Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4617-4624, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regulation of Expression of the
yiaKLMNOPQRS Operon for Carbohydrate Utilization in
Escherichia coli: Involvement of the Main
Transcriptional Factors
Ester
Ibañez,
Evangelina
Campos,
Laura
Baldoma,
Juan
Aguilar,* and
Josefa
Badia
Department of Biochemistry, School of
Pharmacy, University of Barcelona, 08028 Barcelona, Spain
Received 13 March 2000/Accepted 2 June 2000
 |
ABSTRACT |
The yiaKLMNOPQRS (yiaK-S) gene cluster of
Escherichia coli is believed to be involved in the
utilization of a hitherto unknown carbohydrate which generates the
intermediate L-xylulose. Transcription of
yiaK-S as a single message from the unique promoter found
upstream of yiaK is proven in this study. The 5' end has
been located at 60 bp upstream from the ATG. Expression of the
yiaK-S operon is controlled in the wild-type strain by a
repressor encoded by yiaJ. No inducer molecule of the
yiaK-S operon has been identified among over 80 carbohydrate or derivative compounds tested, the system being expressed
only in a mutant strain lacking the YiaJ repressor. The
lacZ transcriptional fusions in the genetic background of the mutant strain revealed that yiaK-S is modulated by the
integration host factor and by the cyclic AMP (cAMP)-cAMP receptor
protein (Crp) activator complex. A twofold increase in the induction
was observed during anaerobic growth, which was independent of ArcA or
Fnr. Gel mobility shift assays showed that the YiaJ repressor binds to
a promoter fragment extending from
50 to +121. These studies also
showed that the cAMP-Crp complex can bind to two different sites. The
lacZ transcriptional fusions of different fragments of the
promoter demonstrated that binding of cAMP-Crp to the Crp site 1, centered at
106, is essential for yiaK-S expression. The
5' end of the yiaJ gene was determined, and its promoter
region was found to overlap with the divergent yiaK-S
promoter. Expression of yiaJ is autogenously regulated and
reduced by the binding of Crp-cAMP to the Crp site 1 of the
yiaK-S promoter.
 |
INTRODUCTION |
The gene cluster
yiaKLMNOPQRS (yiaK-S) (Fig. 1), labeled according
to the latest notation (17) proposed for the genes of unknown function in the Escherichia coli genome (accession
no. U00039), lies at min 80.7 of the bacterial chromosome. Sequence similarity studies allowed us to assign a carbohydrate metabolism function to this system (36). Previous work by Sanchez et
al. (32) identified the yiaP gene product as a
highly specific L-xylulose kinase purified from mutant
cells selected for their ability to grow on the rare pentose
L-lyxose. However, the yiaK-S operon seems only
fortuitously used for the metabolism of the intermediate L-xylulose formed from L-lyxose. The natural
origin of L-xylulose may result from the action of the
yiaK-S-encoded proteins on the unknown substrate. Of the
nine genes in the yiaK-S cluster, recently we have shown
that two more gene products are involved in the metabolism of
endogenous L-xylulose (14). Gene yiaR
is believed to encode a 3-epimerase, while gene yiaS encodes
a 4-epimerase. The yiaK-S gene cluster is coordinately
regulated by gene yiaJ, located upstream of
yiaK-S and divergently transcribed from it. The
yiaJ gene product acts as a repressor of yiaK-S.
Because no inducer or inducing conditions have been found, expression
of this gene cluster has only been detected in mutant strain JA134, selected for its ability to grow on L-lyxose. In this
strain, the regulator gene is inactivated by a genome rearrangement
mediated by IS1 transposition that leads to constitutive
expression of the yiaK-S operon (2). The absence
of structural gene transcripts in wild-type strain ECL1 and the absence
of regulator transcript in strain JA134 are in accordance with a
negative control exercised by the repressor encoded by gene
yiaJ. Control of expression of yiaK-S operon by
yiaJ and other transcriptional factors is reported here.
 |
MATERIALS AND METHODS |
Bacterial strains, plasmids, and phages.
All of the strains
used were E. coli K-12 derivatives. The genotype and sources
of the relevant bacterial strains are given in Table
1. Genetic crosses were performed by
P1vir-mediated transduction (23). Transductants
that incorporated the arcA mutation were selected by their
sensitivity to O-toluidine blue (15), and those
incorporating the fnr mutation were selected by their
inability to grow anaerobically on glycerol plus nitrate (37). Transductants that incorporated a himA,
himD3, or crp mutation were selected by the
linked antibiotic resistance.
Growth conditions and preparation of cell extracts.
Cells
were grown on Luria broth or minimal medium and harvested at the end of
the exponential phase as described previously (4). Carbon
sources were added to a basal inorganic medium at a 60 mM carbon
concentration for aerobic growth and 120 mM for anaerobic growth. For
anaerobic respiration, nitrate was also added to the culture at a 20 mM
concentration. Casein acid hydrolysate (CAA) was used at 0.5 or 1%
depending on oxygen availability. To search for the inducer, a
screening of candidate molecules was set up by adding to the CAA medium
the following compounds at the carbon concentration indicated above:
D-raffinose (C18); D-glucopyranosyl-D-fructose, cellobiose,
saccharose, trehalose, and maltose (C12);
N-acetylmuramic acid (C11);
N-acetylglucosamine (C8);
methyl-D-mannopyranoside, pimelic acid, and
D-glucoheptonic acid (C7);
D-galactose, D-fucose, L-fucose,
D-fructose, L-fructose, D-mannose,
L-mannose, D-sorbose, L-sorbose,
inulin, D-glucose, D-tagatose,
D-allose, D-talose, D-psicose,
L-rhamnose, D-mannitol, D-sorbitol,
myo-inositol, dulcitol, L-fucitol,
L-iditol, gluconic acid, galacturonic acid, glucuronic
acid, saccharic acid, phthalic acid, L-ascorbic acid, and
adipic acid (C6); D-arabinose,
L-arabinose, D-xylose, L-xylose,
D-lyxose, L-lyxose, D-arabitol,
L-arabitol, D-ribose, D-ribulose,
D-xylulose, adonitol, xylitol,
-ketoglutaric acid,
-ketoglutaric acid (C5); erythritol, succinic
semialdehyde, succinic acid, fumaric acid,
D,L-malic acid, tartaric acid, diglycolic acid
(C4); D-lactate, L-lactate,
D,L-glyceraldehyde, glycerol, pyruvic acid
(C3); and glycolic acid and oxalic acid (C2).
Citrus fruit pectin and apple pectin were prepared at 0.14% in sodium acetate buffer (pH 4.0) and incubated overnight at 25°C with 400 U of
Aspergillus niger pectinase, and the hydrolysis products were diluted 10-fold in the medium. All compounds tested were obtained
from Sigma Chemical Co. (St. Louis, Mo.).
When necessary, the antibiotics were used at the indicated
concentrations: ampicillin, 100 µg/ml; kanamycin, 50 µg/ml;
tetracycline,
12.5 µg/ml; chloramphenicol, 30 µg/ml; and
novobiocin, 200 µg/ml.
5-Bromo-4-chloro-3-indolyl-

-
D-galactoside (X-Gal) and
isopropyl-

-
D-thiogalactoside
were used at 30 and 10 µg/ml,
respectively.
For

-galactosidase assays, the cells were allowed to double five or
six times to an
A600 of 0.5 for aerobic cultures
or 0.25
for anaerobic
cultures.
Cell extracts were prepared as described previously (
4).
Protein concentration was determined by the method of Lowry et
al.
(
20) with bovine serum albumin as a standard.

-Galactosidase
activity was assayed by hydrolysis of
o-nitrophenyl-

-
D-galactopyranoside
and
expressed as Miller units (
23). The data reported are a
representative set of at least four separate experiments performed
in
duplicate.
Northern blot analysis and primer extension.
For preparation
of total RNA, cells of a 25-ml culture grown to an
A650 of 0.5 were collected by centrifugation at
5,000 × g for 10 min and processed as described by
Belasco et al. (3). Northern blot hybridization was
performed with each RNA sample (10 µg) by the procedure described by
Moralejo et al. (24). For determination of the 5' end of the
structural and the regulatory genes, the following oligonucleotides
were used as primers: 5'-GCCGCGTGAAATTAAGACCCG-3' complementary to an internal region within yiaK and
5'-CTTTTTCCTGTGCCATCTCGTTC-3' complementary to an internal
region within yiaJ. The reactions were performed with 50 µg of total RNA at 37°C for 30 min with 200 U of Moloney murine
leukemia virus reverse transcriptase (Life Technologies, Inc.) and
[
-35S]thio-dATP (>1,000 Ci/mmol; Amersham Pharmacia
Biotech) and followed by a 30-min chase with all four nucleotides (at 1 mM each). As a reference, double-strand sequence reactions were
performed with the primers used for the primer extension experiments.
DNA manipulation and genetic techniques.
Plasmid DNA was
routinely prepared by the boiling method (13). For
large-scale preparation, a crude DNA sample was subjected to
purification on a column (Qiagen GmbH, Düsseldorf, Germany). DNA
manipulations were performed essentially as described by Sambrook et
al. (31). The DNA sequence was determined by using the
dideoxy-chain termination procedure of Sanger et al. (33),
with double-stranded plasmid as the template.
Tn
5 insertion mutagenesis was carried out by infection with
phage

467 (
b221
cIts857
rex::Tn
5 Oam29
Pam80), as
described
by Bruijn and Lupski (
5). Tn
5 insertion
mutants in the
yiaK-S gene cluster or in the
cya
gene were obtained from strain JA134.
These mutants were selected for
their inability to utilize
L-lyxose.
The precise location
of the insertion in the
yiaK gene in strain
JA181 and in the
cya gene in strain JA187 was assessed by sequencing
the
chromosomal region close to the Tn
5, with an internal
sequence
of the transposon used as a
primer.
Constructions of lacZ fusions and deletions of the
yiaK-S promoter.
To create operon fusions, DNA
fragments of the 5'-upstream region of some structural genes and the
regulator gene were cloned into plasmid pRS550 or pRS551
(35). In some experiments, the DNA fragment was extended to
several genes to examine the presence of possible promoters within the
coding region (Fig. 1). The pRS plasmids
carried a cryptic lac operon and genes that confer
resistance to both kanamycin and ampicillin. After introduction of the
recombinant plasmids into the tetracycline-resistant strain XL1-Blue,
blue colonies on Luria-Bertani plates containing X-Gal, ampicillin, and
kanamycin were isolated. Plasmid DNA was sequenced by using the M13
primer to ensure that the desired fragment was inserted in the correct
orientation. Single-copy fusions on the E. coli chromosome
were obtained by the method of Elliot (8). Plasmids containing the different lacZ fusions were linearized with
XhoI or SalI and used to transform strain TE2680.
Due to the presence in strain TE2680 of the
recD::Tn10 mutation and sequences
inserted into the trp operon that are homologous to
sequences in pRS plasmids, this strain recombines linear pRS550- or
pRS551-based plasmids into its chromosome. The transformants were
selected for kanamycin resistance and screened for sensitivity to
ampicillin and chloramphenicol. P1vir lysates were made to
transduce the fusions into other genetic backgrounds.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Physical and genetic map of the region encompassing the
yiaK-S operon. The bar represents the SalI genome
fragment with the relevant restriction sites labeled as follows: A,
AgeI; B, BamHI; Bg, BglII; Bs,
BstXI; H, HindIII; P, PstI; S,
SalI; V, EcoRV; X, XhoI; and Xc,
XcmI. Open arrows indicate the extent and direction of
transcription of the genes included in the yiaK-S operon.
Black arrows represented the fragments fused to lacZ for
testing yia promoter function.
|
|
Fragments containing sequences of the promoter region were created by
PCR. The 20-mer oligonucleotide 5'-ACGCCGCGTGAAATTAAGAC-3'
identical to the sequence between +121 and +102 of the noncoding
strand of gene
yiaK was used as the constant primer. This
oligomer
incorporated eight bases at the 5' end, which included an
EcoRI
site at one end of the PCR product. The partner
primers extended
from the following positions:

148 to

128,

114 to

94,

105
to

85,

93 to

73,

50 to

30, and

17 to +3 (see
Fig.
4), all
bearing nine additional nucleotides at the 5' end, which
included
a
BamHI site at the other end of the PCR product.
After digestion
with
BamHI-
EcoRI, the PCR
products were cloned into pRS550, and
the recombinant plasmids were
used to construct single-copy
lacZ fusions (labeled as

-148,

-114,

-105,

-93,

-50, and

-17)
in the
background of strain JA134 or
ECL1.
DNA binding studies.
For electrophoretic mobility shift
assays, three different PCR-amplified fragments were used as probes.
These fragments extended, according to the 5' end determined for the
structural genes (see Fig. 3B), from position
148 to position +121,
from
50 to +121, and from
148 to
70. After purification from
acrylamide gels, fragments were labeled with T4 polynucleotide kinase
and [
-32P]ATP (3,000 Ci/mmol; New England Nuclear).
Electrophoretic mobility shift assays were performed with crude
extracts obtained as described by Nunoshiba et al. (
28).
Acrylamide gels containing 10% glycerol were run at 4°C by using
1×
Tris-borate-EDTA buffer (
1). Protein samples were mixed
with
32P-end-labeled DNA substrates (ca. 2.5 nM final
concentration,
ca. 10,000 to 25,000 cpm) in a 25-µl reaction volume
containing
10 mM Tris-HCl (pH 7.4), 100 mM KCl, 10 mM
MgCl
2, 10% glycerol,
and 2 mM dithiothreitol. Poly(dI-dC)
was used as a nonspecific
competitor. Validation of binding specificity
was performed with
unlabeled DNA fragments P269, P171, and P78 as
competitors for
themselves. After incubation for 30 min at 25°C, a
1/6 volume
of a 6× gel loading buffer (
1) was added, and
the mixtures
were loaded directly onto prerun
gels.
 |
RESULTS |
Transcriptional organization of the yiaK-S operon.
Previous Northern blot experiments with the
L-lyxose-positive strain JA134 failed to detect a
polycistronic mRNA (2), possibly because of a message decay.
To circumvent such a possibility, we transduced the
yiaJ::cat of strain JA161
(2) into RNase E temperature-sensitive mutant strain CH1828
(strain JA180). Northern blot hybridization of RNA preparations of
mutant strain JA180 grown at a restrictive temperature by using
internal probes of yiaP (lyxK), yiaQ,
or yiaR showed an mRNA of 8.2 kb corresponding to the
full-length transcript of the yiaK-S system. This
full-length transcript was not apparent in RNA preparations of strain
JA180 grown at a nonrestrictive temperature, while no hybridization bands were observed in a control experiment with RNA of strain CH1828
(Fig. 2).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Northern blot of total RNA from strain JA180 grown at
30°C (lane 3), strain JA180 after shifting to 45°C (lane 1), and
strain CH1828 grown at 30°C (lane 2). Hybridization was performed
with a 0.85-kb yiaR-specific probe.
|
|
Transcription of the
yiaK-S genes as a single unit was also
supported by the properties of
lacZ fusions presented in
Fig.
1. These operon fusions were transferred to strains ECL1 and
JA134.
Among these fusions, only the one corresponding to the leading
yiaK displayed

-galactosidase activity under any of the
growth
conditions used, which included CAA in the presence or absence
of
L-lyxose. Expression of the (
yiaK-lacZ)
fusion in the genetic
background of strain ECL1 resulted in a

-galactosidase activity
of 42 Miller units, while its expression in
the
yiaJ mutant strain
JA134 displayed high levels of

-galactosidase activity (4,250
Miller units) in both the absence and
the presence of
L-lyxose.
These observations indicated that
the only functional promoter
for the structural genes is located
upstream of
yiaK.
Processing of the
yiaK-S genetic cluster as a single
transcriptional unit was also consistent with the polarity effects
caused
by Tn
5 insertion mutation in several of the
intervening genes,
notably in
yiaK, the first gene
transcribed. Indeed, the
yiaK mutant strain JA181 displayed
neither
L-xylulose kinase activity
nor
yiaK-S
transcript, as shown by the absence of hybridization
bands in Northern
experiments (data not
shown).
As reported previously, the regulator gene
yiaJ, divergently
transcribed, yielded a transcript of 0.95 kb in RNA preparations
of
strain ECL1, but not of mutant strain JA134 (
2). The operon
fusion
yiaJ-lacZ corresponding to the putative regulator
gene,
as is common to other regulator genes, showed a basal level of

-galactosidase activity in strain ECL1, indicating regular function
of its promoter (Table
2). The increase
in activity level observed
in strain JA134, impaired in the regulator
gene, could indicate
the autogenous regulation of
yiaJ
expression. Consistently overexpression
of YiaJ from pJB1 reduced the
level of
yiaJ-lacZ expression in
strain JA134.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
-Galactosidase activities of (yiaJ-lacZ)
and (yiaK-lacZ) in the genetic background of wild-type
strain ECL1 and mutant strain JA134 grown in different conditions
|
|
Mapping of the mRNA 5' end for the structural and regulator
transcriptional units.
The 5' end of the structural genes was
determined by primer extension analysis. Total RNA from strain JA134,
hence containing structural yiaK-S gene transcripts, was
obtained by growth on L-lyxose and also on CAA. For the
primer extension reaction, primer complementary to an internal region
of yiaK was used, and a single putative start point was
determined (Fig. 3B). The mRNA 5' end was thus located at 60 bp
upstream from the ATG codon. The putative start site, position +1 in
Fig. 3A, is preceded by a promoter-like sequence that conforms relatively well to the consensus for
70 RNA polymerase. In this sequence, a
10 TATA box is
clearly defined as well as a
35 consensus box found at 17 nucleotides. Analysis of the sequence also showed two putative Crp
consensus sites
one centered at
106 (Crp site 1) and the other at
+65 (Crp site 2). Using the MacTargsearch program (10), we
identified potential integration host factor (IHF)-binding sites
extending from
28 to
71 in the coding strand and from
31 to
74
in the complementary strand. A putative Fnr site has been noted
centered at
65.5 (Fig. 3A) matching 7 of 10 positions in the Fnr
consensus sequence (TTGAT-N4-ATCAA) (39).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 3.
Promoter sequences and primer extension analysis of the
divergently transcribed yiaK and yiaJ genes. (A)
The sequence containing both overlapping promoters is presented and
numbered relative to the 5' end of the yiaK gene. For each
gene, the Shine-Dalgarno sequences (SD) and the 10 and 35 consensus
for RNA polymerase binding are indicated by a double underline for
yiaJ and a black bar for yiaK. Nucleotides in the
extension of the 10 consensus for yiaJ are shown in
boldface. The 5' ends are shown by arrowheads labeled as +1. Potential
IHF binding sites, identified by using the MacTargsearch program
(10), are shaded. The putative Fnr site is boxed, and
positions conserved with respect to the Crp consensus (7) in
Crp putative sites are indicated by asterisks. (B) The primed-extended
products using total RNA of strain ECL1 (lane 1 of the yiaJ
panel) or strain JA134 (lane 1 of the yiaK panel) were
electrophoresed with a sequencing ladder (lanes A, C, G, and T)
generated by using the same template and primer. A portion of the
nucleotide sequence deduced from the sequencing lanes is shown. The
most intense extended product assigned as the transcriptional start
site for each gene is labeled by an asterisk.
|
|
Because the regulator gene
yiaJ was transcribed opposite to
the neighbor structural gene
yiaK, the promoter regions of
both
genes overlapped. Transcription initiation of
yiaJ was
also determined
by the same method with total RNA obtained from strain
ECL1, which
contains copies of the regulator transcript. In this way,
three
products were detected by the radioautography. A major one,
located
at 87 bp upstream of the regulator ATG on the minus strand, was
likely to be the 5' end for the regulator gene (Fig.
3B). The
other
minor signals were considered to be alternative, secondary,
or
artifactual. As described by Kumar et al. (
18) in other
promoters,
an extended

10 region, TGATTGAT (Fig.
3A),
could compensate for
the poor

10 and

35 consensus and the unusual
spacing of 21 bp
of this weak
promoter.
Expression from the functional promoter.
Since we could not
identify the inducer, we studied the promoter function in a biochemical
background lacking the repressor. Comparison of
-galactosidase
activities expressed by the (yiaK-lacZ) fusion in strain
ECL1 and strain JA134 allowed us to further characterize the function
of this promoter (Table 2). In this way, wild-type cells displayed
basal levels of activity when grown on CAA, whereas the mutant strain
JA134 gave high constitutive levels of activity when grown on this
carbon source, indicating full transcription from its promoter. This is
well in agreement with the repressor model of regulation of this system.
Cultures of strain JA134 carrying

(
yiaK-lacZ) grown in
the presence of glucose, both aerobically and anaerobically, showed
lower

-galactosidase activities, indicating that glucose produced
catabolite repression in this promoter. The addition of cyclic
AMP
(cAMP) to a 5 mM concentration partially recovered the activity
in the
presence of glucose. The threefold increased expression
of

(
yiaK-lacZ) by growth on succinate (Table
2), which is
considered
a poor carbon source, also confirmed the regulation of this
operon
by carbon sources. In contrast, the presence of glucose enhanced
the promoter function of the regulator, as indicated by the increased

-galactosidase activity of

(
yiaJ-lacZ). No relevant
effect of
the cAMP addition was observed in this case. This is further
supported
by the increase in the expression of (
yiaJ-lacZ)
fusion (510 Miller
units) and the reduction of the expression of
(
yiaK-lacZ) fusion
(55 Miller units) in strain JA186 lacking
Crp. Thus,
yiaK-S transcription
is coordinately repressed in
the presence of glucose by both the
effect of the absence of cAMP-Crp
binding to the promoter and
the increase in repressor
synthesis.
Expression of this operon was twofold higher in cultures of strain
JA134 grown in the absence of oxygen, suggesting an aerobic
or
anaerobic control. To test whether Fnr and/or Arc is involved
in the
expression of the
yiaK-S operon, we transduced an
fnr mutation
from strain JRG1728 and an
arcA
mutation from strain ECL618 to
JA134 to yield strains JA182 and JA183,
respectively.

-Galactosidase
analysis showed that neither Fnr nor
Arc controls the aerobic
or anaerobic expression of this operon (not
shown). The influence
of DNA supercoiling in this control was studied
by adding 0.2
mM novobiocin to CAA cultures at an
A600 of 0.5. Assays of

-galactosidase
did not
show differences after 1 h of incubation with the antibiotic
(not
shown).
To determine whether IHF influences
yiaK-S expression in
vivo, we examined the effect of a mutation in
himA or in
himD3. The
himA::
cat and the
himD3::
cat alleles were transferred
from strain
HN1491 and strain K2704 to a JA134 background by P1
transduction,
yielding strains JA184 and JA185. Introduction of each of
these
IHF mutations produced a fourfold decrease in

-galactosidase
activity in these mutant strains compared with that of the isogenic
wild type (data not shown). These results suggest that IHF activates
yiaK-S expression.
Deletion analysis of the promoter.
To analyze the
cis-acting motifs relevant for regulation of the
yiaK-S operon and whether the repressor YiaJ is the
regulator protein acting in trans, single-copy fusions to
the lacZ reporter gene of serially deleted fragments were
obtained and introduced in the JA134 background. Twelve constructs were
analyzed in cultures grown aerobically in CAA, in both the presence and
absence of glucose. Figure 4 displays
only those relevant in this analysis. The shortest fusion expressing a
level of
-galactosidase activity similar to that of
(yiaK-lacZ) was
-148. Constructs
-114 and
-105,
partially affecting the Crp site 1, expressed
-galactosidase activities 60% lower than that of the full-length promoter
construction, whereas in construct
-93, from which the Crp site 1 had been completely deleted, the activity decreased 98%. In contrast,
construct
-50, which not only lacks the Crp site 1 but also affects
the AT-rich sequence and the IHF binding sites, yielded an activity higher than that of
-93, with a decrease of only 85% with respect to the control. Catabolite repression by glucose and partial reversion by cAMP were apparent for the cells bearing constructs like
-148,
-114, or
-105, which carry all or part of Crp site 1. No effect was seen with constructs
-93 and
-50, which lack Crp site 1. Deletion to position
17, affecting RNA polymerase binding, almost abolished promoter function.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion analysis of the yiaK-yiaJ promoter
region. A set of 5' deletions of the yiaK promoter was used
to generate transcriptional lacZ fusions on the ECL1 and
JA134 chromosome. The relevant regulatory elements of the
yiaK promoter are shown at the top. Indicated positions
correspond to the yiaK coding strand, whereas those
corresponding to the complementary yiaJ coding strand are in
parentheses. The 5' ends are marked by an arrow labeled +1. Upstream of
the start site of the yiaK-S operon the 10 and 35
consensus, high AT content region, IHF site, and Crp-binding sites are
located by the corresponding boxes. Deleted promoter fragments are
represented by lines, and the corresponding lacZ fusion is
labeled on the left. The 5' end of each deletion is indicated by the
position number to the left. -Galactosidase activity values are
indicated in the table to the right.
|
|
Single-copy fusions from

-148 to

-50 in the background of strain
ECL1, which expresses the repressor protein, showed no

-galactosidase activity, indicating that the regulator binding
site
is still present in

-50 (data not
shown).
Gel mobility shift assays.
Protein interactions with the
yiaK promoter region were assessed by gel mobility shift
experiments performed with a 269-bp fragment (positions
148 to +121,
labeled P269) belonging to the full-length promoter region. Experiments
performed with 10 µg of crude extracts of strain JA134, lacking the
repressor, displayed two retarded complexes (CI and CII in lane 3, Fig.
5A). No additional complexes were
observed with extracts of strain JA134 transformed with plasmid pJB1
(2), from which YiaJ was overexpressed (lane 2, Fig. 5A).
When a crude extract of strain JA184 was used, the CI complex
disappeared (lane 1, Fig. 5A), indicating that the formation of this
complex was dependent on the IHF binding.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 5.
Interactions of IHF, Crp, and YiaJ with different
fragments of the yiaK promoter region. The experiments were
performed with the following 32P-labeled probes: P269 (from
148 to +121), corresponding to the full-length region (A); P171 (from
50 to +121) (B); and P78 (from 148 to 70) (C). The migration
patterns of the different DNA-protein complexes are indicated (CI,
complex I; CII, complex II). (A) Complexes formed with extracts of
strain JA184 (lane 1), strain JA134 previously transformed with plasmid
pJB1 (lane 2), strain JA134 (lane 3), and no extract (lane 4). (B and
C) Complexes formed with crude extracts of strain JA134 (lanes 1),
strain JA134 previously transformed with plasmid pJB1 (lanes 2), strain
JA186 (lanes 3), strain JA187 (lanes 4), strain JA184 (lanes 5), and no
extract (lanes 6).
|
|
To determine the location of the fragment responsible for the repressor
binding, the total promoter region was split into
two parts: one from

50 to +121 (labeled P171) and the other from

148 to

70 (labeled
P78). Neither of the two fragments contained
the IHF site, whose
occupancy yielded a complex (CI) hiding the
other complexes formed by
binding of additional proteins. Analyses
with extracts of strain JA134
(lane 1 of Fig.
5B and C) or strain
JA134 overexpressing YiaJ (lane 2 of Fig.
5B and C) showed, in
fragment P171 but not in fragment P78, a
retarded complex corresponding
to the YiaJ repressor
binding.
The identity of the Crp-DNA complexes was approached attending to the
previous identification by sequence analysis of two
consensus sites for
Crp binding in the 269 promoter region. The
results presented in Fig.
5B and C show a shifted band with either
the P171 or P78 fragment when
crude extracts of strain JA134 (lanes
1) or strain JA184 (lanes 5) were
used. In contrast, the Crp-DNA
bands were absent when crude extracts of
Crp mutant strain JA186
(lanes 3) or Cya mutant strain JA187 (lanes 4)
were
used.
Search for inducers.
As for all genetic systems of unknown
function disclosed by the genome sequencing project, identification of
the substrate(s) or inducer(s) of the yiaK-S operon is a
priority subject. The similarity of these gene sequences and
organization to those of other known systems gives some clues for the
substrate-candidate structure. In this sense, a similar operon was
found in Haemophilus influenzae (6), and the
yiaO gene displayed high similarity to a periplasmic
solute-binding protein of Rhodobacter capsulatus (9) involved in the transport of dicarboxylates. The YiaJ
repressor was also found to have a high similarity to KdgR and Pir of
Erwinia chrysanthemi (27, 29), both involved in
pectin degradation and classified into the IclR family of regulator
proteins. On the other hand, the possibility of assaying candidate
inducers with a yiaK-S operon fusion prompted us to approach
their identification by using this technique.
Among 80 different compounds tested, only
L-fucose and
L-ascorbate resulted in modestly increased expression of

-galactosidase
activity (Table
2). No induction was seen with any of
the other
compounds, including pentoses, hexoses, other derivative
sugars,
mono- and dicarboxylate organic acids, and related compounds
listed
in Materials and Methods. The possibility of the presence of the
inducer in animal gut or lung mucus was explored by using rat
specimens
suspended in minimal medium and autoclaved. These solutions
were added
to CAA medium at a final concentration of 0.1%. No
induction of

-galactosidase activity was detected by growth in
any of these
cultures.
The sensitivity of the
yiaK-S operon to pH, temperature,
osmolarity, oxidative stress, growth phase, and nitrogen availability
was also tested. The selected cultures, at an
A600 of approximately
0.5, were shocked by
addition of NaCl to 0.3 M for osmotic studies
(
22) or
paraquat to 20 mM for oxidative stress studies (
30).
Heat
shock was performed by shifting the culture to 45°C. In these
experiments,

-galactosidase activity was assayed after 1 h. For
external pH regulation, cells were grown in CAA medium buffered
at pH
5.5 or 8.0 as described by Watson et al. (
38). For nitrogen
limitation, cultures were grown in 1 mM ammonium sulfate. None
of these
environmental conditions affected the expression of this
operon.
As described above, citrus fruit pectin or apple pectin previously
hydrolyzed by the action of pectinase did not affect the
expression of
the structural genes, even in the absence of repressor.
However, a 10- to 20-fold induction of

(
yiaJ-lacZ) was observed
only in
wild-type strain ECL1, but not in mutant strain JA134.
At present, we
do not know the significance of this
effect.
 |
DISCUSSION |
Three lines of evidence support the expression of the
yiaK-S gene cluster as a single mRNA transcribed from the
unique promoter found upstream of yiaK: (i) the presence of
full-length transcript in RNase E mutants, (ii) induction of
lacZ fusion only from the leading yiaK structural
gene, and (iii) polarity effects of
yiaK::Tn5 insertion mutation in the
yiaK-S transcription. Expression of this operon was
previously reported to be under the control of the repressor YiaJ.
Consistently, the DNA binding experiments showed that the repressor was
bound to a sequence present in promoter fragment P78 (position
50 to
+121). This repressor was found to be highly homologous to the IclR
family of regulators (32). The cis-acting element
recognized by E. coli IclR repressor was shown to be
AATTAAAATGGAAATTGTTTTTGATTTTGCATTTT (27),
and highly homologous sequences have been reported in E. chrysanthemi for other operator regions recognized by proteins of
this family, such as KdgR or Pir (27, 29). In the
yiaK-S promoter, the sequence
GTTAAAAAGTGATCGATATATTTGAAATCAAGTTT,
with many conserved positions (underlined), may also be
identified between positions
30 and +5, allowing us to propose it as
a putative binding site for the YiaJ repressor.
Our results indicate that the yiaK-S operon is regulated by
carbon sources. As shown, succinate increases and glucose reduces its
expression in the absence of the repressor. This promoter strongly
responds to glucose catabolite repression through the Crp site 1; in
contrast, the yiaJ promoter, which overlaps with the
yiaK-S promoter and is transcribed divergently from it,
responds to the same conditions with increased expression. The
mechanism for this yiaJ activation seems to be based on the
nonoccupancy of Crp site 1 by the Crp-cAMP complex, hence releasing the
obstruction to yiaJ transcription. In this way, catabolite
repression of yiaK-S expression is coordinately helped by
the increase in the repressor synthesis. In the absence of glucose,
Crp-cAMP complex binds to Crp site 1 activating yiaK-S
expression and obstructing the yiaJ-encoded repressor
expression and synthesis. In spite of the binding observed to Crp site
2, its function remains unknown.
Increased levels of
-galactosidase activity found in anaerobic
conditions were not Fnr dependent. The location of the Fnr site at
65.5, different from the
61.5 or
71.5 shown to be the correct
distance for activation function (39), may explain the inability of this site to control yiaK-S expression. In this
context, examples have been reported in which DNA supercoiling accounts for anaerobic increased expression (16). To study whether
this hypothesis applied to our promoter behavior, experiments in the presence of novobiocin were designed. The results indicate that novobiocin did not modify the expression pattern. At present, the
regulatory element responsible for this redox control has not been identified.
Sensitivity to IHF was probably due to DNA looping (11) to
close the distance between the RNA polymerase site and Crp site 1 or
other unidentified cis-acting elements. This effect would be
particularly favored by the presence of the AT-rich sequence located
between positions
77 and
87.
Up to now, we have been unable to identify the inducer molecule or the
conditions required for its induction. One possible explanation would
be that the system was a cryptic one activated by a mutation in strain
JA134, as proposed in our first report on L-xylulose kinase
identification (32). Nevertheless, the normal function of
the constitutive promoter and the weak induction by compounds such as
L-fucose or L-ascorbate seem to give support to
the hypothesis that the yiaK-S operon is normally functional and that the inducing conditions have yet to be found. In this sense,
it is of interest to stress that several experiments trying to
reproduce the physiological induction conditions have failed. The
possibility of mutations in the YiaJ repressor that impaired inducer
recognition without affecting DNA binding capacity cannot be ruled out.
These mutations would be hardly suppressible, since the recovery of the
recognition capacity would be quite unlikely.
Similarities of yiaK-S regulatory systems to KdgR and Pir
regulatory elements for the pel regulon in E. chrysanthemi (27, 29) open the possibility of a
parallel mechanism as a model for the regulation of these systems. In
E. chrysanthemi, the KdgR repressor induces pel
genes in response to 2-keto-3-deoxygluconate, and this induction is
reinforced by competition with Pir activator. In our case, YiaJ could
require the unknown inducing molecule and perhaps the collaboration of
another unidentified regulatory protein. Although YiaJ displays more
than 70% similarity with Pir, the former acts as a repressor, whereas
the latter acts as an activator. The mutation leading to this change in
the regulatory function of YiaJ could also be the molecular basis for
its inability to recognize the inducer molecule converting the
yiaK-S in a cryptic system. Further experiments are in
progress to confirm or rule out the crypticity of this genetic system.
 |
ACKNOWLEDGMENTS |
This work was supported by grant PB97-0920 from the
Dirección General de Enseñanza Superior e
Investigación Científica, Madrid, Spain, and partially by
the help of the "Comissionat per Universitats i Recerca de la
Generalitat de Catalunya." E.I. is the recipient of a predoctoral
fellowship from the Generalitat de Catalunya.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Bioquímica, Facultad de Farmacia, Universidad de Barcelona,
Avda. Diagonal 643, 08028 Barcelona, Spain. Phone: 34-93-403 44 96. Fax: 34-93-402 4520. E-mail:
jaguilar{at}farmacia.far.ub.es.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1987.
Current protocols in molecular biology.
Greene Publishing-Wiley Interscience, New York, N.Y.
|
| 2.
|
Badia, J.,
E. Ibañez,
M. Sabaté,
L. Baldomà, and J. Aguilar.
1998.
A rare 920-kilobase chromosomal inversion mediated by IS1 transposition causes constitutive expression of the yiaK-S operon for carbohydrate utilization in Escherichia coli.
J. Biol. Chem.
273:8376-8381[Abstract/Free Full Text].
|
| 3.
|
Belasco, J. G.,
T. Beatty,
C. W. Adams,
A. von Gabain, and S. N. Cohen.
1985.
Differential expression of photosynthesis genes in R. capsulata results from segmental differences in stability within the polycistronic rxcA transcript.
Cell
40:171-181[CrossRef][Medline].
|
| 4.
|
Boronat, A., and J. Aguilar.
1979.
Rhamnose-induced propanediol oxidoreductase in Escherichia coli: purification, properties, and comparison with the fucose-induced enzyme.
J. Bacteriol.
140:320-326[Abstract/Free Full Text].
|
| 5.
|
Bruijn, F. J., and J. R. Lupski.
1984.
The use of transposon Tn5 mutagenesis in the rapid generation of correlated physical and genetic maps of DNA segments cloned into multicopy plasmids.
Gene
27:131-149[CrossRef][Medline].
|
| 6.
|
De Rosa, R., and B. Labedan.
1998.
The evolutionary relationships between the two bacteria Escherichia coli and Haemophilus influenzae and their putative last common ancestor.
Mol. Biol. Evol.
15:17-27[Abstract].
|
| 7.
|
Ebright, R. H.,
Y. W. Ebright, and A. Gunasekera.
1989.
Consensus DNA site for the Escherichia coli catabolite gene activator protein (CAP): CAP exhibits a 450-fold higher affinity for the consensus DNA site than for the lac DNA site.
Nucleic Acids Res.
17:10295-10305[Abstract/Free Full Text].
|
| 8.
|
Elliot, T.
1992.
A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.
J. Bacteriol.
174:245-253[Abstract/Free Full Text].
|
| 9.
|
Golby, P.,
S. Davies,
D. J. Kelly,
J. R. Guest, and S. C. Andrews.
1999.
Identification and characterization of a two-component sensor-kinase and response-regulator system (DcuS-DcuR) controlling gene expression in response to C4-dicarboxylates in Escherichia coli.
J. Bacteriol.
181:1238-1248[Abstract/Free Full Text].
|
| 10.
|
Goodrish, J. A.,
M. L. Schwartz, and W. R. McClure.
1990.
Searching for and predicting the activity of sites for DNA binding proteins: compilations and analysis of the binding sites for Escherichia coli integration host factor (IHF).
Nucleic Acids Res.
18:4993-5000[Abstract/Free Full Text].
|
| 11.
|
Goosen, N., and P. van de Putte.
1995.
The regulation of transcription initiation by integration host factor.
Mol. Microbiol.
16:1-7[CrossRef][Medline].
|
| 12.
|
Granston, B. E., and H. A. Nash.
1993.
Characterization of a set of integration host factor mutants deficient for DNA binding.
J. Mol. Biol.
234:45-49[CrossRef][Medline].
|
| 13.
|
Holmes, D. S., and M. Quigley.
1981.
A rapid boiling method for the preparation of bacterial plasmids.
Anal. Biochem.
114:193-197[CrossRef][Medline].
|
| 14.
|
Ibáñez, E.,
R. Giménez,
T. Pedraza,
L. Baldomà,
J. Aguilar, and J. Badia.
2000.
Role of the yiaR and yiaS genes of Escherichia coli in metabolism of endogenously formed L-xylulose.
J. Bacteriol.
182:4625-4627[Abstract/Free Full Text].
|
| 15.
|
Iuchi, S.,
D. Furlong, and E. C. C. Lin.
1989.
Differentiation of arcA, arcB, and cpxA mutant phenotypes of Escherichia coli by sex pilus formation and enzyme regulation.
J. Bacteriol.
171:2889-2893[Abstract/Free Full Text].
|
| 16.
|
Jamieson, D. J., and C. F. Higgins.
1986.
Two genetically distinct pathways for transcriptional regulation of anaerobic gene expression in Salmonella typhimurium.
J. Bacteriol.
168:389-397[Abstract/Free Full Text].
|
| 17.
|
Koonin, E. V.,
R. L. Tatusov, and K. E. Rudd.
1995.
Sequence similarity analysis of Escherichia coli proteins: functional and evolutionary implications.
Proc. Natl. Acad. Sci. USA
92:11921-11925[Abstract/Free Full Text].
|
| 18.
|
Kumar, A.,
B. Grimes,
N. Fujita,
K. Makino,
R. A. Malloch,
R. S. Hayward, and A. Ishihama.
1994.
Role of the sigma70 subunit of Escherichia coli RNA polymerase in transcription activation.
J. Mol. Biol.
235:405-413[CrossRef][Medline].
|
| 19.
|
Lin, E. C. C.
1976.
Glycerol dissimilation and its regulation in bacteria.
Annu. Rev. Microbiol.
30:535-578[CrossRef][Medline].
|
| 20.
|
Lowry, O. H.,
N. J. Rosebrough,
A. L. Farr, and R. J. Randall.
1951.
Protein measurement with the Folin phenol reagent.
J. Biol. Chem.
193:265-275[Free Full Text].
|
| 21.
|
Lynch, A. S., and E. C. C. Lin.
1996.
Transcriptional control mediated by the ArcA two-component response regulator protein of Escherichia coli: characterization of DNA binding at target promoters.
J. Bacteriol.
178:6238-6249[Abstract/Free Full Text].
|
| 22.
|
Mellies, J.,
A. Wise, and M. Villarejo.
1995.
Two different Escherichia coli proP promoters respond to osmotic and growth phase signals.
J. Bacteriol.
177:144-151[Abstract/Free Full Text].
|
| 23.
|
Miller, J. H.
1992.
A short course in bacterial genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 24.
|
Moralejo, P.,
S. M. Egan,
E. Hidalgo, and J. Aguilar.
1993.
Sequencing and characterization of a gene cluster encoding the enzymes for L-rhamnose metabolism in Escherichia coli.
J. Bacteriol.
175:5585-5594[Abstract/Free Full Text].
|
| 25.
|
Mozola, M. A., and D. I. Friedman.
1985.
A phi 80 function inhibitory for growth of lamboid phage in him mutants of Escherichia coli deficient in IHF. Genetic analysis of the Rha phenotype.
Virology
140:313-327[CrossRef][Medline].
|
| 26.
|
Mudd, E. A.,
H. M. Krisch, and C. F. Higgins.
1990.
RNAseE, an endoribonuclease, has a general role in the chemical decay of Escherichia coli mRNA: evidence that rne and ams are the same genetic locus.
Mol. Microbiol.
4:2127-2135[Medline].
|
| 27.
|
Nomura, K.,
W. Nasser,
H. Kawaghishi, and S. Tsuyumu.
1998.
The pir gene of Erwinia chrysanthemi EC16 regulates hyperinduction of pectate lyase virulence genes in response to plant signals.
Proc. Natl. Acad. Sci. USA
95:14034-14039[Abstract/Free Full Text].
|
| 28.
|
Nunoshiba, T.,
E. Hidalgo,
C. F. Amábile-Cuevas, and B. Demple.
1992.
Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene.
J. Bacteriol.
174:6054-6060[Abstract/Free Full Text].
|
| 29.
|
Reverchon, S.,
W. Nasser, and J. Robert-Baudouy.
1991.
Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation.
Mol. Microbiol.
5:2203-2216[Medline].
|
| 30.
|
Rocha, E. D., and C. J. Smith.
1997.
Regulation of Bacteroides fragilis katB mRNA by oxidative stress and carbon limitation.
J. Bacteriol.
179:7033-7039[Abstract/Free Full Text].
|
| 31.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 32.
|
Sanchez, J. C.,
R. Gimenez,
A. Schneider,
W.-D. Fessner,
L. Baldomà,
J. Aguilar, and J. Badia.
1994.
Activation of a cryptic gene encoding a kinase for L-xylulose opens a new pathway for the utilization of L-lyxose by Escherichia coli.
J. Biol. Chem.
269:29665-29669[Abstract/Free Full Text].
|
| 33.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 34.
|
Sawers, G.,
M. Kaiser,
A. Sirko, and M. Freundich.
1997.
Transcriptional activation by FNR and CRP: reciprocity of binding-site recognition.
Mol. Microbiol.
23:835-845[CrossRef][Medline].
|
| 35.
|
Simons, R. W.,
F. Houman, and N. Kleckner.
1987.
Improved single and multicopy lac-based cloning vectors for protein and operon fusions.
Gene
53:85-96[CrossRef][Medline].
|
| 36.
|
Sofia, H. J.,
V. Burland,
D. L. Daniels,
G. Plunkett, and F. R. Blattner.
1994.
Analysis of the Escherichia coli genome. V. DNA sequence of the region from 76.0 to 81.5 minutes.
Nucleic Acids Res.
22:2576-2586[Abstract/Free Full Text].
|
| 37.
|
Spiro, S., and J. R. Guest.
1987.
Regulation and over expression of the fnr gene of Escherichia coli.
J. Gen. Microbiol.
133:3279-3288[Abstract/Free Full Text].
|
| 38.
|
Watson, N.,
D. S. Dunyak,
E. L. Rosey,
J. L. Slonczewski, and E. R. Olson.
1992.
Identification of elements involved in transcriptional regulation of the Escherichia coli cad operon by external pH.
J. Bacteriol.
174:530-540[Abstract/Free Full Text].
|
| 39.
|
Wing, H. J.,
S. M. Williams, and S. J. W. Busby.
1995.
Spacing requirements for transcription activation by Escherichia coli FNR protein.
J. Bacteriol.
177:6704-6710[Abstract/Free Full Text].
|
Journal of Bacteriology, August 2000, p. 4617-4624, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Campos, E., de la Riva, L., Garces, F., Gimenez, R., Aguilar, J., Baldoma, L., Badia, J.
(2008). The yiaKLX1X2PQRS and ulaABCDEFG Gene Systems Are Required for the Aerobic Utilization of L-Ascorbate in Klebsiella pneumoniae Strain 13882 with L-Ascorbate-6-Phosphate as the Inducer. J. Bacteriol.
190: 6615-6624
[Abstract]
[Full Text]
-
Campos, E., Montella, C., Garces, F., Baldoma, L., Aguilar, J., Badia, J.
(2007). Aerobic L-ascorbate metabolism and associated oxidative stress in Escherichia coli. Microbiology
153: 3399-3408
[Abstract]
[Full Text]
-
Rollenhagen, C., Bumann, D.
(2006). Salmonella enterica Highly Expressed Genes Are Disease Specific. Infect. Immun.
74: 1649-1660
[Abstract]
[Full Text]
-
Thomas, G. H., Southworth, T., Leon-Kempis, M. R., Leech, A., Kelly, D. J.
(2006). Novel ligands for the extracellular solute receptors of two bacterial TRAP transporters. Microbiology
152: 187-198
[Abstract]
[Full Text]
-
Plantinga, T. H., van der Does, C., Tomkiewicz, D., van Keulen, G., Konings, W. N., Driessen, A. J. M.
(2005). Deletion of the yiaMNO transporter genes affects the growth characteristics of Escherichia coli K-12. Microbiology
151: 1683-1689
[Abstract]
[Full Text]
-
Forouhar, F., Lee, I., Benach, J., Kulkarni, K., Xiao, R., Acton, T. B., Montelione, G. T., Tong, L.
(2004). A Novel NAD-binding Protein Revealed by the Crystal Structure of 2,3-Diketo-L-gulonate Reductase (YiaK). J. Biol. Chem.
279: 13148-13155
[Abstract]
[Full Text]
-
Campos, E., Baldoma, L., Aguilar, J., Badia, J.
(2004). Regulation of Expression of the Divergent ulaG and ulaABCDEF Operons Involved in L-Ascorbate Dissimilation in Escherichia coli. J. Bacteriol.
186: 1720-1728
[Abstract]
[Full Text]
-
Campos, E., Aguilar, J., Baldoma, L., Badia, J.
(2002). The Gene yjfQ Encodes the Repressor of the yjfR-X Regulon (ula), Which Is Involved in L-Ascorbate Metabolism in Escherichia coli. J. Bacteriol.
184: 6065-6068
[Abstract]
[Full Text]
-
Zhang, R.-g., Kim, Y., Skarina, T., Beasley, S., Laskowski, R., Arrowsmith, C., Edwards, A., Joachimiak, A., Savchenko, A.
(2002). Crystal Structure of Thermotoga maritima 0065, a Member of the IclR Transcriptional Factor Family. J. Biol. Chem.
277: 19183-19190
[Abstract]
[Full Text]
-
Yew, W. S., Gerlt, J. A.
(2002). Utilization of L-Ascorbate by Escherichia coli K-12: Assignments of Functions to Products of the yjf-sga and yia-sgb Operons. J. Bacteriol.
184: 302-306
[Abstract]
[Full Text]