Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4545-4556, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
AnkB, a Periplasmic Ankyrin-Like Protein in
Pseudomonas aeruginosa, Is Required for Optimal Catalase B
(KatB) Activity and Resistance to Hydrogen Peroxide
Michael L.
Howell,1
Eyad
Alsabbagh,1
Ju-Fang
Ma,1
Urs A.
Ochsner,2
Martin G.
Klotz,3
Terry J.
Beveridge,4
Kenneth M.
Blumenthal,1
Eric C.
Niederhoffer,5
Randall E.
Morris,6
David
Needham,7
Gary E.
Dean,1
Maqsood A.
Wani,1 and
Daniel J.
Hassett1,*
Department of Molecular Genetics,
Biochemistry and Microbiology, University of Cincinnati College of
Medicine, Cincinnati, Ohio 45267-05241;
Department of Microbiology, University of Colorado Health
Sciences Center, Denver, Colorado 802622;
Department of Biology and Center for Genetics and Molecular
Medicine, University of Louisville, Louisville, Kentucky
402923; Department of Microbiology,
College of Biological Sciences, University of Guelph, Guelph, Ontario,
Canada N1G 2W14; Department of Medical
Biochemistry, Southern Illinois University College of Medicine,
Carbondale, Illinois 62901-44135;
Department of Cell Biology, University of Cincinnati College of
Medicine, Cincinnati, Ohio 45267-05216; and
Department of Materials Science and Mechanical Engineering,
Duke University, Durham, North Carolina 277087
Received 11 February 2000/Accepted 19 May 2000
 |
ABSTRACT |
In this study, we have cloned the ankB gene, encoding
an ankyrin-like protein in Pseudomonas aeruginosa. The
ankB gene is composed of 549 bp encoding a protein of 183 amino acids that possesses four 33-amino-acid ankyrin repeats that are
a hallmark of erythrocyte and brain ankyrins. The location of
ankB is 57 bp downstream of katB, encoding a
hydrogen peroxide-inducible catalase, KatB. Monomeric AnkB is a
19.4-kDa protein with a pI of 5.5 that possesses 22 primarily
hydrophobic amino acids at residues 3 to 25, predicting an
inner-membrane-spanning motif with the N terminus in the cytoplasm and
the C terminus in the periplasm. Such an orientation in the cytoplasmic
membrane and, ultimately, periplasmic space was confirmed using
AnkB-BlaM and AnkB-PhoA protein fusions. Circular dichroism analysis of
recombinant AnkB minus its signal peptide revealed a secondary
structure that is ~65%
-helical. RNase protection and KatB- and
AnkB-LacZ translational fusion analyses indicated that katB
and ankB are part of a small operon whose transcription is
induced dramatically by H2O2, and controlled by
the global transactivator OxyR. Interestingly, unlike the spherical
nature of ankyrin-deficient erythrocytes, the cellular morphology of an
ankB mutant was identical to that of wild-type bacteria,
yet the mutant produced more membrane vesicles. The mutant also
exhibited a fourfold reduction in KatB activity and increased
sensitivity to H2O2, phenotypes that could be
complemented in trans by a plasmid constitutively
expressing ankB. Our results suggest that AnkB may form an
antioxidant scaffolding with KatB in the periplasm at the cytoplasmic
membrane, thus providing a protective lattice work for optimal
H2O2 detoxification.
 |
INTRODUCTION |
Ankyrins are structural proteins in
human erythrocytes and brain that bridge the spectrin exoskeleton to
the cytoplasmic surface of the plasma membrane (5). They are
composed of three domains: (i) an N-terminal membrane-binding domain,
(ii) a spectrin-binding domain, and (iii) a C-terminal domain with an
apparent regulatory function (5). Integral membrane proteins
that associate with ankyrin both in vivo and in vitro include the band
III anion exchanger (15),
Na+/K+-ATPase (15), and multiple
sodium channels (51, 52). The protein-binding N-terminal
domain harbors a series of 33-amino-acid tandem repeats (herein termed
ank repeats) that extend over 740 residues. The tandem repeat motif is
present in 22 contiguous copies with 30 to 35% identity between the
repeats (reference 5 and references therein).
Closely related repeats (30 to 35% identity to brain ankyrin) were
found in seemingly dissimilar proteins of lower and higher eukaryotes
that regulate the cell cycle in yeast (e.g., products of
cdc10 and SWI6) and are involved in intercellular
signaling during development and cell differentiation of
Caenorhabditis elegans (products of lin-12,
glp-1, and fem-1), Drosophila (Notch),
or Xenopus (Xotch) (references 2, 9, 19,
and 50 and references therein). Subsequently
identified ankyrin-like proteins (ALPs) include transcription factors
(e.g., GABP-
and NF-
B), toxins (e.g., black widow spider venom),
enzymes (e.g., rat liver-specific glutaminase), and a viral host range factor (Vaccinia hr gene product) (listed in references
5 and 50); a protein-tyrosine
kinase in Hydra vulgaris (14); and the
Chlorella virus long terminal repeat gene product (GenBank accession no. D14469). Two ALPs were also identified in the higher
plant Arabidopsis thaliana (GenBank accession no. M82883), one of which was implicated in membrane transport (GenBank accession no. X62907). So far, more than 150 genes possessing ank repeats have
been reported in eukaryotic systems (GenBank search, May 2000). Due to
the success in whole genome sequencing, however, genes encoding ankyrin
homologs found most recently reside in bacteria.
The first bacterial ALP-encoding gene (phlB), from
Serratia liquefaciens, was not recognized as such
(21) until Bennett (5) identified an ank repeat
consensus sequence (-G-TA/PLM/H-AA--GH---V/A--LL--GAD-N/D--D-). According to various databases, bacterial ALPs have been identified in
several actinobacteria (Streptomyces verticillus
[13], Streptomyces argillaceus [U43537],
Streptomyces coelicolor cosmid 6D7 [AL133213]), two
spirochetes (Treponema pallidum [AE001254] and
Deinococcus radiodurans [AE002034 and AE001863]), two
cyanobacteria (Anabaena sp. strain PCC 7120 [X95645] and
Synechocystis sp. strain PCC 6803 [D90900]), and several
proteobacteria (S. liquefaciens [21],
Chromatium vinosum [17], Rhizobium
leguminosarum [AJ243305], Rickettsia prowazekii
[AJ235273], Vibrio cholerae [http://www.tigr.org], two
Erlichia species [AF047897 and AF153716], and the four species of fluorescent pseudomonads, i.e., Pseudomonas
aeruginosa [U59457], Pseudomonas fluorescens
[U83328], Pseudomonas putida KT2440
[http://www.tigr.org], and Pseudomonas syringae [32] [AF133262 and AF133263]). Interestingly, unlike
eukaryotic ankyrin or ALPs, bacterial ALPs seem to belong to divergent
operons: bleomycin and mithramycin antibiotic resistance in S. verticillus (13) and S. argillaceus
(U43537), respectively; periplasmic flavocytochrome c and
cytoplasmic tetraheme cytochrome c in C. vinosum
(17); and a catalase with proposed periplasmic and
cytoplasmic locations in P. syringae (32) and
P. fluorescens (U83328). The ankyrin gene in V. cholerae (http://www.tigr.org) is also downstream of a gene
encoding a type I bacterial catalase. A putative open reading frame
(ORF) upstream of a gene encoding a histidinol phosphate
aminotransferase, an enzyme required for ethanol tolerance, was found
in Acetobacter pasteurianus (DDBJ accession no. D14440) (54). The ALP of S. liquefaciens, whose gene is
located downstream of the gene encoding periplasmic phospholipase A1,
has a putative regulatory function regarding phospholipase activity
(21). Taken together, the bacterial ALP genes are located in
close proximity to genes encoding proteins involved in either (i)
nutrient acquisition and uptake or (ii) tolerance or resistance to
antibiotics, starvation, or oxidative stress.
In this study, we demonstrate the first functional characterization of
a bacterial ALP, AnkB, in P. aeruginosa. AnkB was found to
be a cytoplasmic membrane-periplasmic protein whose expression is
increased upon exposure of bacteria to H2O2.
AnkB was also found to be essential for optimal resistance to
H2O2, which we believe is in part due to its
ability to bind to and stabilize KatB, a type I bacterial catalase.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and media.
All P. aeruginosa and Escherichia coli strains used in this
study are listed in Table 1 and were
maintained on Luria (L) agar (10 g of tryptone, 5 g of yeast
extract, and 10 g of NaCl) or M9 minimal medium (6 g of
Na2HPO4, 3 g of
KH2PO4, 1 g of NH4Cl, 0.5 g of NaCl, 1 mM MgSO4 · 7H2O, and 0.2%
glucose [per liter]) plates, with each medium solidified with 15 g of Bacto agar per liter. All strains were stored indefinitely at
80°C in a 1:1 suspension of overnight-grown culture and either 25%
glycerol or 10% skim milk.
Growth conditions.
All bacteria were grown from
single-colony isolates or overnight cultures in L broth or M9 minimal
medium. Liquid cultures were grown at 37°C with shaking at 300 rpm or
on a roller wheel at 70 rpm unless otherwise indicated. Culture volumes
were 1/10 of the total Erlenmeyer flask volume to ensure proper aeration.
Cloning and sequence analysis of ankB.
Steps involved
in the cloning of the P. aeruginosa PAO1 ankB and
radA genes are described in Results. DNA sequencing was
performed on both strands using the PRISM Dye Deoxy Terminator Cycle
Sequencing Kit and analyzed on an ABI model 373A DNA sequencer.
Oligonucleotides for DNA sequencing reactions and PCR analysis were
synthesized in the DNA Core Facilities in the Department of Molecular
Genetics, Biochemistry and Microbiology at the University of Cincinnati College of Medicine or in the Department of Microbiology at the University of Colorado Health Sciences Center. Sequence analyses were
performed using either MacVector 6.5.1 (Eastman Chemical Co., New
Haven, Conn.), Sequencher 3.1 (Gene Codes Corp., Ann Arbor, Mich.), or
Gene Runner (Hastings Software, Inc.) software. Amino acid alignments
were performed using either the BLASTP program provided by the National
Center for Biotechnology Information (1) or the Align Plus 3 Global Alignment Program (Sci-Ed Software, Durham, N.C.). Potential
membrane-spanning domains (MSDs) of AnkB and other bacterial
ankyrin-like proteins were determined using TOP-PRED II (57)
or the SOSUI program
(http://www.tuat.ac.jp/~mitaku/adv_sosui/submit.html).
Manipulation of recombinant DNA and RNA.
Plasmid DNA was
transformed into E. coli DH5
-MCR (Gibco-BRL,
Gaithersburg, Md.) or SM10 (48).
5-Bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal)
(40 µg/ml) was routinely added to agar medium to detect the presence
of insert DNA. Restriction endonuclease, alkaline phosphatase (AP),
Klenow fragment, T4 DNA polymerase, and T4 DNA ligase were used as
specified by the vendor (Gibco-BRL). Plasmid DNA was isolated using
miniprep kits from Qiagen. DNA fragments used for cloning or in the
construction of radiolabeled probes were recovered from agarose gels
using SeaPlaque low-melting-point agarose (FMC BioProducts, Rockland,
Maine) or with the GeneClean II kit (BIO 101, Inc., La Jolla, Calif.).
RNA was isolated by the hot-phenol method and analyzed by RNase
protection assays as described in detail elsewhere (3).
Radiolabeled riboprobes were generated from cloned DNA fragments (Table
1) using an in vitro runoff transcription system (Promega), and excess
probe was hybridized to 20 µg of total RNA.
Overexpression of recombinant AnkB in E. coli.
Overexpression of recombinant AnkB as a His6-tagged protein
in E. coli was performed using the T7 promoter-T7 RNA
polymerase system (53). A 0.53-kb fragment containing the
ankB gene minus the first 19 codons comprising its signal
sequence was amplified using primers
(XhoI)-ctCGAGGTGCATGGGGTCGAGGT and
(BamHI)-ggaTCCAGACTAGCCCAGCAGGC (bases in
the XhoI and BamHI restriction sites are
underlined, and nonmatching bases near the 5' end are in lowercase
type). This PCR product was cloned into pCRII (Invitrogen),
sequenced, and directionally cloned as an
XhoI-BamHI fragment into pET14b (Novagen). The
resulting plasmid, pET14b-ankB, allowed T7-inducible expression of AnkB containing an in-frame His6 tag at its N
terminus spaced by a thrombin cleavage site encoded on pET14b.
Similarly, a 0.485-kb fragment containing the ankB gene
minus the first 17 codons and lacking the last two codons was amplified
using the primers
(NheI)-GCTaGCGAGGTGCATGGGGTCGA and
(NotI)-GCgGCCGCAGTGCCGTTCAGTTC and
subsequently cloned as an NheI-NotI fragment into
pET23a linearized with NheI and NotI. In the
resulting plasmid, pET23-ankB, the AnkB protein was fused in
frame to a carboxy-terminal His6 tag encoded by pET23a.
Recombinant plasmids were first selected in E. coli
DH5
-MCR and then transformed into E. coli BL21(
DE3), which harbors a single genomic copy of the T7 RNA polymerase gene under
control of the lacUV5 promoter. These bacteria were grown in
1 liter of L broth containing ampicillin at 100 mg/ml to an optical
density at 600 nm (OD600) of 0.3. At this point, the
synthesis of T7 polymerase was induced by the addition of 0.5 mM
isopropyl-
-D-thiogalactopyranoside (IPTG), and the cells
were allowed to grow for an additional 3 h at 37°C. Recombinant
AnkB proteins were then purified using a nickel-nitrilotriacetic acid
column as specified by the manufacturer (Qiagen).
Construction of ankB::blaM,
ankB::phoA, and
ankB::lacZ fusion plasmids.
For
construction of a translational
ankB::blaM fusion plasmid, the
N-terminal region of ankB was PCR amplified to create a 551-bp fragment harboring the entire ankB gene. This
fragment was cut with NaeI, and the 162-bp 5' fragment
containing the predicted MSD and a portion of the predicted periplasmic
region of AnkB was ligated into the SmaI site of pKM1
(10). For construction of a translational
ankB::phoA fusion plasmid, a 174-bp 5'
fragment of the ankB gene containing an AflIII
restriction site was first cloned into a T/A version of pKS(
)
(35). The ankB fragment was removed from this
plasmid and cloned into the NcoI-SmaI sites of
pEX30 (H. P. Schweizer). pPHO7, a broad-host-range
phoA-containing plasmid encoding AP (24), was
first cut with BamHI, blunted, and then excised with
PstI. The resulting phoA gene was then ligated to
pEX-ankB that had been previously digested with
EcoRI (blunted) and PstI, allowing for
directional cloning of ankB in frame with phoA.
The resulting construct fuses the first 58 amino acids of AnkB with
PhoA. Translational fusions of ankB to the lacZ
reporter gene were constructed as follows. PCR products were generated with primer
(BamHI)-ggatCCTCGCATCGTCGTCATCTC
containing a BamHI site after the third codon of the
ankB gene and either primer TACAAGGCTGACAGCGACT
(0.16 kb upstream), primer GCAGCGAGGTCAATACCGTC (0.47 kb upstream), or primer CTTGGAACTGCGCCATGCAG (1.9 kb
upstream). The PCR products were cloned into pCRII and directionally
ligated as EcoRI-BamHI fragments into pPZ30
linearized with EcoRI and BamHI, yielding
pPZ-ankB-160, pPZ-ankB-470, and
pPZ-ankB-1900, respectively.
Construction of isogenic P. aeruginosa ankB and
katB ankB mutants.
To generate a clean
ankB deletion mutant, the DNA sequences flanking
ankB were PCR amplified using primers
GCAGCGAGGTCAATACCGTC and
(KpnI)-ggtaCCGGTTGCGATCAATCCTGG
(0.408-kb ankB upstream fragment) and primers
(XbaI)-tctaGATGCGTTGGGCAACAGCGT and
(HindIII)-aaGCTTCAACCCCTGCAGCGCCA (0.334-kb ankB downstream fragment). The two PCR
products were cloned into pCRII, sequenced, and cloned as an
EcoRI-KpnI ankB upstream fragment and
an XbaI-HindIII ankB downstream
fragment on each side of and in proper orientation to a 1.7-kb
aac1 (Gmr) cartridge in pUC-Gm, yielding
pUC
ankB::Gm. A 2.8-kb PvuII fragment of pUC
ankB::Gm containing the
ankB::Gm construct was cloned into the
SmaI site of the suicide vector pEX100T (46), and
the resulting pEX100T-
ankB::Gm was transformed
into E. coli SM10, which then served as the donor strain in
a biparental plate mating (16 h, 37°C) with P. aeruginosa
PAO1 or with PAO1
katA::Tc (35). The
mating mixture was plated on brain heart infusion agar containing gentamicin (75 µg ml
1) and irgasan (Ciba-Geigy) (50 µg ml
1) as a counterselective agent. Several colonies
were grown to late logarithmic phase in L broth, and serial dilutions
were spread onto L agar containing gentamicin (75 µg
ml
1) and sucrose (5%). Chromosomal DNA from individual
colonies was evaluated for deletion of the ankB gene by PCR
and Southern blot analysis (data not shown). A PAO1
katB
ankB deletion mutant was obtained as follows. A 2.7-kb fragment
containing the katB-ankB region was PCR amplified using the
primers CTTGGAACTGCGCCATGCAG and GCTTCAACCCCTGCAGCGCCA
and cloned into pCRII. A 1.75-kb SstII fragment
containing most of the katB and ankB genes was
excised and replaced by a 1.2-kb Gmr cartridge by blunt-end
ligation after filling in the ends with Klenow enzyme. A 2.6-kb
PvuII fragment of the resulting plasmid, pCRII-
katB
ankB::Gm, was cloned into the SmaI site of
pEX100T, yielding the donor plasmid pEX100T-
katB
ankB::Gm for a mating as described above.
Cell fractionation: periplasm, cytoplasm, and cytoplasmic
membrane.
Bacteria were grown aerobically in 1 liter of L broth at
37°C until the OD600 reached 0.6. At this point,
organisms were treated with 350 µM paraquat (Sigma) for 1 h to
stimulate katB-ankB transcription prior to harvesting the
bacteria by centrifugation at 10,000 × g for 10 min.
The pellet was washed twice in ice-cold 10 mM Tris-HCl-30 mM
MgCl2 (pH 7.3) (Tris-Mg) and resuspended in 1/25 the volume of the same buffer. Chloroform (15 µl/ml of buffer) was then added, and the cells were incubated on ice for an additional 15 min followed by dilution with an additional 1 ml of buffer. The bacteria were pelleted by centrifugation at 10,000 × g for 10 min at
4°C, and the supernatant was further subjected to centrifugation at
150,000 × g for 2 h at 4°C to remove potential
contaminating membranes. Finally, the periplasmic preparation was
stored on ice. The bacteria were washed again, resuspended in 5 ml of
Tris-Mg, and disrupted by sonication with a Heat Systems-Ultrasonics
(Farmingdale, N.Y.) model W-225 sonicator equipped with microtip at
output setting 5 at 4°C. Cell debris and membrane fractions were
clarified by centrifugation at 35,000 × g for 1 h
at 4°C. The supernatant was designated the cytoplasmic fraction.
For preparation of cytoplasmic membrane proteins, the above-described
growth conditions were employed. The pellet of paraquat-stimulated
bacteria was resuspended in 10 ml of 10 mM Tris-HCl (pH 7.5) (T
buffer), containing 20% sucrose, treated with 0.5 mg of DNase
I
(Gibco) and RNase (Sigma) per ml, and incubated for 15 min at
22°C
with periodic agitation. The suspension was placed on ice
for 20 min,
followed by two passages through a French pressure
cell at 1,200 lb/in
2 at 4°C. The cell debris was removed by
centrifugation at 5,500
×
g for 10 min at 4°C. The
supernatant containing the membranes
was subjected to a two-stage
sucrose gradient centrifugation.
The first stage involved layering 10 ml of membranes on 14 ml
of 50% sucrose and 14 ml of 70% sucrose in T
buffer. The membranes
were then separated by centrifugation in an SW28
swinging-bucket
rotor at 130,000 ×
g for 17 h at
4°C. Cytoplasmic membranes (the
top red band) and outer membranes
(the bottom white band) were
collected by dropwise collection and
diluted to 7 ml in cold T
buffer-20% sucrose. The second
centrifugation stage involved layering
the membrane fractions on 9 ml
of 52% sucrose, 9 ml of 58% sucrose,
9 ml of 64% sucrose, and 3 ml
of 70% sucrose, each prepared in
T buffer. The membranes were again
separated by centrifugation
in an SW28 swinging bucket rotor at
130,000 ×
g for 17 h at 4°C.
The purified
cytoplasmic and outer membrane fractions were concentrated
by dropwise
collection and dialyzed exhaustively against T buffer
for 17 h at
4°C. The purity of each cellular fraction was gauged
by measuring
enzymatic activities specific for the cytoplasm,
periplasm, and inner
membrane. Stripping of AP activity from cytoplasmic
membrane
preparations was accomplished by incubating the membranes
in either T
buffer (control) or 0.1 M Na
2CO
3 for 30 min on
ice.
Thirty milliliters of the membrane suspension was carefully
layered
on 4 ml of 0.3 M sucrose in T buffer and centrifuged at
150,000
×
g for 2 h at 4°C. The pellet was
solubilized in 2% Triton X-100
in T buffer and assayed for AP activity
as described below. Glucose-6-phosphate
dehydrogenase, a cytoplasmic
marker, was assayed by monitoring
the reduction of NADP
+ at
340 nm as previously described (
33).

-Lactamase, one
periplasmic
marker, was assayed by the decomposition of 50 µM
nitrocefin (CalBiochem,
La Jolla, Calif.) at 486 nm (
34).
AP, another periplasmic marker,
was assayed by monitoring the
production of
p-nitrophenol through
hydrolysis of 1 mM
p-nitrophenyl phosphate (Sigma) (
20). AP
activity
in bacterial colonies on L-agar plates containing 10
mM potassium
phosphate (pH 7.0) to inhibit endogenous AP activity
was monitored
using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)
(40 µg/ml) in the
medium. Succinate dehydrogenase, a cytoplasmic
membrane marker, was
assayed by monitoring the reduction of dichlorophenol-indophenol
as
previously described (
12).
TEM.
Cells were harvested from exponential-growth-phase
cultures, treated with 1 mM H2O2 to induce the
katB-ankB operon, and negatively stained for transmission
electron microscopy (TEM). For staining, the cells were put on a
carbon- and Formvar-coated 200-mesh TEM grid, stained for 15 s
with 2% (wt/vol) uranyl acetate, and blotted dry. The negatively
stained bacteria were imaged using a Philips EM300 instrument operating
at 60 kV under standard conditions with the liquid nitrogen
anticontaminator in place.
Circular dichroism spectropolarimetry.
Circular dichroism
spectra of purified recombinant AnkB proteins (AnkB-23a and AnkB-14b)
were obtained using a JASCO J-710 spectropolarimeter calibrated with
d10-camphorsulfonic acid. All samples were
dissolved in 10 mM sodium phosphate (pH 7.0) and equilibrated at 22°C
for 10 min prior to data collection. The spectra represent the means of
four independent scans obtained at a scanning rate of 20 nm
min
1. Samples were added to a water-jacketed, cylindrical
quartz cuvette with a 0.05-cm path length. Protein content was
calculated based upon the equation [protein]µg/ml = 144(A215
A225),
using a 1-cm light path. Percent
-helix was estimated from
[
]222 as described by Greenfield and Fasman
(23).
Cell extract preparation and biochemical assays.
Routine
cell extracts were prepared from bacteria harvested by centrifugation
at 10,000 × g for 10 min at 4°C. Bacteria were washed twice in ice-cold 50 mM potassium phosphate buffer (pH 7.0) and
sonicated in an ice-water bath for 10 s as described above. The
sonicate was then clarified by centrifugation at 13,000 × g for 10 min at 4°C. Cell extract preparation for native gel electrophoresis was performed as described above except that 50 mM T
buffer was used as the diluent. Catalase activity was assayed spectrophotometrically at 240 nm by monitoring the decomposition of 18 mM H2O2 using a Spectronic Genesys 5 spectrophotometer (Spectronic Unicam, Rochester, N.Y.) (4).
The concentration of H2O2 was determined using
an extinction coefficient of 43.6 mM. One unit of activity is that
which degrades 1 µmol of H2O2 per min at
23°C. Nondenaturing polyacrylamide gels (5%) were stained for
catalase activity according to the method of Wayne and Diaz
(58).
-Galactosidase assays were performed using
o-nitrophenyl-
-D-galactopyranoside, and the
results were expressed as international units with an extinction
coefficient for
o-nitrophenyl-
-D-galactopyranoside of 3.1 mM
(37). Protein concentrations in cell extracts were estimated
by the method of Bradford (8), using bovine serum albumin as
a standard.
Nucleotide sequence accession number.
The P. aeruginosa katB, ankB, and radA sequences
have been assigned GenBank accession number U89384.
 |
RESULTS |
Sequence analysis downstream of the P. aeruginosa katB
gene: identification of ankB, encoding an ALP, and
radA, a DNA repair protein.
In a previous study, we
cloned and characterized the katB gene, encoding a 228-kDa
tetrameric catalase (11). The katB gene was
recently found to be under the control of the global transactivator OxyR (39), and its transcription is markedly induced upon
exposure to H2O2 or the redox-cycling agent
paraquat (11). DNA sequence analysis downstream of the
katB locus revealed a small, 549-bp ORF (Fig.
1). This ORF, ankB, is
predicted to encode a protein of 183 amino acids with a monomeric
molecular mass of 19,360 Da and a pI of 5.55. The deduced amino acid
sequence demonstrated the highest similarity with genes harboring ank
repeats in other bacteria (13, 17, 21, 32) and various
ankyrin or ALP genes in eukaryotes (5) (see below). When we
sequenced further downstream of the ankB locus, we
discovered a large inverted repeat spanning 33 bp (Fig. 1). We then
identified a gene downstream of the inverted repeat that was 70%
identical to the radA gene of E. coli
(49). The radA gene in E. coli encodes
a protein that repairs DNA damaged (alkylated) by gamma irradiation.
However, because virtually nothing is known of the function of ALPs in
bacteria, we chose to focus our efforts on the functional
characterization of P. aeruginosa AnkB.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Gene map of the ~5.2-kb insert of pSMB1 containing the
katB, ankB, and radA genes. The
functions of the gene products are also given. We have previously shown
that OxyR, a 34-kDa transactivator, responds to
H2O2 by activating katB-ankB
(39). T, 33-amino-acid inverted repeat that could represent
the transcriptional terminator for the katB-ankB operon.
|
|
Amino acid comparison of AnkB with other bacterial ALPs.
Ankyrins are proteins that are characterized by 33-amino-acid ank
repeats that are thought to represent an ancient motif that has evolved
to allow for functional diversity without compromising specificity
(5). Each of the five bacterial ALPs in Fig.
2 possess the 33-amino-acid tandem,
nonidentical ank repeats. These repeats are based upon the consensus
ank repeat motif put forth by Michaely and Bennett (36).
AnkB (PaAnkB), not surprisingly, is similar to AnkF (PsAnkF, in the
related plant pathogenic species P. syringae, strain 61 [32]; PsAnkB [in P. syringae B301D;
accession no. AF133262]; and PfAnkB [in P. fluorescens;
U83328]) in that it possesses four tandem repeats and an 18-residue
signal sequence (Fig. 2). However, the Ank signal peptides from
P. syringae differ from those of PaAnkB and PfAnkB in that
they are followed by a proteolytic proline-threonine-box (hinge
[32]). Interestingly, PaAnkB and PfAnkB, but not
PsAnkF and PsAnkB, possess an RGD motif, which, in eukaryotes, is
responsible for physical interaction with integrins, structural
proteins that play a role in the homing and action of immune cells.
Other bacterial ALPs (some of which are not listed in Fig. 2) from
V. cholerae (http://www.tigr.org/.) (VcAnkB), S. argillaceus (U43537) (SaAnk), C. vinosum
(17) (CvAnkA), and S. liquefaciens
(21) (SlPhlB, for phospholipase A1-related ALP) possessed
longer putative signal sequences (25 to 28 residues), while the ALP
from R. leguminosarum (AJ243305) (R1Ank) contained a very
short N-terminal MSD of 12 residues. The ALPs of S. verticillus (13) (SvAnkA and SvAnkB) possessed only two
33-amino-acid ank repeats. All other identified bacterial ALPs contain
a putative cleavage site following an MSD either in the middle or close
to the C terminus, or they do not contain a hydrophobic region long
enough to incorporate into the membrane.

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the deduced amino acids from genes coding
for bacterial ankyrins PaAnkB (P. aeruginosa; accession no.
U59457), PsAnkF (P. syringae; U16026), CvAnkA (C. vinosum; L13419), SlPhlB (S. liquefaciens; P18954), and
SvAnkA (S. verticillus; L26954). The 33-amino-acid tandem
repeats (underlined) were revealed by using the Ank motif of conserved
residues (boldface) as identified by Bennett using the erythrocyte ank
repeat consensus sequence (5). Proposed signal sequences are
indicated by a double underline. The conserved ank repeat sequences for
erythrocyte ankyrin are given below the selected bacterial ALP
sequences. RBC, erythrocyte concensus ank repeat sequence.
|
|
AnkB is a periplasmic protein: AnkB-
-lactamase and
AnkB-alkaline phosphatase protein fusion analysis.
Using the
membrane topology program TopPred 3.0, it was predicted that the
cytoplasmic N terminus of P. aeruginosa AnkB (3 amino acids)
is followed by a 20-amino-acid stretch that is predicted to be the
hydrophobic inner-MSD (for a von Heijne schematic, see Fig.
3A) (TMRGWILAGLLLAALAAQAEVH),
with the remaining portion of the protein (being highly hydrophilic)
predicted to reside in the periplasm. The ALPs of other selected
gram-negative bacteria, including C. vinosum, S. liquefaciens, and other Pseudomonas species, are also
predicted to span the cytoplasmic membrane (Fig. 3A). To test whether
the predicted cytoplasmic membrane location was correct, we constructed
AnkB-BlaM and AnkB-PhoA protein fusions linking the C terminus of AnkB
with both reporters (Fig. 3B). E. coli and P. aeruginosa harboring an ankB::blaM
fusion plasmid were resistant to ampicillin and carbenicillin,
respectively. In addition, E. coli and P. aeruginosa harboring pEX30-ankB::phoA were blue on indicator plates containing BCIP, suggesting that the C
terminus of AnkB resides in the periplasm and confirming the
AnkB-
-lactamase fusion plasmid results. To determine the precise
location of AnkB within the cell, membrane fractionation techniques
(see Materials and Methods) were employed. Cytoplasm, periplasm,
cytoplasmic membrane, and outer membrane fractions were assayed for AP
activity (Fig. 3C). The vast majority of AP activity was detected in
the periplasmic space and the cytoplasmic membrane. The contaminating
AP activity in the cytoplasm is likely due to overexpression and
problems associated with transport of a larger-than-normal AnkB-PhoA
protein. To show that AnkB traverses the cytoplasmic membrane and is
not simply nonspecifically bound to it, cytoplasmic membranes were
stripped by treatment with Na2CO3 at high pH
(56). Our results showed that AnkB is tightly bound to the
cytoplasmic membrane (data not shown). These results suggest that AnkB
first exists as a cytoplasmic membrane protein, followed by proteolytic
cleavage via a putative LepB signal peptidase cleavage site (GEVHG) to
finally reside in the periplasmic space (42).

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 3.
Cellular localization of AnkB in P. aeruginosa. (A) Predicted cytoplasmic membrane organization of
P. aeruginosa AnkB bacterial ankyrin-like proteins from
P. syringae, P. fluorescens, S. liquefaciens, and C. vinosum based upon the
positive-inside-rule algorithm developed by von Heijne (57).
For the P. aeruginosa AnkB protein, the large number 1 indicates the predicted single MSD. N, N terminus; C, C terminus; LL,
loop length; KR, number of lysine and arginine residues; KR Diff,
positive charge difference. (B) Schematic diagram of
AnkB- -lactamase and AnkB-PhoA protein fusions in both E. coli and P. aeruginosa PAO1. In both cases, organisms
expressing AnkB- -lactamase were resistant to ampicillin (E. coli) or carbenicillin (P. aeruginosa). Organisms
expressing AnkB-PhoA were found to hydrolyze the alkaline phosphatase
substrate BCIP in L-agar plates. IM, inner membrane; OM, outer
membrane. (C) AP activity in cellular fractions of P. aeruginosa
ankB harboring pEX30-ankB::phoA.
Bar 1, cytoplasm; bar 2, periplasm; bar 3, cytoplasmic membrane; bar 4, outer membrane.
|
|
Overexpression of AnkB in E. coli: AnkB secondary
structure is predominantly
-helical.
To obtain some preliminary
structural analysis of AnkB, we overexpressed and purified two
recombinant AnkB proteins with N-terminal (pET23a-AnkB) and C-terminal
(pET14b) His6-tagged fusions in E. coli
BL21(
DE3) without their predicted MSDs. Figure
4A demonstrates purified pET23a-AnkB.
Gorina and Pavletich revealed that the secondary structure of an ank
repeat in protein 53BP2, which binds to the p53 tumor suppressor,
consists of an L-shaped structure with a
-turn and 2
-helices
(22). Circular dichroism spectropolarimetric analysis of
recombinant AnkB-23a suggested that AnkB is ~60 to 70%
-helical
(Fig. 4B). This structure is consistent with the 66%
-helical
nature of the ank repeats of the 53BP2 protein (22).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
Overexpression (A) and circular dichroism analysis (B)
of recombinant AnkB proteins. (A) E. coli BL21( DE3)
harboring pET23-ankB-480 was grown aerobically in L broth to
mid-logarithmic phase and treated with 1 mM IPTG for 3 h at
37°C. After Ni2+-nitrilotriacetic acid purification,
purified protein was separated by sodium dodecyl sulfate-12%
polyacrylamide gel electrophoresis and the gel was stained with
Coomassie blue R-250. Lane 1, molecular mass standard; lane 2, 15 µg
of AnkB-480. (B) Circular dichroism spectrum of AnkB-480, using 100 µg ml 1 in 10 mM sodium phosphate (pH 7.0) at 23°C.
|
|
Polycistronic nature of katB and ankB:
regulation by H2O2.
To determine if
katB and ankB are part of a small operon, RNase
protection assays were performed. Figure
5 demonstrates that transcription of both
katB and ankB is stimulated by paraquat in a
concentration-dependent fashion. The transcriptional start site was
found to be a G 227 bp upstream of the katB start codon. Furthermore, transcription of katB-ankB is dependent upon
OxyR, since no katB and very little ankB
transcript could be detected in an oxyR mutant. These
results were also confirmed using
ankB::lacZ reporter fusion studies
(data not shown).

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 5.
RNase protection assays indicate that katB
and ankB comprise an operon and are regulated by OxyR.
Riboprobes specific for the katB promoter (katB
rp) and for the katB-ankB overlapping region
(katB-ankB rp) were used to detect the corresponding
transcripts in P. aeruginosa PAO1 or oxyR mutant
total RNA isolated during the exponential growth phase in aerobic M9
minimal medium. Paraquat (PQ) was added to final concentrations of 10 and 100 µM 1 h prior to harvest as indicated. Also shown are the
digested probes in the absence of any P. aeruginosa RNA as a
control. A DNA sequencing reaction was run in parallel and served as a
size marker. Numbers on the left are base pairs.
|
|
Phenotypes of a P. aeruginosa ankB mutant. (i) Normal
cell size and shape.
Humans with hereditary spherocytosis (HS)
suffer from an ankyrin deficiency. Erythrocytes from individuals with
HS lack deformability and stability (40) and are unable to
pass through capillaries, resulting in hemolytic anemia and
hypersensitivity to osmotic lysis. This disorder has been reproduced in
nb/nb (normoblastosis, ankyrin-deficient) mice (7), which
have a severe hemolytic anemia throughout life (41). In
these settings, it is predicted that a loss of ankyrin from the
lipid bilayer causes a reduction in the critical surface area/volume
ratio, leading to a shift in the morphology of erythrocytes from
discoidal to spherical. Thus, there is a definitive structural role for
ankyrins in erythrocytes. In contrast to the case for HS erythrocytes,
the ultrastructure of wild-type and ankB mutant bacteria was
observed by TEM and no significant differences in overall cell shape
were found (Fig. 6). However, the
ankB mutant produced more membrane vesicles than wild-type
bacteria (Fig. 6B). This implies that a fundamental difference exists
between the surfaces of the wild type and the ankB mutant
and that their ability to package periplasmic constituents in natural
membrane vesicles has changed (i.e., the ankB mutant has
more packaging potential). The difference in quantities in membrane
vesicles has been confirmed by thin sections (6).

View larger version (147K):
[in this window]
[in a new window]
|
FIG. 6.
Ultrastructural analysis of wild-type PAO (A) and PAO
ankB mutant (B) bacteria. Bacteria were grown aerobically in
L broth to mid-exponential growth phase and treated with 1 mM
H2O2 for 1 h at 37°C to stimulate
transcription of katB-ankB. Organisms were then prepared for
TEM examination as described in Materials and Methods. The arrows in
panel B point to the larger number of membrane vesicles being produced
by the ankB mutant. The width of the cells is ~800 nm.
|
|
(ii) Enhanced sensitivity to H2O2.
Because we found that ankB is part of a small operon with
katB, we postulated that its gene product may play a role in
resistance to H2O2. To test this hypothesis,
the wild type and ankB, katB, and katB
ankB mutants were screened for H2O2
sensitivity. As shown in Fig. 7, an
ankB mutant was only slightly more susceptible to H2O2 than wild-type organisms (bars 2).
However, when the mutant was pretreated with a sublethal dose of
H2O2, which activates the katB-ankB
operon, sensitivity was increased dramatically (bars 2 versus bars 1 [shaded bars]). Bars 6 demonstrate that provision of a plasmid that
allows for constitutive expression of ankB restored wild-type resistance regardless of H2O2
pretreatment. The katB (bars 3) and katB ankB
(bars 4) mutants were equally susceptible to
H2O2, and more so than the ankB
mutant. Interestingly, provision of ankB alone to the
katB ankB mutant dramatically helped these organisms resist
H2O2 (bars 8 relative to bars 7).

View larger version (67K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of ankB, katB, and
katB ankB on sensitivity to H2O2.
All bacteria were grown aerobically overnight in M9F medium at 37°C.
Fresh prewarmed medium (1 volume of culture in 10-volume flasks) was
inoculated with 1/50 of the final culture volume and allowed to reach
an OD600 of 0.6. Some bacteria were pretreated with a
sublethal (1 mM) dose of H2O2 for 1 h
(shaded bars) relative to control bacteria (open bars). The suspensions
were diluted 100-fold in 7 ml of M9F 0.6% top agarose kept at 37°C
and poured onto M9F plates. Filter paper disks (7 mm) impregnated with
8.8 M H2O2 were placed on the top agar surface.
Zones of growth inhibition were measured after a 24-h aerobic
incubation at 37°C. Bars: 1, PAO1; 2, ankB; 3, katB; 4, katB ankB; 5, ankB plus
pUCP22; 6, ankB plus pankB; 7, katB
ankB plus pUCP22; 8, katB ankB plus pankB.
Error bars indicate standard errors of the means.
|
|
(iii) Absence of AnkB decreases KatB activity.
Because of
the close proximity of katB and ankB, their
organization in a small operon, and the enhanced
H2O2 sensitivity of the ankB mutant,
we postulated that AnkB could play a role in KatB function. To test
this hypothesis, the catalase isozyme profiles of several mutant
organisms were examined. Fig. 8 (left
panel) shows that the KatB activities of the ankB mutant
(lane 2) and a katA ankB (lane 5) mutant are significantly
reduced relative to that of wild-type bacteria (lane 1). When
transcription of katB was stimulated by the addition of
paraquat, there was a robust increase in KatB activity in the wild type
(right panel, lane 1) and especially in the katA mutant
(right panel, lane 3). The catalase activity band produced in the
katA mutant that migrated to the same
Rf as KatA could be another, previously
undiscovered catalase in P. aeruginosa, although analysis of
the recently completed P. aeruginosa genome suggested
otherwise (data not shown). We now know that this paraquat-inducible
catalase band is one of the alkyl hydroperoxide reductases, AhpA,
that possesses weak catalase activity (39). The KatB
activities of the ankB mutant (Fig. 8, right panel, lane 2)
and a katA ankB mutant (right panel, lane 5) were still
reduced relative to that of wild-type bacteria (right panel, lane 1).

View larger version (69K):
[in this window]
[in a new window]
|
FIG. 8.
Absence of AnkB causes a decrease in KatB activity.
Bacteria were grown aerobically overnight in L-broth medium at 37°C.
Fresh prewarmed medium (1 volume of culture in 10-volume flasks) was
inoculated with 1/100 the final culture volume, and the organisms were
grown to an OD600 of 0.6. Some bacteria (right panel) were
then treated with a sublethal (0.35 mM) (11) dose of
paraquat for 1 h, and the others (left panel) served as controls.
Cell extracts were prepared, and 10 µg was subjected to nondenaturing
polyacrylamide gel electrophoresis (5% polyacrylamide). The gels were
then stained for catalase activity (58). Lanes: 1, PAO1; 2, ankB; 3, katA; 4, katB; 5, katA
ankB.
|
|
(iv) Quantitative effect of AnkB on KatB activity.
To quantify
the effect of AnkB on KatB activity, we examined catalase activity in
katA and katA ankB mutants that had been treated
with paraquat in stationary-phase culture, where the only catalase
activity that can be detected and quantified spectrophotometrically is
KatB. As shown in Fig. 9, the KatB
activity of a paraquat-treated katA mutant is ~21.5 U/mg
(bar 1). Provision of ankB in trans to the
katA mutant had no effect on KatB activity (bar 2).
Interestingly, KatB activity in a katA ankB mutant was
reduced fourfold (bar 3) relative to that of the katA mutant
and was fully complemented by providing ankB in
trans (bar 4). There was no observation of the AhpA activity
band under these conditions.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 9.
Quantitative effect of AnkB on KatB activity. Bacteria
were grown aerobically overnight in L-broth medium containing 0.35 mM
paraquat at 37°C. Catalase activity and activity gel staining were
monitored in cell extracts. Bars: 1, katA plus pUCP22; 2, katA plus pankB; 3, katA ankB plus
pUCP22; 4, katA ankB plus pankB. Error bars
indicate standard errors of the means. The inset photograph is KatB
activity staining of cell extracts in a representative native
polyacrylamide gel of each strain. It should be noted that no AhpA
activity band (see Fig. 8) could be detected under these conditions.
|
|
 |
DISCUSSION |
The major catalase gene of P. aeruginosa,
katA, encoding a constitutive 170-kDa heteromultimer, is
positively regulated by iron (35) and maximally expressed in
stationary phase, in part through a process of cell-to-cell
communication known as quorum sensing (27). Thus, it is not
surprising that KatA contributes significant protection against
H2O2 in both planktonic and biofilm cultures
(26, 27, 35).
In contrast to katA, which is minimally responsive to
H2O2, we found in this study that the
katB-ankB operon is transcribed dramatically in its presence
and requires the global transactivator OxyR (25, 39). When
we discovered ankB downstream of katB, we
immediately classified its gene product as an ALP because it possessed
the characteristic 33-amino-acid ank repeat motifs and showed high
similarity to ALPs in the related organisms P. fluorescens and P. syringae (32). Bacterial ALPs differ
dramatically from their eukaryotic counterparts in that they contain
only the ank repeats, which we believe to be involved in
protein-protein interactions (5). Bacterial ALPs should,
therefore, lack the structural role in the cell, similar to the
function of prototypical erythrocyte spectrin-binding ankyrin.
Examination of transmission electron micrographs of the ankB
mutant confirmed this assumption (Fig. 6). Due to the polycistronic
nature of katB-ankB and the conservation of this operon in
the pseudomonads and other proteobacteria such as V. cholerae, we postulated that AnkB might belong to a group of
evolutionarily related proteins with a novel, unrecognized function(s),
one of which could contribute toward protection against H2O2. Indeed, AnkB appears to play a role in
the response of P. aeruginosa to
H2O2, because an ankB mutant was
more sensitive to it than wild-type organisms (Fig. 7). Furthermore,
the enhanced H2O2 sensitivity of an isogenic
katB ankB mutant did not change when only katB
was provided in trans (39). Although unproven, the nearly fourfold reduction in KatB activity in the ankB
mutant suggests that there could be a physical interaction between the two proteins. We found KatB activity in the cytoplasm, periplasm, and
cytoplasmic membrane (data not shown). Because AnkB is a cytoplasmic membrane protein whose bitopic integration into the inner membrane ultimately causes its ank repeat domain to reside in the periplasm, we
postulated that one function of AnkB may be to bind KatB near inner
membrane targets that are sensitive to H2O2
(e.g., F1Fo-ATPase [55]).
H2O2 must first enter a protein channel leading
to the heme catalytic site of the catalase molecule (47).
Without entering this channel, the H2O2 is free
to damage cellular components, especially sensitive respiratory chain
components and DNA (16). Thus, AnkB may position or anchor
KatB so that its H2O2 channel is in the optimal
orientation for H2O2 entry. Alternatively, AnkB may serve to stabilize KatB, allowing it to persist longer and function
better upon exposure of bacteria to H2O2.
An alternative hypothesis is that AnkB may reinforce the cytoplasmic
membrane and prevent crippling of the proton motive force. Microscopic
oxygen bubbles could be produced upon H2O2
degradation, thereby increasing cellular turgor pressure. Although
unexplained, such cell swelling has been shown in E. coli
(38) and in mitochondria treated with
H2O2 or agents that generate it
(30). Upon H2O2 degradation by
catalase, oxygen gas nuclei could be stabilized and even grow in the
bacteria at hydrophobic sites. With the production of gas at a rate
that saturates the cytoplasm, gas bubbles could readily appear, be
stabilized by lipid and/or protein adsorption, and take up considerable
volume inside a cell, thereby creating a turgor pressure
(31). Thus, AnkB could serve to stabilize the inner membrane
against swelling due to the mounting intracellular pressure built by
H2O2 degradation. Both hypotheses are being tested experimentally.
 |
ACKNOWLEDGMENTS |
The first three authors contributed equally toward completion of
this work.
This work was supported by Public Health Service grants AI-40541 (to
D.J.H.) and DK-50749 (to K.M.B.) and Cystic Fibrosis grant HASSET98PO
(to D.J.H.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular Genetics, Biochemistry and Microbiology, University of
Cincinnati College of Medicine, 231 Bethesda Ave., Cincinnati, OH
45267-0524. Phone: (513) 558-1154. Fax: (513) 558-8474. E-mail:
Daniel.Hassett{at}UC.Edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 2.
|
Artavanis-Tsakonas, S.,
K. Matsuno, and M. E. Fortini.
1995.
Notch signaling.
Science
268:225-232[Abstract/Free Full Text].
|
| 3.
|
Barton, H.,
Z. Johnson,
C. D. Cox,
A. I. Vasil, and M. L. Vasil.
1996.
Ferric uptake regulator mutants of Pseudomonas aeruginosa with distinct alterations in the iron-dependent repression of exotoxin A and siderophores in aerobic and microaerobic environments.
Mol. Microbiol.
21:1001-1017[CrossRef][Medline].
|
| 4.
|
Beers, R. F., Jr., and I. W. Sizer.
1952.
A spectrophotometric method for measuring the breakdown of hydrogen peroxide by catalase.
J. Biol. Chem.
195:133-140[Free Full Text].
|
| 5.
|
Bennett, V.
1992.
Ankyrins: adaptors between diverse plasma membrane proteins and the cytoplasm.
J. Biol. Chem.
267:8703-8706[Free Full Text].
|
| 6.
|
Beveridge, T. J.
1999.
Structures of gram-negative cell walls and their derived membrane vesicles.
J. Bacteriol.
181:4725-4733[Free Full Text].
|
| 7.
|
Bodine, D. M.,
C. S. Birkenmeier, and J. E. Barker.
1984.
Spectrin deficient inherited hemolytic anemias in the mouse: characterization by spectrin synthesis and mRNA activity in reticulocytes.
Cell
37:721-729[CrossRef][Medline].
|
| 8.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 9.
|
Breeden, L., and K. Nasmyth.
1987.
Similarity between cell-cycle genes of budding yeast and fission yeast and the Notch gene of Drosophila.
Nature
329:651-654[CrossRef][Medline].
|
| 10.
|
Broome-Smith, J., and B. G. Spratt.
1986.
A vector for the construction of translational fusions to the TEM -lactamase and analysis of protein export signals and membrane protein topology.
Gene
49:341-349[CrossRef][Medline].
|
| 11.
|
Brown, S. M.,
M. L. Howell,
M. L. Vasil,
A. J. Anderson, and D. J. Hassett.
1995.
Cloning and characterization of the katB gene of Pseudomonas aeruginosa encoding a hydrogen peroxide-inducible catalase: purification of KatB, cellular localization, and demonstration that it is essential for optimal resistance to hydrogen peroxide.
J. Bacteriol.
177:6536-6544[Abstract/Free Full Text].
|
| 12.
|
Burans, J. P.,
M. Lynn, and M. Solotorovsky.
1983.
Induction of active immunity with membrane fractions from Haemophilus influenzae type b.
Infect. Immun.
41:285-293[Abstract/Free Full Text].
|
| 13.
|
Calcutt, M. J., and F. J. Schmidt.
1994.
Gene organization in the bleomycin-resistance region of the producer organism Streptomyces verticillus.
Gene
151:17-21[CrossRef][Medline].
|
| 14.
|
Chan, T. A.,
C. A. Chu,
K. A. Rauen,
M. Kroiher,
S. M. Tatarewicz, and R. E. Steele.
1994.
Identification of a gene encoding a novel protein-tyrosine kinase containing SH2 domains and ankyrin-like repeats.
Oncogene
9:1253-1259[Medline].
|
| 15.
|
Davis, J., and V. Bennett.
1990.
The anion exchanger and Na+K+ ATPase interacts with distinct sites on ankyrin: in vitro assays.
J. Biol. Chem.
265:17252-17256[Abstract/Free Full Text].
|
| 16.
|
Demple, B., and S. Linn.
1982.
5,6-saturated lesions in DNA: production by ultraviolet light or hydrogen peroxide.
Nucleic Acids Res.
10:3781[Abstract/Free Full Text].
|
| 17.
|
Dolata, M. M.,
J. J. Van Beeumen,
R. P. Ambler,
T. E. Meyer, and M. A. Cusanovich.
1993.
Nucleotide sequence of the heme subunit of flavocytochrome c from the purple phototrophic bacterium, Chromatium vinosum: a 2.6-kilobase pair DNA fragment contains two multiheme cytochromes, a flavoprotein, and a homolog of human ankyrin.
J. Biol. Chem.
268:14426-14431[Abstract/Free Full Text].
|
| 18.
|
Elkins, J. G.,
D. J. Hassett,
P. S. Stewart,
H. P. Schweizer, and T. R. McDermott.
1999.
Protective role of catalase in Pseudomonas aeruginosa biofilm resistance to hydrogen peroxide.
Appl. Environ. Microbiol.
65:4594-4600[Abstract/Free Full Text].
|
| 19.
|
Fortini, M. E., and S. Artavanis-Tsakonas.
1993.
Notch: neurogenesis is only part of the picture.
Cell
75:1245-1247[CrossRef][Medline].
|
| 20.
|
Garen, A., and C. Levinthal.
1960.
A fine-structure genetic and chemical study of the enzyme alkaline phosphatase of E. coli I. Purification and characterization of alkaline phosphatase.
Biochim. Biophys. Acta
38:470[Medline].
|
| 21.
|
Givskov, M.,
L. Olsen, and S. Molin.
1988.
Cloning and expression in Escherichia coli of the gene for extracellular phospholipase A1 from Serratia liquefaciens.
J. Bacteriol.
170:5855-5862[Abstract/Free Full Text].
|
| 22.
|
Gorina, S., and N. P. Pavletich.
1996.
Structure of the p53 tumor suppressor bound to the ankyrin and SH3 domains of 53BP2.
Science
274:1001-1005[Abstract/Free Full Text].
|
| 23.
|
Greenfield, N., and G. D. Fasman.
1969.
Computed circular dichroism for the evaluation of protein conformation.
Biochemistry
8:4108-4116[CrossRef][Medline].
|
| 24.
|
Gutierrez, C., and J. C. Devedjian.
1989.
A plasmid facilitating in vitro construction of phoA gene fusions in Escherichia coli.
Nucleic Acids Res.
17:3999[Free Full Text].
|
| 25.
|
Hassett, D. J.,
E. Alsabbagh,
K. Parvatiyar,
M. L. Howell,
R. W. Wilmott, and U. A. Ochsner.
2000.
A protease-resistant catalase, KatA, released upon cell lysis during stationary phase is essential for aerobic survival of a Pseudomonas aeruginosa oxyR mutant at low cell densities.
J. Bacteriol.
182:4557-4563[Abstract/Free Full Text].
|
| 26.
|
Hassett, D. J.,
J. G. Elkins,
J.-F. Ma, and T. R. McDermott.
1999.
Pseudomonas aeruginosa biofilm sensitivity to biocides: use of hydrogen peroxide as model antimicrobial agent for examining resistance mechanisms.
Methods Enzymol.
310:599-608[Medline].
|
| 27.
|
Hassett, D. J.,
J.-F. Ma,
J. G. Elkins,
T. R. McDermott,
U. A. Ochsner,
S. E. H. West,
C.-T. Huang,
J. Fredericks,
S. Burnett,
P. S. Stewart,
G. McPheters,
L. Passador, and B. H. Iglewski.
1999.
Quorum sensing in Pseudomonas aeruginosa controls expression of catalase and superoxide dismutase genes and mediates biofilm susceptibility to hydrogen peroxide.
Mol. Microbiol.
34:1082-1093[CrossRef][Medline].
|
| 28.
|
Holloway, B. W.
1969.
Genetics of Pseudomonas.
Bacteriol. Rev.
33:419-443[Free Full Text].
|
| 29.
|
Holloway, B. W.,
V. Krishnapillai, and A. F. Morgan.
1979.
Chromosomal genetics of Pseudomonas.
Microbiol. Rev.
43:73-102[Free Full Text].
|
| 30.
|
Kakkar, P.,
S. Mehrotra, and P. N. Viswanathan.
1998.
Influence of antioxidants on the peroxidative swelling of mitochrondria in vitro.
Cell Biol. Toxicol.
14:313-321[CrossRef][Medline].
|
| 31.
|
Kim, D.
1999.
Elastic and viscous properties of fel-phase monolayers measured at the gas-bubble/water interface. Ph.D. thesis.
Duke University, Durham, N.C.
|
| 32.
|
Klotz, M. G., and A. J. Anderson.
1995.
Sequence of a gene encoding periplasmic Pseudomonas syringae ankyrin.
Gene
164:187-188[CrossRef][Medline].
|
| 33.
|
Klotz, M. G., and S. W. Hutcheson.
1992.
Multiple periplasmic catalases in phytopathogenic strains of Pseudomonas syringae.
Appl. Environ. Microbiol.
58:2468-2473[Abstract/Free Full Text].
|
| 34.
|
Kraft, A. R.,
J. Prabhu,
A. Ursinus, and J. V. Holtje.
1999.
Interference with murein turnover has no effect on growth but reduces beta-lactamase induction in Escherichia coli.
J. Bacteriol.
181:7192-7198[Abstract/Free Full Text].
|
| 35.
|
Ma, J.-F.,
U. A. Ochsner,
M. G. Klotz,
V. K. Nanayakkara,
M. L. Howell,
Z. Johnson,
J. Posey,
M. L. Vasil,
J. J. Monaco, and D. J. Hassett.
1999.
Bacterioferritin A modulates catalase A (KatA) activity and resistance to hydrogen peroxide in Pseudomonas aeruginosa.
J. Bacteriol.
181:3730-3742[Abstract/Free Full Text].
|
| 36.
|
Michaely, P., and V. Bennett.
1992.
The ANK repeat: a ubiquitous motif involved in macromolecular recognition.
Trends Cell Biol.
2:127-130[CrossRef][Medline].
|
| 37.
|
Miller, J. H.
1992.
A short course in bacterial genetics, p. 72-74.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 38.
|
Minakami, H., and I. Fridovich.
1990.
Effects of paraquat on cultures of Escherichia coli: turbidity versus enumeration.
Free Rad. Biol. Med.
8:387-391[CrossRef][Medline].
|
| 39.
|
Ochsner, U. A.,
M. L. Vasil,
E. Alsabbagh,
K. Parvatiyar, and D. J. Hassett.
2000.
Role of the Pseudomonas aeruginosa oxyR-recG operon in oxidative stress defense and DNA repair: OxyR-dependent regulation of katB-ankB, ahpB, and ahpC-ahpF.
J. Bacteriol.
182:4533-4544[Abstract/Free Full Text].
|
| 40.
|
Palek, J., and S. Lambert.
1990.
Genetics of the red cell membrane.
Semin. Hematol.
27:290-332[Medline].
|
| 41.
|
Peters, L. L.,
L. C. Turtzo,
C. S. Birkenmeier, and J. E. Barker.
1993.
Distinct fetal Ank-1 and Ank-2 related proteins and mRNAs in normal and nb/nb mice.
Blood
81:2144-2149[Abstract/Free Full Text].
|
| 42.
|
Pugsley, A. P.
1993.
The complete secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108[Abstract/Free Full Text].
|
| 43.
|
Schweizer, H. P.
1991.
Improved broad-host-range lac-based plasmid vectors for the isolation and characterization of protein fusions in Pseudomonas aeruginosa.
Gene
103:87-92[CrossRef][Medline].
|
| 44.
|
Schweizer, H. P.
1994.
A method for construction of bacterial hosts for lac-based cloning and expression vectors: -complementation and regulated expression.
BioTechniques
17:452-456[Medline].
|
| 45.
|
Schweizer, H. P.
1993.
Small broad-host-range gentamicin resistance gene cassettes for site-specific insertion and deletion mutagenesis.
BioTechniques
15:831-833[Medline].
|
| 46.
|
Schweizer, H. P., and T. T. Hoang.
1995.
An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa.
Gene
158:15-22[CrossRef][Medline].
|
| 47.
|
Sevinc, M. S.,
M. J. Mate,
J. Switala,
I. Fita, and P. C. Loewen.
1999.
Role of the lateral channel in catalase HPII of Escherichia coli.
Protein Sci.
8:490-498[Medline].
|
| 48.
|
Simon, R.,
U. Priefer, and A. Puehler.
1983.
A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria.
Bio/Technology
1:784-791[CrossRef].
|
| 49.
|
Song, Y., and N. J. Sargentini.
1996.
Escherichia coli DNA repair gene radA and sms are the same gene.
J. Bacteriol.
178:5045-5048[Abstract/Free Full Text].
|
| 50.
|
Spence, A. M.,
A. Coulson, and J. Hodgkin.
1990.
The product of fem-1, a nematode sex-determining gene, contains a motif found in cell cycle control proteins and receptors for cell-cell interactions.
Cell
60:981-990[CrossRef][Medline].
|
| 51.
|
Srinivasan, Y.,
L. Elmer,
J. Davis,
V. Bennett, and K. Angelides.
1988.
Ankyrin and spectrin associate with voltage-dependent sodium channels in brain.
Nature
333:177-180[CrossRef][Medline].
|
| 52.
|
Srinivasan, Y.,
M. Lewallen, and K. J. Angelides.
1992.
Mapping the binding site of ankyrin for the voltage-dependent sodium channel from brain.
J. Biol. Chem.
267:7483-7489[Abstract/Free Full Text].
|
| 53.
|
Studier, F. W., and B. H. Moffatt.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[CrossRef][Medline].
|
| 54.
|
Takemura, H.,
S. Horinouchi, and T. Beppu.
1993.
Suppression of an ethanol-sensitive mutation of Acetobacter pasteurianus by overexpression of the his1 gene encoding histidinol phosphate aminotransferase.
J. Ferment. Bioeng.
76:224-228[CrossRef].
|
| 55.
|
Tamarit, J.,
E. Cabiscol, and J. Ros.
1998.
Identification of the major oxidatively damaged proteins in Escherichia coli cells exposed to oxidative stress.
J. Biol. Chem.
273:3027-3032[Abstract/Free Full Text].
|
| 56.
|
van de Goor, J., and R. B. Kelly.
1996.
Association of Drosophila cysteine string proteins with membranes.
FEBS Lett.
19:251-256[CrossRef].
|
| 57.
|
von Heijne, G.
1992.
Membrane protein structure prediction. Hydrophobicity analysis and positive-inside rule.
J. Mol. Biol.
225:487-494[CrossRef][Medline].
|
| 58.
|
Wayne, L. G., and G. A. Diaz.
1986.
A double staining method for differentiating between two classes of mycobacterial catalase in polyacrylamide gels.
Anal. Biochem.
157:89-92[CrossRef][Medline].
|
Journal of Bacteriology, August 2000, p. 4545-4556, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhu, B., Nethery, K. A., Kuriakose, J. A., Wakeel, A., Zhang, X., McBride, J. W.
(2009). Nuclear Translocated Ehrlichia chaffeensis Ankyrin Protein Interacts with a Specific Adenine-Rich Motif of Host Promoter and Intronic Alu Elements. Infect. Immun.
77: 4243-4255
[Abstract]
[Full Text]
-
Ishmael, N., Hotopp, J. C. D., Ioannidis, P., Biber, S., Sakamoto, J., Siozios, S., Nene, V., Werren, J., Bourtzis, K., Bordenstein, S. R., Tettelin, H.
(2009). Extensive genomic diversity of closely related Wolbachia strains. Microbiology
155: 2211-2222
[Abstract]
[Full Text]
-
Miyazaki, R., Ohtsubo, Y., Nagata, Y., Tsuda, M.
(2008). Characterization of the traD Operon of Naphthalene-Catabolic Plasmid NAH7: a Host-Range Modifier in Conjugative Transfer. J. Bacteriol.
190: 6281-6289
[Abstract]
[Full Text]
-
Mavromatis, K., Doyle, C. K., Lykidis, A., Ivanova, N., Francino, M. P., Chain, P., Shin, M., Malfatti, S., Larimer, F., Copeland, A., Detter, J. C., Land, M., Richardson, P. M., Yu, X. J., Walker, D. H., McBride, J. W., Kyrpides, N. C.
(2006). The Genome of the Obligately Intracellular Bacterium Ehrlichia canis Reveals Themes of Complex Membrane Structure and Immune Evasion Strategies. J. Bacteriol.
188: 4015-4023
[Abstract]
[Full Text]
-
Starkenburg, S. R., Chain, P. S. G., Sayavedra-Soto, L. A., Hauser, L., Land, M. L., Larimer, F. W., Malfatti, S. A., Klotz, M. G., Bottomley, P. J., Arp, D. J., Hickey, W. J.
(2006). Genome Sequence of the Chemolithoautotrophic Nitrite-Oxidizing Bacterium Nitrobacter winogradskyi Nb-255.. Appl. Environ. Microbiol.
72: 2050-2063
[Abstract]
[Full Text]
-
Parvatiyar, K., Alsabbagh, E. M., Ochsner, U. A., Stegemeyer, M. A., Smulian, A. G., Hwang, S. H., Jackson, C. R., McDermott, T. R., Hassett, D. J.
(2005). Global Analysis of Cellular Factors and Responses Involved in Pseudomonas aeruginosa Resistance to Arsenite. J. Bacteriol.
187: 4853-4864
[Abstract]
[Full Text]
-
Lau, G. W., Britigan, B. E., Hassett, D. J.
(2005). Pseudomonas aeruginosa OxyR Is Required for Full Virulence in Rodent and Insect Models of Infection and for Resistance to Human Neutrophils. Infect. Immun.
73: 2550-2553
[Full Text]
-
Chauvatcharin, N., Atichartpongkul, S., Utamapongchai, S., Whangsuk, W., Vattanaviboon, P., Mongkolsuk, S.
(2005). Genetic and physiological analysis of the major OxyR-regulated katA from Xanthomonas campestris pv. phaseoli. Microbiology
151: 597-605
[Abstract]
[Full Text]
-
Holmes, K., Mulholland, F., Pearson, B. M., Pin, C., McNicholl-Kennedy, J., Ketley, J. M., Wells, J. M.
(2005). Campylobacter jejuni gene expression in response to iron limitation and the role of Fur. Microbiology
151: 243-257
[Abstract]
[Full Text]
-
Nascimento, A. L. T. O., Ko, A. I., Martins, E. A. L., Monteiro-Vitorello, C. B., Ho, P. L., Haake, D. A., Verjovski-Almeida, S., Hartskeerl, R. A., Marques, M. V., Oliveira, M. C., Menck, C. F. M., Leite, L. C. C., Carrer, H., Coutinho, L. L., Degrave, W. M., Dellagostin, O. A., El-Dorry, H., Ferro, E. S., Ferro, M. I. T., Furlan, L. R., Gamberini, M., Giglioti, E. A., Goes-Neto, A., Goldman, G. H., Goldman, M. H. S., Harakava, R., Jeronimo, S. M. B, Junqueira-de-Azevedo, I. L. M., Kimura, E. T., Kuramae, E. E., Lemos, E. G. M., Lemos, M. V. F., Marino, C. L., Nunes, L. R., de Oliveira, R. C., Pereira, G. G., Reis, M. S., Schriefer, A., Siqueira, W. J., Sommer, P., Tsai, S. M., Simpson, A. J. G., Ferro, J. A., Camargo, L. E. A., Kitajima, J. P., Setubal, J. C., Van Sluys, M. A.
(2004). Comparative Genomics of Two Leptospira interrogans Serovars Reveals Novel Insights into Physiology and Pathogenesis. J. Bacteriol.
186: 2164-2172
[Abstract]
[Full Text]
-
Trott, D. J., Alt, D. P., Zuerner, R. L., Bulach, D. M., Wannemuehler, M. J., Stasko, J., Townsend, K. M., Stanton, T. B.
(2004). Identification and cloning of the gene encoding BmpC: an outer-membrane lipoprotein associated with Brachyspira pilosicoli membrane vesicles. Microbiology
150: 1041-1053
[Abstract]
[Full Text]
-
Palma, M., DeLuca, D., Worgall, S., Quadri, L. E. N.
(2004). Transcriptome Analysis of the Response of Pseudomonas aeruginosa to Hydrogen Peroxide. J. Bacteriol.
186: 248-252
[Abstract]
[Full Text]
-
Srinivasa Rao, P. S., Yamada, Y., Leung, K. Y.
(2003). A major catalase (KatB) that is required for resistance to H2O2 and phagocyte-mediated killing in Edwardsiella tarda. Microbiology
149: 2635-2644
[Abstract]
[Full Text]
-
Chain, P., Lamerdin, J., Larimer, F., Regala, W., Lao, V., Land, M., Hauser, L., Hooper, A., Klotz, M., Norton, J., Sayavedra-Soto, L., Arciero, D., Hommes, N., Whittaker, M., Arp, D.
(2003). Complete Genome Sequence of the Ammonia-Oxidizing Bacterium and Obligate Chemolithoautotroph Nitrosomonas europaea. J. Bacteriol.
185: 2759-2773
[Abstract]
[Full Text]
-
Harris, A. G., Wilson, J. E., Danon, S. J., Dixon, M. F., Donegan, K., Hazell, S. L.
(2003). Catalase (KatA) and KatA-associated protein (KapA) are essential to persistent colonization in the Helicobacter pylori SS1 mouse model. Microbiology
149: 665-672
[Abstract]
[Full Text]
-
Ochsner, U. A., Vasil, M. L., Alsabbagh, E., Parvatiyar, K., Hassett, D. J.
(2000). Role of the Pseudomonas aeruginosa oxyR-recG Operon in Oxidative Stress Defense and DNA Repair: OxyR-Dependent Regulation of katB-ankB, ahpB, and ahpC-ahpF. J. Bacteriol.
182: 4533-4544
[Abstract]
[Full Text]
-
Hassett, D. J., Alsabbagh, E., Parvatiyar, K., Howell, M. L., Wilmott, R. W., Ochsner, U. A.
(2000). A Protease-Resistant Catalase, KatA, Released upon Cell Lysis during Stationary Phase Is Essential for Aerobic Survival of a Pseudomonas aeruginosa oxyR Mutant at Low Cell Densities. J. Bacteriol.
182: 4557-4563
[Abstract]
[Full Text]