Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4328-4336, Vol. 182, No. 15
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Eight of Fourteen gvp Genes Are
Sufficient for Formation of Gas Vesicles in Halophilic
Archaea
Sonja
Offner,1,
Annette
Hofacker,1
Gerhard
Wanner,2 and
Felicitas
Pfeifer1,*
Institut für Mikrobiologie und Genetik,
Technische Universität Darmstadt, D-64287
Darmstadt,1 and Institut für
Botanik, Ludwig-Maximilians-Universität München, D-80638
Munich,2 Germany
Received 28 January 2000/Accepted 9 May 2000
 |
ABSTRACT |
The minimal number of genes required for the formation of gas
vesicles in halophilic archaea has been determined. Single genes of the
14 gvp genes present in the p-vac region on plasmid pHH1 of
Halobacterium salinarum (p-gvpACNO and
p-gvpDEFGHIJKLM) were deleted, and the remaining genes were
tested for the formation of gas vesicles in Haloferax
volcanii transformants. The deletion of six gvp genes
(p-gvpCN, p-gvpDE, and p-gvpHI)
still enabled the production of gas vesicles in H. volcanii. The gas vesicles formed in some of these
gvp gene deletion transformants were altered in shape
(
I,
C) or strength (
H) but still functioned as
flotation devices. A minimal p-vac region (minvac) containing
the eight remaining genes (gvpFGJKLM-gvpAO) was constructed
and tested for gas vesicle formation in H. volcanii. The
minvac transformants did not form gas vesicles; however,
minvac/gvpJKLM double transformants contained gas vesicles
seen as light refractile bodies by phase-contrast microscopy.
Transcript analyses demonstrated that minvac transformants synthesized
regular amounts of gvpA mRNA, but the transcripts derived
from gvpFGJKLM were mainly short and encompassed only gvpFG(J), suggesting that the
gvpJKLM genes were not sufficiently expressed. Since
gvpAO and gvpFGJKLM are the only
gvp genes present in minvac/JKLM transformants containing
gas vesicles, these gvp genes represent the minimal set
required for gas vesicle formation in halophilic archaea. Homologs of
six of these gvp genes are found in Anabaena
flos-aquae, and homologs of all eight minimal halobacterial
gvp genes are present in Bacillus megaterium
and in the genome of Streptomyces coelicolor.
 |
INTRODUCTION |
Gas vesicles are formed by
halophilic archaea, cyanobacteria, and some heterotrophic bacteria and
allow these microorganisms to float at a favorable depth in their
watery environment. These proteinaceous structures vary in length from
0.2 to 1.5 µm (for a review, see reference 39).
The ribbed gas vesicle envelope exclusively consists of protein
and appears to be watertight but is freely permeable to dissolved
ambient gases. Electron micrographs indicate 4.6-nm-wide ribs arranged
perpendicular to the long axis that are formed by a helix of low pitch
and not by a stack of hoops (3, 30). The major constituent
of the gas vesicle envelope is the hydrophobic 7- to 8-kDa protein GvpA
(9, 38). Immunological studies revealed GvpC (20 to 42 kDa)
as a second but minor protein constituent (8, 12, 15). In
cyanobacteria, GvpC is located at the outer surface of the gas vesicle
envelope and strengthens the entire structure (15, 22). In
halophilic archaea, GvpC also appears to be responsible for a constant
diameter of the cylindrical part of the gas vesicle (29).
Genes encoding proteins involved in gas vesicle formation have been
identified in a few species of cyanobacteria (Anabaena flos-aquae, Calothrix strain PCC 7601) and in
halophilic archaea (Halobacterium salinarum, Haloferax
mediterranei, and the haloalkaliphilic archaeon
Natronobacterium vacuolatum) (6, 10, 14, 20, 21,
27), as well as in the soil bacterium Bacillus
megaterium (26). In the case of halophilic archaea, 14 gvp genes cluster in an approximately 9-kb DNA region termed
the vac region (10, 11, 19, 20). H. salinarum
PHH1 harbors the two related vac regions p-vac (located on plasmid
pHH1) and c-vac (located in the chromosome) (10, 18, 19). In
both vac regions, the 14 gvp genes are identically arranged:
gvpACNO form one cluster, and gvpDEFGHIJKLM are
located upstream of gvpA and oriented in the opposite
direction. Two promoters located in front of c-gvpA and c-gvpD drive the expression of these genes in the
c-vac region, whereas four promoters could be
identified in the p-vac region, resulting in
p-gvpO and p-gvpFGHIJKLM transcripts in
addition to the p-gvpA, p-gvpACNO, and
p-gvpDE mRNAs (29). The expression of the
p-vac region leads to predominantly spindle-shaped gas vesicles
throughout growth, whereas the c-vac region is only expressed in p-vac
deletion mutants, and then in the stationary growth phase only (9,
17). Fourteen gvp genes designated
gvpAPQBRNFGLSKJTU are found in the gram-positive
soil bacterium B. megaterium; the highly similar
gvpA and gvpB genes of this gene cluster
could encode the major gas vesicle structural protein GvpA
(26). So far, the transcription of these gvp
genes and gas vesicle formation have not been investigated; however,
Escherichia coli transformants containing the
gvpBRNFGLSKJTU genes of B. megaterium have been reported to form tiny gas vesicles (26).
The function of some of the halobacterial Gvp proteins has been
determined by transformation experiments using halobacterial shuttle vectors conferring resistance to mevinolin (2, 25) or novobiocin (pMDS20) (16) and the gas vesicle-negative
(Vac
) species Haloferax volcanii as the
recipient strain. Also, an expression vector (pJAS35) is available
which enables high-level expression of halobacterial reading frames
under the control of the halobacterial ferredoxin (fdx) gene
promoter (34). Such transformation experiments showed that
(i) the entire p-vac region (construct M-O) leads to gas vesicle
formation in H. volcanii (10), and (ii) the
p-gvpACNO (A-O) and p-gvpDEFGHIJKLM (D-M) gene clusters present on different vector constructs (or A-O/F-M =
DE) allow the formation of spindle-shaped gas vesicles in H. volcanii transformants (28). The GvpD and GvpE proteins
are involved in the regulation of gas vesicle formation: GvpE is a transcriptional activator required for gvpA promoter
activity, whereas GvpD is involved in the repression of gas vesicle
formation (11, 23, 24, 36).
Deletion studies have been carried out to determine the necessity of
each gene found in the p-gvpACNO operon for gas vesicle formation (29). These experiments show that
A
transformants (containing the entire p-vac region except for the
gvpA gene) and
O transformants (p-vac region without
gvpO) are Vac
, whereas
N
(Vac+/
) and
C (Vac+) transformants produce
gas vesicles.
C transformants contain many irregularly shaped gas
vesicles with various diameters throughout a single gas vesicle. The
finding that gas vesicles of
C+C transformants regain the wild-type
shape implies that GvpC is involved in shape determination
(29). A different approach has been employed by S. DasSarma's group, who inserted foreign DNA into various
gvp genes present on endogenous plasmid pNRC100 and
analyzed the effect in pNRC100-negative H. halobium mutant strain SD109 (7). This mutant still
contains the c-vac region, although the cells appear to be devoid of
gas vesicles. Since the two approaches revealed different results in 6 out of 14 gvp cases (including the data reported here), both
methods will be discussed in more detail.
In this study, we examined the necessity of genes located in the
p-gvpFGHIJKLM cluster for gas vesicle formation. Single
gvp genes were deleted, and the expression of the remaining
gvp genes was analyzed in H. volcanii
transformants.
H and
I transformants still produced gas vesicles,
whereas all other deletion variants were gas vesicle free. Together
with the results obtained earlier (28, 29), these
experiments show that 6 of the 14 gvp genes can be deleted
without affecting the ability of the cell to form gas vesicles. We also
investigated whether the eight genes gvpA, gvpO,
and gvpFGJKLM represent the minimal number of gvp
genes sufficient for gas vesicle formation in H. volcanii.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
E. coli strains DH5
(13) and GM1674 (dam
)
(31) harboring plasmid constructs were cultured at 37°C in
LB broth (37) containing ampicillin at 100 µg/ml. H. volcanii WFD11 (lacking endogenous plasmid pHV2) (5)
was grown in rich medium containing, per liter, 175 g of NaCl,
37 g of MgSO4 · 7H2O, 3.7 g of
KCl, 5 g of Bacto Tryptone, 3 g of Bacto Yeast Extract, 25 ml
of 1 M Tris/HCl (pH 7.2), 5 ml of 10% CaCl2 · 2H2O, and 100 µl of 100 µM MnCl2.
Halobacterial transformants were selected on agar plates containing
novobiocin at 0.2 µg/ml and/or mevinolin or lovastatin at 6 µg/ml.
For inspection of the gas vesicle phenotype or isolation of total
protein, transformants were grown in the medium described above, except
that the NaCl concentration was raised to 206 g/liter to enhance gas
vesicle formation. Lovastatin and mevinolin were a generous gift from
Merck, Sharp and Dohme GmbH, Munich, Germany.
Constructs used for transformation of H. volcanii and
transformation procedure.
The subfragments of the p-vac region
used for the construction of plasmids are listed in Table
1. The protruding ends of DNA fragments
E-O, F-O, and G-O were blunt ended by T4 polymerase and ligated to the
blunt-ended BamHI site of halobacterial vector pWL102,
whereas BglII fragment D-O was directly ligated to the BamHI site of pWL102 (25). The
L1/2-O/pWL102 construct (Table 1) was used to yield the
H-O, I-O, J-O, K-O, and L-O fragments. This construct was cut at
the single NheI site located 36 bp upstream of the
p-gvpH stop codon and at the single XbaI
site located in the pWL102 sequence downstream of the truncated
p-gvpL codon, resulting in a deletion of 36 bp of
p-gvpH and all of
p-gvpIJKL1/2. The remaining
NheI/XbaI fragment, H9/10-O/pWL102
[
gvp(H)IJKL1/2], was ligated to various fragments amplified by PCR. PCRs were performed with the p-vac region as the template and oligonucleotide
CTCGAAATTCGGCTAGCACGAACA (positions 2746 to 2723 of the p-vac region, containing the NheI site [underlined]
within p-gvpH) as primer 1 and the respective oligonucleotide containing an XbaI site (as listed in Table
1) as primer 2. The PCR products started at the NheI site in
p-gvpH and contained 36 bp derived from the 3' end of
p-gvpH [= p-gvp(H)], p-gvp(H)I,
p-gvp(H)IJ,
p-gvp(H)IJK, or
p-gvp(H)JKL. These fragments were
cleaved with NheI/XbaI and ligated to
NheI/XbaI fragment H9/10-O/pWL102,
resulting in constructs H-O through L-O.
The p-vac subfragments E-M, F-M, G-M, H-M, I-M, J-M, K-M, and M-M
(Table
1) were produced by PCR using oligonucleotide
GTCTGGACGCTA
CCATGGCCTCTCGTTCCC
(located
downstream of p-
gvpM at positions 351 to 380; the
NcoI
site is underlined) as primer 1 and the respective
oligonucleotide
complementary to different p-vac sequences as primer 2 (Table
1). Both primers contain an
NcoI site, and the PCR
products were
ligated to pJAS35 cut with
NcoI. The
orientation of the DNA insert
relative to the
fdx promoter
was determined by
KpnI cleavage.
The distance between the
NcoI site and the start codon of the
first
gvp
reading frame varied between 14 and 43 nucleotides,
leading to short
mRNA leader sequences. The expression of functional
gvp gene
products (especially in the case of the first
gvp gene)
was
proven by the formation of gas vesicles in the respective
control
transformants.
The minimal p-vac region (minvac) was constructed in the following way.
SmaI/
Asp718-digested pUC18 was ligated with a
PshAI/
Asp718
DNA fragment (fragment 1 [see Fig.
4]) containing p-
gvpFG (= FG
× pUC). This construct
was linearized by
Asp718, blunt ended,
recut with
EcoRI, and ligated to an
ScaI/
EcoRI
fragment (fragment
2 [see Fig.
4]) harboring p-
gvpJKLM,
resulting in construct FG-JKLM
× pUC. A second construct
containing the
HindIII/
BglII
p-
gvpACNO fragment (fragment 3 [see Fig.
4]) cloned in the
HindIII/
BamHI
sites of pUC18 was cleaved with
EcoRV to delete major portions
of the p-
gvpCN
genes (= AO × pUC). Linearized AO × pUC was religated
and
linearized again at the
HindIII site located upstream of
p-
gvpA (see Fig.
4). The
HindIII site was
blunt ended and used to insert
the blunt-ended
HindIII/
EcoRI fragment containing
p-
gvpFGJKLM of FGJKLM × pUC. The resulting plasmid (=
minvac × pUC) was analyzed
by restriction digestion for the
orientation of the p-
gvp genes,
which was determined as
gvpFGJKLM-gvpAO. The minvac × pUC construct
was
cleaved with
PvuII to yield the insert, which was then
cloned
in the
BamHI-cleaved, blunt-ended pWL102 vector. The
construction
of the M-O, D-M, A-O, and

A fragments was described by
Offner
and Pfeifer (
28), and the construction of

C, ACO,
and ACN was
described by Offner et al. (
29). Prior to the
transformation
of
H. volcanii, each construct was passaged
through
E. coli dam mutant strain GM1674 to avoid a
halobacterial restriction barrier
(
16). Transformation was
performed as described earlier (
33).
The presence of the
desired plasmids in
H. volcanii transformants
was determined
by Southern analyses of total DNA using a p-vac-region-specific,
digoxigenin (DIG)-labeled DNA probe (DIG labeling kit of Boehringer
Mannheim).
RNA isolation and Northern analyses.
Total RNA was isolated
as described by Chomczynski and Sacchi (4). For Northern
analyses, 10 µg of each RNA was electrophoretically separated on
denaturing, formaldehyde-containing 1.2% (wt/vol) agarose gels
(1). Strand-specific RNA probes were synthesized using the
following fragments cloned in pBluescript as the template: the 515-bp
XhoI-Asp718 fragment containing the 3' part of
p-gvpF and p-gvpG (probe FG; Fig. 1), the
1,258-bp NcoI p-gvpLM fragment (probe LM), and
the 476-bp HindIII-ScaI fragment containing
p-gvpA (probe A). The RNA probes were synthesized using the
DIG RNA labeling kit obtained from Boehringer Mannheim.
Isolation of gas vesicles and electron microscopy.
H.
volcanii transformants were grown on agar plates for 1 to 2 weeks.
Cells were scraped from the agar and lysed in 10 mM Tris/HCl (pH 7.2)
with 1 to 2 µl of DNase I (1 mg/ml). Gas vesicles were collected in
small, narrow tubes (diameter, 4 mm) by centrifugation in an Eppendorf
centrifuge for 20 min at 1,000 to 2,000 rpm to improve flotation and
washed three times with 10 mM Tris/HCl (pH 7.2). For negative staining,
a drop of the gas vesicle preparation was placed onto a carbon-coated
copper grid and removed after 2 min with a pipette, and the grid was
air dried. Gas vesicles were treated for 1 min with a solution of 1%
uranyl acetate and 0.01% glucose in water, briefly rinsed with a drop
of water, and then air dried. The specimens were examined with a ZEISS
EM 912 transmission electron microscope operated with the OMEGA energy filter in the zero-loss mode.
 |
RESULTS |
Deletion of single gvp genes and effect on gas vesicle
formation in H. volcanii transformants.
The deletion
of a specific gvp gene in the p-gvpDEFGHIJKLM
cluster was achieved by the complementation of two subfragments present
on different vector plasmids, except for the deletion of
gvpM. The
M transformant harbored a single p-vac
construct (L-O) without the gvpM gene together with the
"empty" pJAS35 expression vector. Each construct produced was
designated according to the gvp gene located near the
boundary of the subfragment (Table 1; Fig.
1A). Four of these fragments (D-O, E-O,
F-O, and G-O) were obtained by restriction endonuclease digestions,
whereas all other subfragments were, at least in part, amplified by
PCR. Subfragments D-O through L-O were inserted into pWL102, and the
various gvp genes were expressed under the control of the
endogenous promoters. In contrast, constructs E-M through M-M contained
gvp reading frames inserted into pJAS35, where they are
expressed under ferredoxin (fdx) promoter control (Table 1).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
The p-vac region and phenotypes of various H. volcanii transformants. (A) The 14 gvp genes
constituting the p-vac region are shown as boxes (A and C through O).
The four endogenous p-vac promoters are indicated by arrows underneath.
The bars above represent the A, FG, and LM probes used for Northern
analyses. The lines underneath represent colonies grown according to
the gvp fragment(s) present in the cells. The M-O (entire
p-vac region), L-O ( M), A, and C transformants harbor the
p-vac region on a single construct (plus pJAS35 as a second construct);
all other transformants contain the p-vac region on two constructs.
Vac+ colonies appear turbid and white; orange, turbid
colonies possess fewer gas vesicles, and dark red translucent colonies
are Vac . The designations to the right of the plate
indicate the deleted gvp genes. The constructs used for
transformation are shown further to the right. The construction of
transformants M-O, A, C, N, and O has been described
previously (28, 29). (B) Various gene deletion transformants
(top) in comparison to the respective control transformants (bottom).
The colonies are arranged according to the respective gene deletion
given underneath (i.e., M = M transformant on top and c M
control transformant underneath).
|
|
Various combinations of two of these constructs were used to transform
H. volcanii. Figure
1A shows the series of transformants
as
colony streaks according to the p-vac subfragment(s) present
in the
cells. For completeness, all transformants with
gvp gene
deletions are included; the deletion of genes found within the
p-
gvpACNO cluster has already been described
(
29). Gas vesicle-producing
(Vac
+) colonies
appear pink-white and turbid, whereas Vac

colonies
are red and translucent. Gas vesicles seen by phase-contrast
microscopy appear as light refractile bodies inside the cells.
M-O transformants contain the entire p-vac region and showed the
expected pink-white and turbid Vac
+ phenotype
(
28). In these transformants, gas vesicle formation
became
visible 2 days after colony formation. The

C (
29) and

H transformants were also Vac
+; the latter one started
to produce gas vesicles significantly
earlier than

C and M-O. The

I,

HI,

E,

D, and

DE transformants
formed turbid
colonies, but the amount of gas vesicles (also seen
as light refractile
bodies in the cells) was lower compared to
the M-O wild type (Fig.
1A
and data not shown). Minor amounts
of gas vesicles were seen in

N
transformants when the cells were
inspected by phase-contrast
microscopy (
29). The lack of any
of the
gvpM,
gvpL,
gvpK,
gvpJ,
gvpG,
gvpF,
gvpA, or
gvpO genes
yielded red
translucent colonies (Fig.
1A), and no light refractile
bodies were
detected in any of the cells inspected by phase-contrast
microscopy.
The results implied that these eight genes are essential
for gas
vesicle formation whereas the six genes
gvpDE,
gvpHI,
and
gvpCN are not
required.
To demonstrate that each of the constructs was expressed and produced
functional Gvp proteins, the respective control transformants
were
prepared. Each control transformant contained the
gvp gene
missing in the gene deletion transformant as the first reading
frame in
the subfragment cloned in pJAS35. Figure
1B shows the
colony phenotype
of the gene deletion transformants in comparison
to that of the
respective control transformants. One would expect
each control
transformant to express a Vac
+ phenotype similar to that of
the wild type; however, the phenotype
indicated some variations.
A wild-type Vac
+ phenotype (pink-white colonies and many
light refractile bodies
inside the cells) was observed with the c

C,
c

G, c

H, c

I, c

L,
and c

M transformants, while c

J
indicated an overproducer phenotype.
The c

A, c

D, c

E,
c

N, and c

O transformants contained somewhat
fewer gas
vesicles (Fig.
1B, bottom line), and only minor amounts
were observed
in c

F and c

K, as verified by phase-contrast microscopy.
The

I
and c

J transformants contained extremely long gas vesicles
(see
below). These results demonstrated that the
gvp genes
present
in these control transformants were expressed and that the gene
products were functional in gas vesicle
formation.
Northern analyses to investigate transcription from the
gvpF-M cluster.
To analyze the gvp mRNA
levels in the transformants, total RNA was isolated and used for
Northern analyses. H. volcanii transformants with the
wild-type p-vac region produce the 4-kb p-gvpF-M mRNA during
exponential growth (29). Since parts of the
p-gvpFGHIJKLM gene cluster were present on
different vector constructs in the other transformants, the mRNAs
derived from this region were investigated in more detail.
The FG probe (Fig.
1) was used to monitor mRNAs starting at the pF
promoter present in the pWL102 constructs, whereas the
LM probe was
used to determine transcripts derived from the respective
pJAS35
constructs in each transformant. Using the FG probe for
Northern
analyses, mRNAs of the expected length were detected
in all gene
deletion and control transformants (Fig.
2). The LM
probe detected transcripts
starting at the
fdx promoter in the
pJAS35 construct. This
promoter usually leads to a large amount
of mRNA during the
exponential growth phase and a smaller amount
during the
stationary growth phase (
34). Using the LM probe,
such a
transcript pattern was seen in transformants harboring
the H-M, I-M,
K-M, and L-M constructs whereas the amount of mRNA
was smaller in
transformants containing the J-M construct (

I
and c

J) (Fig.
2).
This was surprising, since the c

J transformant
showed overproduction
of gas vesicles. The M-M construct was expressed
predominantly during
the stationary growth phase in both cases
(

L and c

M) (Fig.
2).
Transformants containing the M-M construct
by itself showed the same
pattern of
gvpM mRNA production throughout
growth (data not
shown). In summary, these analyses demonstrated
that each fragment was
transcribed and that the observed variations
in transcription did not
reflect the different gas vesicle phenotypes
observed.

View larger version (99K):
[in this window]
[in a new window]
|
FIG. 2.
Northern analyses of gene deletion and control
transformants to investigate the various p-gvpF-M
transcripts. RNA samples were derived from the exponential (e) and
stationary (s) growth phases. A 10-µg sample of total RNA was applied
to each slot. Transcripts starting at the pF promoter were visualized
using the FG probe (top), whereas the LM probe was used to detect
transcripts starting at the fdx promoter in pJSA35 (bottom).
The construct responsible for mRNA hybridization is indicated at the
bottom of each gel. For the FG probe, the expected mRNA is indicated by
an asterisk. The values on the side of each gel are the sizes (in
kilobases) of the RNA markers.
|
|
Inspection of the gas vesicles formed by transformants
H and
I and the respective control transformants.
The cells of
Vac+ transformants
H and
I were inspected by
phase-contrast microscopy.
H transformants contained light
refractile bodies throughout growth.
I transformants indicated
large, cylinder-shaped gas vesicles spanning the entire length of the
cell and sometimes even altering the cell shape by pushing out lobes. A
similar phenotype was observed with the c
J transformants.
Gas vesicles were isolated from

H and

I (and

HI) transformants
and also from the respective control transformants and investigated
by
electron microscopy (Fig.
3). Gas
vesicles of the

I transformant
were extremely long and
cylinder shaped, with an average length
of more than 0.6 µm
(Fig.
3). Some even measured 2.7 µm in length
and were thus longer
than the average
H. volcanii cell. The appearance
of these
extremely long gas vesicles explained the shape alterations
of

I
transformant cells observed in the phase-contrast microscope.
The
control transformant c

I, however, contained spindle-shaped
gas
vesicles, as found in wild-type
H. salinarum (Fig.
3). Many
gas vesicles were obtained by flotation from the

H transformant;
however, intact gas vesicles were rarely found after staining
for
electron microscopy (Fig.
3). They disintegrated into single
ribs,
demonstrating that the gas vesicles synthesized without
GvpH were
unstable during the staining procedure. Gas vesicles
isolated from the
control transformant c

H were stable but appeared
cylinder and not
spindle shaped (Fig.
3). Gas vesicles isolated
from the double deletion
transformant

HI were stable and cylinder
shaped.

View larger version (154K):
[in this window]
[in a new window]
|
FIG. 3.
Electron micrographs of isolated gas vesicles of H,
I, HI, and the respective control transformants.
|
|
Construction of the minvac region containing eight
gvp genes.
The results of the transformation
experiments implied that the genes p-gvpFGJKLM and
p-gvpAO constitute the minimal number of genes required for
gas vesicle formation. In order to prove that these genes are really
sufficient, a plasmid containing these eight gvp genes was
constructed: the gvpDE and gvpHI genes were deleted from the p-gvpDEFGHIJKLM cluster, as were the
gvpCN genes from the p-gvpACNO gene cluster. The
resulting minimal p-vac (minvac) region contained the remaining
gvp genes arranged consecutively under the control of the
endogenous promoters pA, pO, and pF (Fig. 4). The H. volcanii
transformants containing the minvac plasmid did not contain light
refractile bodies and were Vac
, suggesting that the six
gvp genes that were lacking (gvpCN, gvpDE, and gvpHI) could not be deleted all at
once and that the remaining eight gvp genes were not
sufficient for gas vesicle formation. To identify the missing gene(s)
required for gas vesicle formation, double transformants were produced
containing the minvac construct together with a second plasmid
harboring an additional fragment of the p-vac region (A-O or E-M). The
minvac/A-O transformants were Vac
, whereas the minvac/E-M
transformants were Vac+, suggesting that the
p-gvpHI genes of the p-gvpFGHIJKLM unit might be
lacking. Double transformants containing minvac plus further deletions
in E-M (H-M, I-M, J-M, or K-M) were produced, and the cells were
inspected for gas vesicle formation. Light refractile bodies were found
in the minvac/H-M and minvac/I-M transformants and even in the
minvac/J-M transformants, although the gvp genes present on
construct J-M were already present on the minvac plasmid
(Fig. 5 and data not shown). The
minvac/K-M transformants did not reveal light refractile bodies and
were thus Vac
. These results suggested that the
gvpHI genes are not required for gas vesicle formation and
that the gvpJKLM genes present on the minvac construct
(especially gvpJ) were not sufficiently expressed.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
Genetic map of the p-vac region and strategy for the
construction of the minvac region. The 14 gvp genes of the
p-vac region are represented by boxes labeled A and C through O. Essential gvp genes are represented by grey boxes, and
nonessential genes are represented by white boxes. Arrows indicate the
locations of the endogenous promoters. Restriction sites used to obtain
p-vac subfragments 1 to 3, used for the construction of the minvac
plasmid, are shown at the top as follows: A, Asp718; B,
BglII; E, EcoRI; H, HindIII; P,
PshAI; RV, EcoRV; S, ScaI. The
respective subfragments are shown as bars. For further explanations,
see Materials and Methods. The minvac construct at the bottom acquired
deletions of gvpDE, gvpHI, and gvpCN.
ISH2, halobacterial insertion element.
|
|

View larger version (137K):
[in this window]
[in a new window]
|
FIG. 5.
Phase-contrast microscopy of various H. volcanii transformants. Gas vesicles are visible as white bodies
inside the cells. The constructs present in the cells are shown above
the images. The M-O transformant contains the entire p-vac region and
produces many light refractile bodies, whereas the minvac and
minvac/K-M transformants are gas vesicle free. Gas vesicles found in
minvac/J-M cells are indicated by arrows. Magnification, ×1,050.
|
|
Northern analyses were performed to investigate the amount
of
gvp transcripts using the A, FG, and LM probes. The
A probe
detected a large amount of 0.27-kb
gvpA mRNA
in each transformant
(Fig.
6). The FG
probe used to detect the
gvpFGJKLM mRNA indicated
a
small amount of a 3.5-kb transcript that could span the entire
gvpFGJKLM region (Fig.
4). In addition to this transcript,
larger
amounts of 1.8- and 1.4-kb mRNAs were also detected,
suggesting
early termination or degradation of the 3.5-kb transcript
(Fig.
6). The LM probe indicated the small amount of the 3.5-kb mRNA
in
minvac transformants. The double transformant minvac/I-M or
minvac/J-M
contained a large amount of I-M or J-M mRNA due to
the expression of
these genes under
fdx promoter control in pJAS35
(Fig.
6).
Thus, the lack of gas vesicles in minvac transformants
might be due to
the early termination (or processing) of the
gvpFGJKLM mRNA.

View larger version (63K):
[in this window]
[in a new window]
|
FIG. 6.
Northern analyses of minvac and minvac double
transformants to detect gvpA and gvpF-M mRNA. RNA
samples were derived from the exponential (e) and stationary (s) growth
phases. A 10-µg sample of total RNA was applied to each slot.
Transcripts starting at the pA promoter were visualized using the A
probe (A), and transcripts derived from the pF promoter were visualized
using an FG probe (FG), whereas the LM probe also detected transcripts
starting at the fdx promoter in pJSA35 in the cases of the
I-M and J-M constructs (LM). The values on the right side of each gel
are the sizes (in kilobases) of the hybridizing mRNAs.
|
|
 |
DISCUSSION |
The results presented here suggest that 8 out of 14 gvp
genes found in the vac regions of halophilic archaea are sufficient for
gas vesicle formation: gvpA (encoding the major gas vesicle structural protein); gvpO, whose function is unknown; and
gvpFGJKLM. In contrast to the deletion analysis described
here, DasSarma's group reported that gas vesicle formation in H. salinarum (formerly H. halobium) requires at least 10 out of 13 gvp genes (gvpO was not recognized at
that time; reference 7). That group inserted foreign
DNA into various gvp genes derived from pNRC100 and analyzed the effect on H. salinarum mutant strain SD109 lacking the
pNRC100-encoded vac region. One reason for the discrepancies in 6 out
of 14 cases could be the use of different recipient strains for
the transformation experiments. We chose H. volcanii as the
recipient because this strain is easy to transform, grows faster
than H. salinarum, and
most importantly
offers a clean genetic background for the functional analysis of gvp genes. The expression of various
gvp genes in this recipient strain appears to be similar to
that found for H. salinarum or H. mediterranei.
H. salinarum strains harboring plasmid deletion variants
lacking the p-vac region (such as H. salinarum PHH4 or
SD109; reference 7) are deficient in the plasmid vac
region but still contain the c-vac region.
Another difference is the mutation method used for the analyses.
Insertion of foreign DNA into a gvp gene can cause a polar mutation affecting not only the expression of the gvp gene
investigated but also that of gvp genes located farther
downstream, especially when they are cotranscribed. Without the
determination of the expression of these gvp genes, the
results obtained are not sufficient to define the function of a single
gvp gene. Another problem is encountered when the
integration site is close to the 5' or 3' terminus of the
gvp gene and the insert does not destroy the gene function
at the protein level. In all such cases, the presence or absence of the
respective gvp gene products (mRNAs or proteins) should be
determined; however, this has not been done (7). In
contrast, deletion of a single gvp gene within the vac
region clearly destroys its function and if the control transformant containing the respective gvp gene produces gas vesicles,
the phenotype of the gvp
X transformants provides a good
indication of the effect of the mutation. The deletion of the
gvp gene of interest is, however, often achieved by the
complementation of gvp genes present on two vector plasmids.
In such cases, gvp genes are expressed either by their
endogenous promoter(s) or under ferredoxin (fdx) promoter
control (28, 29, and this report). In such double
transformants, gas vesicle synthesis could be affected by an imbalance
of Gvp proteins due to different plasmid copy numbers or the higher
fdx promoter activity compared to the normally regulated
gvp gene expression. However, gvp gene
function can still be determined by this method, especially when
the respective control transformant indicates normal gas
vesicle formation. The differences obtained with mutations in the
gvpACNO gene cluster have already been discussed
(29, 35).
The analyses of the gvpFGHIJKLM genes presented in this
report indicated that deletion of the gene gvpF,
gvpJ, gvpK, or gvpL in the p-vac
region resulted in Vac
transformants, whereas the
respective control transformants produced gas vesicles. Similar results
have been obtained by insertional mutation of these genes
(7). Contradictory results were observed with the
gvpG, gvpH, gvpI, and
gvpM genes. Deletion of p-gvpG or
p-gvpM (and also mc-gvpM; reference
11) resulted in Vac
transformants,
whereas gas vesicle production was still observed when each of
these gvp genes was mutated by a respective insertion (7). However, the integration site of the insertion in the gvpM gene is very close to the 3' end and the absence of
GvpM has not been checked in these transformants. An insert in
gvpH results in transformants containing minor amounts of
gas vesicles (7), but the
H transformants described in
this report produced large amounts of gas vesicles that could be
isolated by flotation but were unstable in electron microscopy. These
results imply that the presence of GvpH is important for the
formation of stable gas vesicles. Transformants carrying an
insert in the gvpI gene are Vac
(7), whereas the
I transformants described here contained extremely long, cylinder-shaped gas vesicles, and the respective
I/I
control transformant harbored large numbers of spindle-shaped gas
vesicles. All of these discrepancies indicate that careful analyses are
required to unequivocally determine a gvp gene function.
Our deletion analyses suggested that the p-gvpC,
p-gvpDE, p-gvpHI, and p-gvpN
genes are not essential for gas vesicle formation and that
the remaining eight genes (gvpAO and
gvpFGJKLM) consequently represent the minimal number of
genes required for their assembly. In order to test whether these eight
genes are indeed sufficient, the minvac construct containing these
genes was used to transform H. volcanii. The minvac
construct was initially inadequate for the formation of gas
vesicles; however, the addition of extra copies of the
gvpJKLM genes resulted in transformants containing gas
vesicles whereas extra copies of gvpKLM revealed
Vac
transformants, suggesting that the lack of gas
vesicles in minvac transformants is mainly caused by the lack of
sufficient GvpJ protein. Northern analyses demonstrated that the J-M
genes on the original minvac construct were insufficiently expressed
due to early termination of transcription. Nevertheless, since only the
gvpAO and gvpFGJKLM genes were present in the
minvac/JKLM transformants, these eight gvp genes represent
the minimal number of genes required for gas vesicle formation. Thus,
it is possible to delete six gvp genes
simultaneously without losing the ability to synthesize
gas vesicles. Similar experiments have not been done for
the system used by DasSarma et al. (7).
The essential gene products determined in this study involve all of the
small Gvp proteins with molecular masses of 8 to 12.7 kDa (GvpA, GvpG,
GvpJ, GvpK, and GvpM) that also exhibit hydrophobic stretches in their
amino acid sequences (10, 28). Surprisingly, GvpJ and GvpM
show more than 60% sequence similarity to the GvpA protein, suggesting
that they are structural components of the gas vesicle (20,
32). However, the amino acid composition of isolated gas vesicles
exclusively reflects that of the GvpA protein and does not indicate a
recognizable proportion of other proteins (9); thus, GvpM
and GvpJ may only be required in early stages of gas vesicle assembly,
being replaced by GvpA later on. Neither a GvpA-specific antiserum
(12) nor an anti-gas vesicle serum (8) reacts
with other Gvp proteins in a gas vesicle preparation. For some of the
products encoded by the gvpFGHIJKLM gene cluster, chaperone
functions have been suggested; they might keep the highly hydrophobic
GvpA protein in a conformation that is required for the assembly
process or even comprise an incorporation mechanism.
Comparison of the minvac region to gvp gene clusters
found in bacteria.
With the recent finding of gas vesicle
genes in B. megaterium (26) and also
in Streptomyces coelicolor (cosmid 1E6; EMBL database) it is
interesting to compare these eight essential gvp genes of
halophilic archaea with gas vesicle genes identified in bacteria. In
the cyanobacterium A. flos-aquae, six homologs to essential
archaeal gvp genes have been identified, including multiple
copies of gvpA and the genes gvpC,
gvpN, and gvpJKL (22). According
to our studies, homologs to gvpFG, gvpM,
and gvpO are still lacking (Table
2). Since neither transcript analyses nor transformation experiments have been done, it is not clear whether the
gvp gene cluster of Anabaena is
complete.
The gram-positive bacterium
B. megaterium contains a
gvp gene cluster consisting of 14 genes
(
gvpAPQ-gvpBRNFGLSKJTU) (
26).
This
gvp gene cluster has been used to transform
E. coli, leading
to the formation of tiny gas vesicles (average
length, 40 nm).
The first three genes (
gvpAPQ) of this
gvp cluster can be deleted
without disturbing the
ability of
E. coli transformants to synthesize
gas vesicles
(
26). The product of the
gvpB gene presumably
constitutes
the major gas vesicle structural protein. The product
of the second
gene of this cluster, GvpR, exhibits 44%
similarity to the GvpO
protein assigned to
S. coelicolor and
39% similarity to the GvpO
protein of halophilic archaea. Thus, GvpR
might be a more distant
homolog of GvpO (Table
2). The
gvpNFGLKJ genes are homologs to
essential genes determined
in this study. The
gvpS gene product
shows similarity to
GvpA and GvpJ and could be a more distant
homolog of the GvpM protein
of halophilic archaea. A phylogenetic
tree constructed with the
sequences of GvpA, GvpJ, and GvpS indicates
that all three sequences
cluster together (data not shown). The
gvpTU genes located
at the end of this gene cluster have no archaeal
homolog. Thus,
among the 14
gvp genes found in
B. megaterium,
all eight essential
gvp genes determined
for halophilic archaea
are present (Table
2).
During the genome sequencing project of the gram-positive bacterium
S. coelicolor, eight
gvp genes were found in
cosmid 1E6;
these genes are arranged as a
gvpOAFGxxJLSK
cluster (with
xx representing
two hypothetical protein
genes; EMBL gene sequence data bank).
The
gvpS gene product
is highly similar to the GvpS protein of
B. megaterium and
most likely a more distant homolog of GvpM.
The arrangement of certain
gvp genes (i.e.,
gvpLSK) is the same
in both
gram-positive bacteria but differs from the arrangement
of the
homologous genes (
gvpKLM) in halophilic archaea. Strikingly,
the eight
gvp genes found in
S. coelicolor
exactly match the
gvp genes in minvac that are required for
gas vesicle formation in
H. salinarum (Table
2). The
expression of
gvp genes in the gram-positive
bacteria has
not been investigated. It might be interesting to
see whether, where,
and when
S. coelicolor produces gas vesicles
and what
functions these flotation devices might have in an organism
that forms
mycelia and does not usually exist in an aquatic environment.
The
possession of genes encoding gas vesicles is obviously more
widely distributed than currently thought, and they occur in archaea
as
well as in gram-positive and gram-negative
bacteria.
 |
ACKNOWLEDGMENTS |
This work was supported by grant Pf 165/6-3 obtained from the
Deutsche Forschungsgemeinschaft.
We thank Christa Schleper, Jobst Gmeiner, and Kathryn Nixdorff for
critical reading of the manuscript. The technical assistance of Ilka
Dürr with electron miroscopy of gas vesicles is gratefully acknowledged. Lovastatin and mevinolin were a generous gift of Merck,
Sharp and Dohme GmbH, Munich, Germany.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Mikrobiologie und Genetik, Technische Universität
Darmstadt, Schnittspahnstr. 10, D-64287 Darmstadt, Germany. Phone: 49 6151 162957. Fax: 49 6151 162956. E-mail:
pfeifer{at}bio.tu-darmstadt.de.
Present address: Micromet GmbH, D-82152 Martinsried, Germany.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl.
1988.
Current protocols in molecular biology, vol. 1.
Greene Publishing Associates and Wiley-Interscience, New York, N.Y.
|
| 2.
|
Blaseio, U., and F. Pfeifer.
1990.
Transformation of Halobacterium halobium: development of vectors and investigation of gas vesicle synthesis.
Proc. Natl. Acad. Sci. USA
87:6772-6776[Abstract/Free Full Text].
|
| 3.
|
Blaurock, A. E., and A. E. Walsby.
1976.
Crystalline structure of the gas vesicle wall from Anabaena flos-aquae.
J. Mol. Biol.
105:183-199[CrossRef][Medline].
|
| 4.
|
Chomczynski, P., and N. Sacchi.
1987.
Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 5.
|
Cline, S. W.,
L. Schalkwyk, and W. F. Doolittle.
1989.
Transformation of the archaebacterium Halobacterium volcanii with genomic DNA.
J. Bacteriol.
171:4987-4991[Abstract/Free Full Text].
|
| 6.
|
Damerval, T.,
J. Houmard,
G. Guglielmi,
K. Csiszar, and N. Tandeau de Marsac.
1987.
A developmentally regulated gvpABC operon is involved in the formation of gas vesicles in the cyanobacterium Calothrix 7601.
Gene
54:83-92[CrossRef][Medline].
|
| 7.
|
DasSarma, S.,
P. Arora,
F. Lin,
E. Molinari, and L. Yin.
1994.
Wild-type gas vesicle formation requires at least ten genes in the gvp gene cluster of Halobacterium halobium plasmid pNRC100.
J. Bacteriol.
176:7646-7652[Abstract/Free Full Text].
|
| 8.
|
Englert, C., and F. Pfeifer.
1993.
Analysis of gas-vesicle gene expression in Haloferax mediterranei reveals that GvpA and GvpC are both gas-vesicle structural proteins.
J. Biol. Chem.
268:9329-9336[Abstract/Free Full Text].
|
| 9.
|
Englert, C.,
M. Horne, and F. Pfeifer.
1990.
Expression of the major gas vesicle protein in the halophilic archaebacterium Haloferax mediterranei is modulated by salt.
Mol. Gen. Genet.
222:225-232[CrossRef][Medline].
|
| 10.
|
Englert, C.,
K. Krüger,
S. Offner, and F. Pfeifer.
1992.
Three different but related gene clusters encoding gas vesicles in halophilic archaea.
J. Mol. Biol.
227:586-592[CrossRef][Medline].
|
| 11.
|
Englert, C.,
G. Wanner, and F. Pfeifer.
1992.
Functional analysis of the gas-vesicle gene cluster of the halophilic archaeon Haloferax mediterranei defines the vac-region boundary and suggests a regulatory role for the gvpD gene or its product.
Mol. Microbiol.
6:3543-3550[Medline].
|
| 12.
|
Halladay, J. T.,
J. G. Jones,
F. Lin,
A. B. MacDonald, and S. DasSarma.
1993.
The rightward gas vesicle operon in Halobacterium plasmid pNRC100: identification of the gvpA and gvpC gene products by use of antibody probes and genetic analysis of the region downstream of gvpC.
J. Bacteriol.
175:684-692[Abstract/Free Full Text].
|
| 13.
|
Hanahan, D.
1983.
Studies on transformation of Escherichia coli with plasmids.
J. Mol. Biol.
166:557-580[Medline].
|
| 14.
|
Hayes, P. K., and R. S. Powell.
1995.
The gvpA/C cluster of Anabaena flos-aquae has multiple copies of a gene encoding GvpA.
Arch. Microbiol.
164:50-57[Medline].
|
| 15.
|
Hayes, P. K.,
B. Buchholz, and A. E. Walsby.
1992.
Gas vesicles are strengthened by the outer-surface protein, GvpC.
Arch. Microbiol.
157:229-234[CrossRef][Medline].
|
| 16.
|
Holmes, M. L.,
S. D. Nuttall, and M. Dyall-Smith.
1991.
Construction and use of halobacterial shuttle vectors and further studies on Haloferax DNA gyrase.
J. Bacteriol.
12:3807-3813.
|
| 17.
|
Horne, M., and F. Pfeifer.
1989.
Expression of two gas vacuole protein genes in Halobacterium halobium.
Mol. Gen. Genet.
218:437-444[CrossRef][Medline].
|
| 18.
|
Horne, M.,
C. Englert, and F. Pfeifer.
1988.
Two genes encoding gas vacuole proteins in Halobacterium halobium.
Mol. Gen. Genet.
213:459-464[CrossRef][Medline].
|
| 19.
|
Horne, M.,
C. Englert,
C. Wimmer, and F. Pfeifer.
1991.
A DNA region of 9 kbp contains all genes necessary for gas vesicle synthesis in halophilic archaebacteria.
Mol. Microbiol.
5:1159-1174[CrossRef][Medline].
|
| 20.
|
Jones, J. G.,
D. C. Young, and S. DasSarma.
1991.
Structure and organization of the gas-vesicle gene cluster on the Halobacterium halobium plasmid pNRC100.
Gene
102:117-122[CrossRef][Medline].
|
| 21.
|
Kinsman, R., and P. K. Hayes.
1997.
Genes encoding proteins homologous to halobacterial Gvps N, J, K, F and L are located downstream of gvpC in the cyanobacterium Anabaena flos-aquae.
DNA Sequence
7:97-106[Medline].
|
| 22.
|
Kinsman, R.,
A. E. Walsby, and P. K. Hayes.
1995.
GvpCs with reduced numbers of repeating sequence elements bind to and strengthen cyanobacterial gas vesicles.
Mol. Microbiol.
17:147-154[CrossRef][Medline].
|
| 23.
|
Krüger, K., and F. Pfeifer.
1996.
Transcript analysis of the c-vac region and differential synthesis of the two regulatory gas vesicle proteins GvpD and GvpE in Halobacterium salinarium PHH4.
J. Bacteriol.
178:4012-4019[Abstract/Free Full Text].
|
| 24.
|
Krüger, K.,
T. Hermann,
V. Armbruster, and F. Pfeifer.
1998.
The transcriptional activator GvpE for the halobacterial gas vesicle genes resembles a basic region leucine-zipper regulatory protein.
J. Mol. Biol.
279:761-771[CrossRef][Medline].
|
| 25.
|
Lam, W. L., and W. F. Doolittle.
1989.
Shuttle vectors for the archaebacterium Halobacterium volcanii.
Proc. Natl. Acad. Sci. USA
86:5478-5482[Abstract/Free Full Text].
|
| 26.
|
Li, N., and M. Cannon.
1998.
Gas vesicle genes identified in Bacillus megaterium and functional expression in Escherichia coli.
J. Bacteriol.
180:2450-2458[Abstract/Free Full Text].
|
| 27.
|
Mayr, A., and F. Pfeifer.
1997.
The characterization of the nv-gvpACNOFGH gene cluster involved in gas vesicle formation in Natronobacterium vacuolatum.
Arch. Microbiol.
168:24-32[CrossRef][Medline].
|
| 28.
|
Offner, S., and F. Pfeifer.
1995.
Complementation studies with the gas vesicle-encoding p-vac region of Halobacterium salinarium PHH1 reveal a regulatory role for the p-gvpDE genes.
Mol. Microbiol.
16:9-19[Medline].
|
| 29.
|
Offner, S.,
G. Wanner, and F. Pfeifer.
1996.
Functional studies of the gvpACNO operon of Halobacterium salinarium reveal that the GvpC protein shapes gas vesicles.
J. Bacteriol.
178:2071-2078[Abstract/Free Full Text].
|
| 30.
|
Offner, S.,
U. Ziese,
G. Wanner,
D. Typke, and F. Pfeifer.
1998.
Structural characteristics of halobacterial gas vesicles.
Microbiology
144:1331-1342[Abstract/Free Full Text].
|
| 31.
|
Palmer, B., and M. Marinus.
1994.
The dam and dcm strains of Escherichia coli a review.
Gene
143:1-12[CrossRef][Medline].
|
| 32.
|
Pfeifer, F., and C. Englert.
1992.
Function and biosynthesis of gas vesicles in halophilic archaea.
J. Bioenerg. Biomembr.
24:577-585[CrossRef][Medline].
|
| 33.
|
Pfeifer, F., and P. Ghahraman.
1993.
Plasmid pHH1 of Halobacterium salinarium: characterization of the replicon region, the gas-vesicle gene cluster and insertion elements.
Mol. Gen. Genet.
238:193-200[Medline].
|
| 34.
|
Pfeifer, F.,
S. Offner,
K. Krüger,
P. Ghahraman, and C. Englert.
1994.
Transformation of halophilic archaea and investigation of gas-vesicle synthesis.
Syst. Appl. Microbiol.
16:569-577.
|
| 35.
|
Pfeifer, F.,
K. Krüger,
R. Röder,
A. Mayr,
S. Ziesche, and S. Offner.
1997.
Gas vesicle formation in halophilic archaea.
Arch. Microbiol.
167:259-268[CrossRef][Medline].
|
| 36.
|
Röder, R., and F. Pfeifer.
1996.
Influence of salt on the transcription of the gas-vesicle genes of Haloferax mediterranei and identification of the endogenous transcriptional activator gene.
Microbiology
142:1715-1723[Abstract/Free Full Text].
|
| 37.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 38.
|
Walker, J. E.,
P. K. Hayes, and A. E. Walsby.
1984.
Homology of gas vesicle proteins in cyanobacteria and halobacteria.
J. Gen. Microbiol.
130:2709-2715.
|
| 39.
|
Walsby, A. E.
1994.
Gas vesicles.
Microbiol. Rev.
58:94-144[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2000, p. 4328-4336, Vol. 182, No. 15
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Dunton, P. G., Mawby, W. J., Shaw, V. A., Walsby, A. E.
(2006). Analysis of tryptic digests indicates regions of GvpC that bind to gas vesicles of Anabaena flos-aquae. Microbiology
152: 1661-1669
[Abstract]
[Full Text]
-
Hofacker, A., Schmitz, K.-M., Cichonczyk, A., Sartorius-Neef, S., Pfeifer, F.
(2004). GvpE- and GvpD-mediated transcription regulation of the p-gvp genes encoding gas vesicles in Halobacterium salinarum. Microbiology
150: 1829-1838
[Abstract]
[Full Text]
-
Shukla, H. D., DasSarma, S.
(2004). Complexity of Gas Vesicle Biogenesis in Halobacterium sp. Strain NRC-1: Identification of Five New Proteins. J. Bacteriol.
186: 3182-3186
[Abstract]
[Full Text]
-
Mlouka, A., Comte, K., Castets, A.-M., Bouchier, C., Tandeau de Marsac, N.
(2004). The Gas Vesicle Gene Cluster from Microcystis aeruginosa and DNA Rearrangements That Lead to Loss of Cell Buoyancy. J. Bacteriol.
186: 2355-2365
[Abstract]
[Full Text]
-
Jager, A., Samorski, R., Pfeifer, F., Klug, G.
(2002). Individual gvp transcript segments in Haloferax mediterranei exhibit varying half-lives, which are differentially affected by salt concentration and growth phase. Nucleic Acids Res
30: 5436-5443
[Abstract]
[Full Text]
-
Pfeifer, F., Zotzel, J., Kurenbach, B., Röder, R., Zimmermann, P.
(2001). A p-loop motif and two basic regions in the regulatory protein GvpD are important for the repression of gas vesicle formation in the archaeon Haloferax mediterranei. Microbiology
147: 63-73
[Abstract]
[Full Text]