25). Together, these
findings show that VirB11 minimally can dimerize independently of ATP
binding or hydrolysis.
Next, we assayed for interactions between VirB11 and mutant proteins
exerting negative dominance previously shown to be suppressible by
VirB11 overproduction (38). One class of dominant alleles (class II) encodes nonfunctional VirB11 mutants, whereas a second class
(class III) encoded VirB11 derivatives that exhibited wild-type function when expressed in the absence of the native protein. Thus, if oligomerization is a prerequisite for VirB11 function, at
least the latter class of mutants was expected to self-assemble. To
test this prediction, extracts from PC1000 cells engineered to
coexpress virB11.343::gfp and one of
the dominant alleles were subjected to immunoprecipitation with
anti-GFP antisera. The alleles also were fused in frame
downstream of the portion of cI encoding the N-terminal DNA
binding domain, and resulting E. coli strains were assayed
for immunity to
KH54 superinfection. All of the mutant proteins
coprecipitated with VirB11.343::GFP from A. tumefaciens extracts and also mediated immunity to
phage when produced as cI
fusions in E. coli (Table 2) (25).
These findings support our model that these mutant proteins most
probably exert their dominant effects by forming nonproductive
complexes with native VirB11.
VirB11 association with truncated derivatives.
Previously, we
showed that an allele encoding the C-terminal half of VirB11 exerts
negative dominance, whereas one encoding the N-terminal half is
recessive (26). To test whether these truncation derivatives
differ in the ability to interact with native VirB11, we fused the
coding sequences for residues 1 to 157 and 157 to 343 to gfp
and coexpressed the resulting chimeric genes with wild-type
virB11 in PC1000 cells. The VirB11[1-157]::GFP protein
was detected by immunoblotting as one prominent polypeptide of 42 kDa
immunoreactive with anti-VirB11 (Fig. 4A,
lane 3) and anti-GFP (data not shown) antisera. The
VirB11[157-343]::GFP fusion migrated as two immunoreactive
species of ~44 and 41 kDa (Fig. 4A, lane 4), most probably because of
proteolytic degradation since the 41-kDa species also was detected in
extracts from cells expressing full-length VirB11::GFP (lane 1).
PC1000 cells coexpressing alleles for native VirB11 and each of the
truncated fusion derivatives were used for immunoprecipitation analyses
with anti-GFP antiserum. Full-length VirB11 was precipitated from
lysates of cells that coexpressed either hybrid protein and was not
precipitated from lysates lacking these hybrid proteins (Fig. 4 and
Table 3). In addition, the C-terminal
half of VirB11 was not precipitated by VirB11[1-157]::GFP, and
conversely, the N-terminal half of VirB11 was not precipitated by
VirB11[157-343]::GFP (Table 3).
|
|
phage, suggesting that
these VirB11 truncation derivatives also can mediate cI
dimerization. By contrast, AG1688(pSR63) and
AG1688(pSR64) cells, synthesizing the fusions cI'::VirB11[157-302] and cI'::VirB11[245-343],
respectively, were unable to confer resistance to
KH54 (Fig.
5). The failure of smaller N- or
C-terminal fragments to support self-interaction could be due to their
intrinsic instabilities or because they lack required sequence
information for dimerization. Together, results of the
immunoprecipitation and cI studies indicate that VirB11 possesses two
domains, one in each half of the protein, that self-interact.
|
| |
DISCUSSION |
|---|
|
|
|---|
We are interested in defining how VirB11 is configured at the cytoplasmic membrane and the role it plays in macromolecular transport. Initial studies in this laboratory resulted in the isolation of a number of dominant VirB11 alleles. In all cases, dominance was at least partially suppressed by overproduction of any combination of VirB9, VirB10, and/or VirB11. A reasonable hypothesis to explain these suppression data is that the overproduction of proteins that interact directly or indirectly with VirB11 resulted in sequestration of the mutant proteins into nonproductive complexes (38). A study by the Binns laboratory supplied independent evidence for interactions between VirB9, VirB10, and VirB11 and further indicated that these proteins might act stoichiometrically and be rate-limiting for transporter assembly (36).
Our early studies of the dominant alleles showed that they fell into
two classes. The class II mutations abolished protein functionality, as
judged by a failure of the corresponding alleles to complement a
VirB11 mutation in virulence assays. By contrast, the class III
mutations exerted strong negative dominance when alleles were
coexpressed with VirB11 but encoded functional proteins when
synthesized in the absence of the native protein. The observation that
these mutant proteins displayed a phenotype only when coexpressed with
native VirB11 led to a model that VirB11 functions as a
homomultimer (38). In the present study, we gained further
evidence for VirB11 self-association in vivo. Precipitation studies
revealed an interaction between native VirB11 and a VirB11::GFP
fusion protein, and cI repressor fusion studies demonstrated the
capacity of cI'::VirB11 to dimerize. Interactions also were
detected between full-length VirB11 and class II and III mutants
exerting dominant effects as well as with Walker A mutants with
recessive effects. For each of the observed interactions, complex
formation clearly occurred independently of other VirB proteins, as
demonstrated by the fact the complexes were recovered from A. tumefaciens mutants deleted of the remaining virB genes
or they were detected in E. coli.
Both classes of dominant mutations were previously reported to be conservative substitutions that map to two fairly discrete regions of VirB11, one immediately upstream of the Walker A motif in the N-terminal half of the protein and the second in the C-terminal half of the protein (38). These findings led to the proposal that these regions might correspond to domains that mediate VirB11 complex formation. In support of this view, here we showed that both halves of VirB11 indeed are capable of interacting with the full-length protein. Furthermore, each half of VirB11 interacted with itself but not with the other half of the protein. Thus, as a working model we now propose that VirB11 self-assembles via N-N and C-C domain interactions.
Our present investigations have not revealed any differences between the class II and III dominant mutant proteins with respect to the capacity to self-assemble. Both classes of mutant proteins mediated dimerization of the DNA binding domain of cI repressor and coprecipitated with full-length VirB11 fused to GFP. Both classes also coprecipitated with the N- and C-terminal halves of VirB11 fused to GFP. Thus, we predict that in merodiploid cells the class II and III mutants dimerize with wild-type VirB11, but these mixed multimers arrest at some later stage in the transporter biogenesis pathway. Similarly, dimers of class II mutants that assemble in cells devoid of native VirB11 likely are dead-end complexes. However, the class III dimers that assemble in cells lacking native VirB11 must be competent for progression along the transporter biogenesis pathway. Given the clustering and the conservative nature of the class II and III substitutions (38), it is likely that the different behaviors of these mutants can be attributed to small perturbations of charge or conformation that render the class II homomultimers, but not the class III homomultimers, nonfunctional. Although our model proposes the dominant mutations affect transporter assembly, it is also possible these mutations impair the ability of a fully assembled transporter to dock or translocate substrate.
Our studies with the Walker A mutants revealed fundamentally different requirements for the N- and C-terminal regions of VirB11 to promote self-interaction. Whereas the N-terminal portion of VirB11 was able to multimerize with mutant proteins exhibiting dominant or recessive effects, the C-terminal portion failed to interact with the recessive Walker A mutants. These findings strongly suggest that ATP binding or hydrolysis is required for self-interaction via the C-terminal domain. We propose that nucleotide binding is required to induce a conformation appropriate for productive self-interaction. The ATP dependence of the C-terminal interaction domain offers a possible explanation for the recessive behaviors of VirB11 mutants. If, as predicted, ATP binding or hydrolysis is a critical reaction during transporter morphogenesis, mutants defective in this reaction might fail to interact with other VirB proteins and thus enter the morphogenetic pathway. In support of this view, an allele encoding the N-terminal half of VirB11, which lacks the nucleotide-binding motif, is recessive, whereas one encoding a C-terminal half with intact nucleotide binding motif is dominant (26). Of further possible significance, we have shown that Walker A mutants accumulate at appreciably lower levels than the wild-type protein even when overexpressed from an IncP replicon whose copy number exceeds that of the Ti plasmid 5- to 10-fold (25, 26). Presumably, complexes composed of Walker A mutant proteins are unstable and rapidly degraded. By analogy, several VirB proteins, including wild-type VirB11, have been shown to be unstable in various virB null mutants that show defects in transporter assembly (1, 15).
VirB11 and PulE are paradigmatic members of a superfamily of ATPases associated with macromolecular trafficking. Collectively, members of this superfamily contribute to motility, the secretion of virulence factors, and the assembly of sex and adhesive pili via secretion pathways that are now designated as types II and IV (2, 5, 8, 23, 24, 35). In fact, a comparison of the VirB11-related proteins with the ProDom protein domain program (http://www.toulouse.inra.fr/prodom.html) shows that a region corresponding to the N-terminal ~120 residues of the VirB11 is highly related to N-terminal regions of proteins associated with type IV transport but is considerably less related to the N-terminal regions of PulE and other ATPases associated with type II transport. By contrast, the C-terminal halves of all VirB11- and PulE-like proteins are highly homologous. It is interesting to speculate that the functional and, possibly, structural relatedness of these protein families is limited to their C-terminal nucleotide binding pockets.
Recent progress has been made toward definition of oligomeric structures of several traffic ATPases. There now is considerable evidence that the ATPase subunits of the ABC transporter superfamily assemble as dimers in which the monomers cooperatively interact to catalyze transport (9, 10, 30). Similarly, SecA translocase functions as a dimer (12). Multimerization also was demonstrated for two VirB11-like ATPases associated with type II secretion, PulE, an essential component of the Klebsiella oxytoca pullulanase secretion machinery (24), and Pseudomonas aeruginosa XcpR, also required for type II protein secretion (34). Interestingly, PulE migrates in nonreducing SDS-polyacrylamide gels as higher-order disulfide-cross-linked homo-oligomers (24). We similarly have observed that VirB11 forms disulfide-cross-linked complexes upon electrophoresis of cell extracts under nonreducing conditions (25, 26). It is not known for either PulE or VirB11 whether these cross-links form in vivo or immediately upon cell lysis. Nevertheless, identification of these cross-linked complexes is consistent with the notion that both ATPases assemble as higher-order homomultimers in vivo.
Recently, Krause et al. (20, 20a) provided a possible architecture for the VirB11-like ATPases. Electron microscopy studies revealed that the TrbB ATPase from the IncP plasmid RP4, TrwD of plasmid R388, and HP0525 of H. pylori form homohexameric donut-shaped complexes (20, 20a). Further, gel filtration studies revealed differences in the oligomeric state of TrbB in the presence and absence of ATP. Thus, consistent with results from our studies of the VirB11 Walker A mutants, ATP binding appears to be critical for TrbB oligomerization. Current efforts in our laboratory are aimed at defining the stoichiometry of VirB11 oligomers and determining whether VirB11 also forms oligomeric rings. A complicating aspect of these studies is that in contrast to TrbB, which is cytosolic and quite soluble in solution, VirB11 is almost exclusively tightly membrane associated and readily aggregates in solution (6, 25, 26, 38).
| |
ACKNOWLEDGMENTS |
|---|
We thank members of the laboratory for helpful discussions, William Margolin for anti-GFP antiserum and GFP constructs, and Jim Hu for the cI repressor fusion system and helpful suggestions.
This work was supported by NIH grant GM48746.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Department of
Microbiology and Molecular Genetics, The University of Texas
Houston Health Sciences Center, 6431 Fannin, Houston, TX 77030. Phone: (713)
500-5440. Fax: (713) 500-5499. E-mail:
christie{at}utmmg.med.uth.tmc.edu.
Present address: Department of Biology, Massachusetts Institute of
Technology, Cambridge, MA 02139.
Present address: CSIRO Plant Industry, Canberra, ACT 2601, Australia.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Berger, B. R., and P. J. Christie.
1994.
Genetic complementation analysis of the Agrobacterium tumefaciens virB operon: virB2 through virB11 are essential virulence genes.
J. Bacteriol.
176:3646-3660 |
| 2. | Burns, D. L. 1999. Biochemistry of type IV secretion. Curr. Opin. Microbiol. 2:25-29[CrossRef][Medline]. |
| 3. |
Chen, C.-Y., and S. C. Winans.
1991.
Controlled expression of the transcriptional activator gene virG in Agrobacterium tumefaciens by using the Escherichia coli lac promoter.
J. Bacteriol.
173:1139-1144 |
| 4. |
Christie, P. J.
1997.
The Agrobacterium tumefaciens T-complex transport apparatus: a paradigm for a new family of multifunctional transporters in eubacteria.
J. Bacteriol.
179:3085-3094 |
| 5. | Christie, P. J., and J. P. Vogel. Bacterial type IV secretion: conjugation systems adapted for delivery of effector molecules to host cells. Trends Microbiol., in press. |
| 6. |
Christie, P. J.,
J. E. Ward,
S. C. Winans, and E. W. Nester.
1989.
A gene required for transfer of T-DNA to plants encodes an ATPase with autophosphorylating activity.
Proc. Natl. Acad. Sci. USA
86:9677-9681 |
| 7. | Dang, T. A., X.-R. Zhou, B. Graf, and P. J. Christie. 1999. Dimerization of the Agrobacterium tumefaciens VirB4 ATPase and the effect of ATP-binding cassette mutations on assembly and function of the T-DNA transporter. Mol. Microbiol. 32:1239-1253[CrossRef][Medline]. |
| 8. | Das, A. 1998. DNA transfer from Agrobacterium to plant cells in crown gall tumor disease. Subcell. Biochem. 29:343-363[Medline]. |
| 9. |
Davidson, A.,
S. Laghaeian, and D. Mannering.
1996.
The maltose transport system of Escherichia coli displays positive cooperativity in ATP hydrolysis.
J. Biol. Chem.
271:4858-4863 |
| 10. |
Davidson, A. L., and S. Sharma.
1997.
Mutation of a single MalK subunit severely impairs maltose transport activity in Escherichia coli.
J. Bacteriol.
179:5458-5464 |
| 11. | de Groot, M. J. A., P. Bundock, P. J. J. Hooykaas, and A. G. M. Beijersbergen. 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16:839-842[CrossRef][Medline]. |
| 12. | Driessen, A. J. 1993. SecA, the peripheral subunit of the Escherichia coli precursor protein translocase, is functional as a dimer. Biochemistry 32:13190-13197[CrossRef][Medline]. |
| 13. |
Eisenbrandt, R.,
M. Kalkum,
E. M. Lai,
R. Lurz,
C. I. Kado, and E. Lanka.
1999.
Conjugative pili of IncP plasmids, and the Ti plasmid T pilus are composed of cyclic subunits.
J. Biol. Chem.
274:22548-22555 |
| 14. |
Fernandez, D.,
T. A. T. Dang,
G. M. Spudich,
X.-R. Zhou,
B. R. Berger, and P. J. Christie.
1996.
The Agrobacterium tumefaciens virB7 gene product, a proposed component of the T-complex transport apparatus, is a membrane-associated lipoprotein exposed at the periplasmic surface.
J. Bacteriol.
178:3156-3167 |
| 15. |
Fernandez, D.,
G. M. Spudich,
X.-R. Zhou, and P. J. Christie.
1996.
The Agrobacterium tumefaciens VirB7 lipoprotein is required for stabilization of VirB proteins during assembly of the T-complex transport apparatus.
J. Bacteriol.
178:3168-3176 |
| 16. | Garfinkel, D. J., R. B. Simpson, L. W. Ream, F. F. White, M. P. Gordon, and E. W. Nester. 1981. Genetic analysis of crown gall: fine structure map of the T-DNA by site-directed mutagenesis. Cell 27:143-153[CrossRef][Medline]. |
| 17. | Hu, J. 1995. Repressor fusions as a tool to study protein-protein interactions. Structure 3:431-433[Medline]. |
| 18. | Hu, J., M. Kornacker, and A. Hochschild. 2000. Escherichia coli one- and two-hybrid systems for the analysis and identification of protein-protein interactions. Methods 20:80-94[CrossRef][Medline]. |
| 19. | Klee, H. J., M. F. Yanofsky, and E. W. Nester. 1985. Vectors for transformation of higher plants. Bio/Technology 3:637-642[CrossRef]. |
| 20. | Krause, S., M. Barcena, W. Panseqrau, R. Lurz, J. Carazo, and E. Lanka. 2000. Sequence related protein export NTPases encoded by the conjugative transfer region of RP4 and by the cag pathogenicity island of Helicobacter pylori share similar hexameric ring structures. Proc. Natl. Acad. Sci. USA 182:2761-2770. |
| 20a. |
Krause, S.,
W. Pansegrau,
R. Lurz,
F. de la Cruz, and E. Lanka.
2000.
Enzymology of type IV macromolecule secretion systems: the conjugative transfer regions of plasmids RP4 and R388 and the cag pathogenicity island of Helicobacter pylori encode structurally and functionally related nucleoside triphosphate hydrolases.
J. Bacteriol.
182:2761-2770 |
| 21. |
Lai, E. M., and C. I. Kado.
1998.
Processed VirB2 is the major subunit of the promiscuous pilus of Agrobacterium tumefaciens.
J. Bacteriol.
180:2711-2717 |
| 22. |
Ma, X.,
D. W. Ehrhardt, and W. Margolin.
1996.
Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein.
Proc. Natl. Acad. Sci. USA
93:12998-13003 |
| 23. | O'Callaghan, D., C. Cazevieille, A. Allardet-Servent, M. L. Boschiroli, G. Bourg, V. Foulongne, P. Frutos, Y. Kulakov, and M. Ramuz. 1999. A homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl type IV secretion systems is essential for intracellular survival of Brucella suis. Mol. Microbiol. 33:1210-1220[CrossRef][Medline]. |
| 24. | Possot, O., and A. Pugsley. 1994. Molecular characterization of PulE, a protein required for pullulanase secretion. Mol. Microbiol. 12:287-299[Medline]. |
| 25. |
Rashkova, S.
1998.
Studies of subcellular localization and complex formation of the Agrobacterium tumefaciens transport ATPase VirB11. Ph.D. thesis.
The University of Texas Houston Medical School, Houston.
|
| 26. |
Rashkova, S.,
G. M. Spudich, and P. J. Christie.
1997.
Mutational analysis of the Agrobacterium tumefaciens VirB11 ATPase: identification of functional domains and evidence for multimerization.
J. Bacteriol.
179:583-589 |
| 27. |
Rivas, S.,
S. Bolland,
E. Cabezon,
F. M. Goni, and F. de la Cruz.
1997.
TrwD, a protein encoded by the IncW plasmid R388, displays an ATP hydrolase activity essential for bacterial conjugation.
J. Biol. Chem.
272:25583-25590 |
| 28. | Salmond, G. P. C. 1994. Secretion of extracellular virulence factors by plant pathogenic bacteria. Annu. Rev. Phytopathol. 32:181-200[CrossRef]. |
| 29. |
Schmidt-Eisenlohr, H.,
N. Domke,
C. Angerer,
G. Wanner,
P. C. Zambryski, and C. Baron.
1999.
Vir proteins stabilize VirB5 and mediate its association with the T pilus of Agrobacterium tumefaciens.
J. Bacteriol.
181:7485-7492 |
| 30. | Schneider, E., and S. Hunke. 1998. ATP-binding-cassette (ABC) transport systems: functional and structural aspects of the ATP-hydrolyzing subunits/domains. FEMS Microbiol. Rev. 22:1-20[CrossRef][Medline]. |
| 31. |
Segal, E.,
J. Cha,
J. Lo,
S. Falkow, and L. Tompkins.
1999.
Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori.
Proc. Natl. Acad. Sci. USA
96:14559-14564 |
| 32. | Segal, G., and H. A. Shuman. 1998. How is the intracellular fate of the Legionella pneumophila phagosome determined? Trends Microbiol. 6:253-255[CrossRef][Medline]. |
| 33. |
Stein, M.,
R. Rappuoli, and A. Covacci.
2000.
Tyrosine phosphorylation of the Helicobacter pylori CagA antigen after cag-driven host cell translocation.
Proc. Natl. Acad. Sci. USA
97:1263-1268 |
| 34. | Turner, L. R., J. W. Olson, and S. Lory. 1997. The XcpR protein of Pseudomonas aeruginosa dimerizes via its N-terminus. Mol. Microbiol. 26:877-887[CrossRef][Medline]. |
| 35. | Vogel, J. P., and R. R. Isberg. 1999. Cell biology of Legionella pneumophila. Curr. Opin. Microbiol. 2:30-34[CrossRef][Medline]. |
| 36. |
Ward, J. E. J.,
E. M. Dale,
P. J. Christie,
E. W. Nester, and A. N. Binns.
1990.
Complementation analysis of Agrobacterium tumefaciens Ti plasmid virB genes by use of a vir promoter expression vector: virB9, virB10, and virB11 are essential virulence genes.
J. Bacteriol.
172:5187-5199 |
| 37. |
Watson, B.,
T. C. Currier,
M. P. Gordon,
M. D. Chilton, and E. W. Nester.
1975.
Plasmid required for virulence of Agrobacterium tumefaciens.
J. Bacteriol.
123:255-264 |
| 38. |
Zhou, X.-R., and P. J. Christie.
1997.
Suppression of mutant phenotypes of the Agrobacterium tumefaciens VirB11 ATPase by overproduction of VirB proteins.
J. Bacteriol.
179:5835-5842 |
| 39. |
Zhou, X.-R., and P. J. Christie.
1999.
Mutagenesis of Agrobacterium VirE2 single-stranded DNA-binding protein identifies regions required for self-association and interaction with VirE1 and a permissive site for hybrid protein construction.
J. Bacteriol.
181:4342-4352 |
| 40. | Zupan, J., D. Ward, and P. Zambryski. 1998. Assembly of the VirB transport complex for DNA transfer from Agrobacterium tumefaciens to plant cells. Curr. Opin. Microbiol. 1:649-655[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|