Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4640-4643, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Developmental Regulation of the Cell Division
Protein FtsZ in Anabaena sp. Strain PCC 7120, a
Cyanobacterium Capable of Terminal Differentiation
Isabelle
Kuhn,1
Ling
Peng,2
Sylvie
Bedu,3 and
Cheng-Cai
Zhang1,3,*
Unité d'Immuotechnologie et
Microbiologie Moléculaire, Ecole Supérieure de
Biotechnologie de Strasbourg, Université Louis Pasteur de
Strasbourg, 67400 Illkirch,1 and AFMB
(UPR9039)2 and Laboratoire de Chimie
Bactérienne (UPR9043),3 CNRS, 13402 Marseille cedex 20, France
Received 7 February 2000/Accepted 5 May 2000
 |
ABSTRACT |
Heterocysts are terminally differentiated cells devoted to nitrogen
fixation in the filamentous cyanobacterium Anabaena sp. strain PCC 7120. We show here that the cell division protein FtsZ is
present in vegetative cells but undetectable in heterocysts. These
results provide a first rational explanation for the inability of
mature heterocysts to undergo cell division.
| |
TEXT |
The relationship between cell
division and cell differentiation is a complex problem in biology. The
decision of a specific cell to continue proliferation or instead to
arrest at a given time during a cell cycle in order to commit itself to
differentiate depends on the interaction between the cell and its
surrounding environment. Once a cell becomes competent and committed to
differentiate, differential gene expression and protein localization
must be involved in order to ensure the cell fate determination.
Generally in both eukaryotes and prokaryotes, a differentiating cell,
once fully committed, stops cell division (6). Forcing
ectopic cell division can affect morphogenesis either by interfering
with terminal differentiation or through an inappropriate increase in
cell number (1, 9). Similarly in Anabaena sp.
strain PCC 7120, a cell division arrest is also observed for
differentiated cells (24). Anabaena sp. strain
PCC 7120 is a filamentous cyanobacterium capable of developing
specialized cells, called heterocysts, devoted to nitrogen fixation.
Heterocyst differentiation is induced upon the depletion of a
combined-nitrogen source in the growth medium, and only 1 in every 10 to 20 cells along each filament can become heterocysts, which are
arranged in a semiregular and one-dimensional pattern (4, 25,
26). Developing proheterocysts may regress under certain
conditions, but mature heterocysts no longer divide (24).
The growth of a filament is thus ensured only by vegetative cells which
retain the ability to divide.
It is not known what makes heterocysts lose the competence for cell
division, nor is it clear if cell division arrest is a necessary
prelude to heterocyst differentiation. Heterocysts have a thick
envelope consisting of an inner layer of glycolipids and an outer layer
of polysaccharide (25). The structure of heterocyst envelope
may eventually provide a physical constraint for cell division.
Alternatively, the arrest of cell division accompanying heterocyst
differentiation involves differential regulation of gene expression and
enzymatic activities. To gain insight into these questions, we started
to investigate the regulation of cell division during heterocyst
development. One key element in bacterial division is the GTPase FtsZ,
the earliest known element acting on bacterial cell cycle. Upon GTP
hydrolysis, FtsZ polymerizes to form a ring structure attached to the
membrane through ZipA at the midpoint of a dividing cell and recruits
other cell division elements to form the septum (for recent reviews,
see references 3, 14, 17, and
22). FtsZ is found in almost all bacteria, Chlamydia trachomatis being the only known exception. It is
also present in plant chloroplasts. The FtsZ protein from
Anabaena sp. strain PCC 7120 (referred to as
FtsZAna hereafter) has been shown to be highly similar to
those found in other bacteria (5, 29). In this study, we
demonstrate that FtsZAna is undetectable in heterocysts,
providing a rational explanation for the inability of mature
heterocysts to undergo cell division.
Overexpression of FtsZIAna in Escherichia
coli disrupts septum formation.
The
ftsZAna coding region was amplified by PCR with
sense (CCGGAATTCCATATGACACTTGATAATAA) and antisense
(GCGGGATCCTTAATTTTTGGGTGGTC) primers. The PCR product was
cloned into the pET15b vector (Novagen) and transformed into the
E. coli host BL21 for the overproduction of
FtsZAna. The expected recombinant FtsZ from this construct would have a His tag attached to its N-terminal end. After induction for 3 h with 0.4 mM
isopropyl-
-D-thiogalactopyranoside (IPTG), a major
protein band with an estimated molecular mass of about 50 kDa was
induced (Fig. 1). The molecular mass of
this protein was close to that calculated from the
His-FtsZAna fusion (47 kDa).
View larger version (115K):
[in this window]
[in a new window]
|
FIG. 1.
Production and purification of recombinant
FtsZAna from E. coli. E. coli BL21 transformed
with pET15b overexpressing FtsZAna was grown to an optical
density of 0.5 at 600 nm (lane 1) and then induced by 0.4 mM IPTG (lane
2). Soluble proteins from induced cells were loaded onto a His tag
affinity column. The flowthrough fraction is shown in lane 3. The
column was washed once (lane 4), and then the retained fraction was
eluted (lane 5). M, protein molecular weight standard (positions shown
in kilodaltons at the right).
|
|
The
E. coli host strain became filamentous in the presence
of the overexpressed FtsZ
Ana after growth at 37°C for
7 h (Fig.
2). The
E. coli
filaments had no visible septum. The filamentation
phenotype of the
E. coli host depended on the concentration of
IPTG. Without
IPTG as an inducer, cells appeared normal. When
incubated for 7 h
at 37°C with 0.002 mM IPTG, cells were slightly
elongated, with short
filaments twice the size of normal cells.
When IPTG was added at 0.008 mM or above, cells became fully filamentous.
A similar phenotype has
been found in
E. coli when its endogenous
FtsZ protein was
overexpressed (
23). These results indicated
that the
presence of FtsZ
Ana at a high concentration interfered
with
the cell division process in
E. coli. A similar observation
was made when
ftsZ from
Rhizobium meliloti was
expressed in
E. coli (
15).
View larger version (155K):
[in this window]
[in a new window]
|
FIG. 2.
Filamentation phenotype of E. coli caused by
overexpression of FtsZAna. E. coli BL21
transformed with pET15b overexpressing FtsZAna was grown
for 7 h in LB medium in the absence (A) or presence (B) of 0.4 mM
IPTG as an inducer.
|
|
GTPase activity of recombinant FtsZAna.
For
purification of the recombinant FtsZAna, E. coli
host cells were collected by centrifugation, disrupted by sonication, and loaded on a His tag affinity column (Pharmacia) as instructed by
the supplier (Fig. 1). The eluted protein, with apparent homogeneity (Fig. 1), was further dialyzed against a buffer consisting of 50 mM
HEPES (pH 7.2), 0.1 mM EDTA, and 10% glycerol. For the GTPase assay,
recombinant FtsZAna (0.125 mg/ml) was incubated at 37°C in a solution containing 1 mM GTP, 5 mM MgCl2, 50 mM Tris
(pH 7.2), 50 mM KCl, and 5% glycerol (16). Samples were
withdrawn at different time points and analyzed by high-performance
liquid chromatography (HPLC). As shown in Fig.
3, GDP appeared over time at the expense
of GTP. Only a basal level of GDP was observed when GTP was incubated
without FtsZAna or with FtsZAna inactivated at
100°C for 15 min. This is the first cyanobacterial FtsZ shown to have
a GTPase activity.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 3.
GTPase activity of FtsZAna detected by HPLC
on an ion-exchange column (Partisil 10; Waters). Samples were eluted
with 0.8 M KH2PO4 (pH 2.6) at a flow rate of 1 ml/min. (A) Identification of nucleotides in a mixture of authentic
GMP, GDP, and GTP. (B) GTP was incubated for 2 h with
FtsZAna previously heated at 100°C for 15 min. (C) GTP
was incubated with FtsZAna for 0 min (top), 60 min
(middle), or 120 min (bottom).
|
|
It has been reported that 3-methoxybenzamide (3-MBA), an inhibitor of
ADP-ribosyltransferase, induces cell filamentation in
Bacillus
subtilis, and this phenotype could be suppressed by a
mutation in
the
ftsZ gene (
18). Since it is conceivable that
3-MBA acts directly on FtsZ, we tested the possibility of this
drug as
a GTPase inhibitor of FtsZ
Ana. Under our assay conditions,
3-MBA up to a concentration of 5 mM had no significant effect
on the
GTPase activity of FtsZ
Ana in vitro. 3-MBA at a
concentration
of 5 mM had an inhibitory effect on the growth ability of
Anabaena sp. strain PCC 7120, but septum formation was not
affected (data
not
shown).
Immunodetection of FtsZAna during heterocyst
development.
The purified recombinant FtsZAna (Fig. 1)
was used as an antigen to produce polyclonal antibodies from a rabbit.
The specificity of the antibodies was controlled by immunoblotting with
protein lysate from Anabaena sp. strain PCC 7120 prepared as
described previously (30), and the recombinant
FtsZAna was purified from an E. coli
overexpressing strain. The results of this experiment are shown in Fig.
4. A band of 47 kDa was revealed from
Anabaena sp. strain PCC 7120 (Fig. 4, lane 2). The size of
this signal correlates well with the theoretical molecular weight of
FtsZAna, as well as that of the purified recombinant
FtsZAna antigen detected on the same blot (lane 1).
View larger version (69K):
[in this window]
[in a new window]
|
FIG. 4.
Detection of FtsZAna by immunoblotting.
Purified FtsZAna produced from E. coli (lane 1)
and protein lysate from Anabaena sp. strain PCC 7120 (lane
2) were immunodetected with a serum raised against the recombinant
FtsZAna. Immunodetection was carried out as described
elsewhere (30). Sizes are indicated in kilodaltons.
|
|
To determine whether the amount of FtsZ changes during heterocyst
development, a 500-ml culture of
Anabaena sp. strain PCC
7120 was grown to an optical density of 0.5 at 700 nm in
nitrate-containing
BG11 medium (
21) and then transferred to
combined nitrogen-free
medium BG11
0 to induce heterocyst
development (
28); 60-ml aliquots
of cells were collected at
different time points from 10 min to
3 days after induction to make
protein preparations. After protein
separation by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis,
similar amounts of
FtsZ
Ana were detected in all protein samples
by
immunoblotting (data not shown). These results suggested that
the
overall amount of FtsZ
Ana was little changed in filaments
induced to differentiate heterocysts. As in
E. coli
(
19), most
FtsZ
Ana was found in the soluble
fraction in
Anabaena sp. strain
PCC 7120 (data not
shown).
Cell-type-specific localization of FtsZAna.
Since
heterocysts represent only 5 to 10% of all cells under nitrogen-fixing
conditions (4, 25, 26), immunodetection of
FtsZAna with proteins prepared from total filaments could
not determine whether FtsZAna displayed a differential
pattern of regulation in heterocysts compared to vegetative cells.
Therefore, a heterocyst preparation was made by treating filaments by
lysozyme followed by weak sonication (8). Under such
conditions, most vegetative cells were lysed to give vegetative
proteins, while heterocysts were resistant due to its thick cell wall.
Short and repetitive sonications were performed to eliminate vegetative cells as much as possible. Total proteins from purified heterocysts were extracted. Similar amounts of proteins from total filaments, heterocysts, and vegetative cells were separated by electrophoresis and
blotted with anti-FtsZAna antibodies. The results of the
immunodetection experiments indicated that FtsZAna was
undetectable in protein preparations from heterocyst fractions, while
it was detected strongly in total cells (heterocysts plus vegetative
cells) in similar amount as in vegetative cells (Fig. 5). This detected protein showed a molecular weight similar to that of the recombinant FtsZAna detected on the same blot (data not shown). A
similar pattern of protein localization was found with polyclonal
antibodies against RbcL (12), the larger subunit of
ribulose-1,5-bisphosphate carboxylase, a well-established element
specifically localized in vegetative cells (7, 27). Another
polyclonal antibody against NifD, the dinitrogenase 
subunit known
to be present only in heterocysts (7, 27), was also used in
this experiment. Consistent with the fact that NifD is heterocyst
specific, the immunodetection experiment revealed a signal of high
intensity in heterocyst proteins, a signal of low intensity in total
filaments, and no signal in vegetative cells (Fig.
5).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 5.
Cell-type-specific localization of FtsZAna
in Anabaena sp. strain PCC 7120. Proteins were prepared from
total filaments (lane 1), heterocysts (lane 2), or vegetative cells
(lane 3). Similar amounts of proteins were loaded onto each lane.
Immunodetection was carried out as described elsewhere (30)
with a polyclonal antibody against FtsZAna, RbcL of
Nicotiana sylvestris (12), or NifD of
Rhodospirillum rubrum (kindly provided by P. W. Ludden,
University of Wisconsin), as indicated. The position of each detected
antigen is indicated by an arrow; sizes are indicated in kilodaltons.
|
|
From these results, we conclude that FtsZ is a vegetative-cell-specific
element in
Anabaena sp. strain PCC 7120. Our results
correlate with the fact that heterocysts are terminally differentiated
cells; they also indicate that the inability of heterocysts to
undergo
division is not simply due to a physical constraint of
the thick
heterocyst cell wall but rather is a result of an actively
regulated
process.
Sporulation in
B. subtilis involves asymmetrically localized
septum, and a switch of FtsZ location from medial to polar is
one of
the earliest signs of sporulation. In this organism, FtsZ
polar
localization is regulated by elements directly involved
in sporulation
(
2,
11,
13). Although no asymmetrical septum
formation has
been observed at the onset of heterocyst formation
in
Anabaena sp. strain PCC 7120, cell-type-specific
localization
of FtsZ observed in the present study is likely to be
regulated
by some elements involved in heterocyst development. It has
been
shown in another developmental bacterium,
Caulobacter
crescentus,
that FtsZ is found in the stalk cell and absent in the
swarmer
cell immediately after division and before the latter
differentiates
to a stalk cell. This cell-type-specific localization is
the result
of both transcriptional and proteolytic regulations of FtsZ
(
10,
20). Similar regulatory mechanisms could account for
the cell-type-specific
localization of FtsZ in
Anabaena sp.
strain PCC 7120. FtsZ is
thus likely to provide a control point for the
coordination between
cell division and cell
differentiation.
| |
ACKNOWLEDGMENTS |
We thank P. Ludden (University of Wisconsin) for anti-Nif
antibodies and C. Fleck (CNRS, Strasbourg, France) for anti-RuBisCO antibodies.
This work was supported by the French Ministère de l'Education
Nationale, de la Recherche et de la Technologie and CNRS.
| |
FOOTNOTES |
*
Corresponding author. Present address: Laboratoire de
Chimie Bactérienne, CNRS, 31 chemin Joseph Aiguier, 13402 Marseille cedex 20, France. Phone: (33) 4 91164096. Fax: (33) 4 91718914. E-mail: cczhang{at}ibsm.cnrs-mrs.fr.
| |
REFERENCES |
| 1.
|
Asano, M.,
J. R. Nevins, and R. P. Wharton.
1996.
Ectopic E2F expression induces S phase and apoptosis in Drosophila imaginal discs.
Genes Dev.
10:1422-1432[Abstract/Free Full Text].
|
| 2.
|
Beall, B., and J. Lutkenhaus.
1991.
FtsZ in Bacillus subtilis is required for vegetative septation and for asymmetric septation during sporulation.
Genes Dev.
5:447-455[Abstract/Free Full Text].
|
| 3.
|
Bramhill, D.
1997.
Bacterial cell division.
Annu. Rev. Cell Dev. Biol.
13:395-424[CrossRef][Medline].
|
| 4.
|
Buikema, W. J., and R. Haselkorn.
1993.
Molecular genetics of cyanobacterial development.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
44:33-52[CrossRef].
|
| 5.
|
Doherty, H. M., and D. G. Adams.
1995.
Cloning and sequence of ftsZ and flanking regions from the cyanobacterium Anabaena PCC 7120.
Gene
163:93-96[CrossRef][Medline].
|
| 6.
|
Edgar, B. A., and C. F. Lehner.
1996.
Developmental control of cell cycle regulators: a fly's perspective.
Science
274:1646-1652[Abstract/Free Full Text].
|
| 7.
|
Elhai, J., and C. P. Wolk.
1990.
Developmental regulation and spatial pattern of expression of the structural genes for nitrogenase in the cyanobacterium Anabaena.
EMBO J.
9:3379-3388[Medline].
|
| 8.
|
Golden, J. W.,
S. J. Robinson, and R. Haselkorn.
1985.
Rearrangement of nitrogen fixation genes during heterocyst differentiation in the cyanobacterium Anabaena.
Nature
314:419-423[CrossRef][Medline].
|
| 9.
|
Karim, F. D., and G. M. Rubin.
1998.
Ectopic expression of activated Ras1 induces hyperplastic growth and increased cell death in Drosophila imaginal tissues.
Development
125:1-9[Abstract].
|
| 10.
|
Kelly, A. J.,
M. J. Sackett,
N. Din,
E. Quardokus, and Y. V. Brun.
1998.
Cell cycle-dependent transcriptional and proteolytic regulation of FtsZ in Caulobacter.
Genes Dev.
12:880-893[Abstract/Free Full Text].
|
| 11.
|
Khvorova, A.,
L. Zhang,
M. L. Higgins, and P. J. Piggot.
1998.
The spoIIE in involved in the Spo0A-dependent switch in the location of FtsZ rings in Bacillus subtilis.
J. Bacteriol.
180:1256-1260[Abstract/Free Full Text].
|
| 12.
|
Lett, M.-C.,
J. Fleck,
C. Fritsch,
A. Durr, and L. Hirth.
1980.
Suitable conditions for characterization, identification, and isolation of the mRNA of the small subunit of ribulose-1,5-biphosphate carboxylase from Nicotiana sylvestris.
Planta
148:211-216[CrossRef].
|
| 13.
|
Levin, P. A., and R. Losick.
1996.
Transcription factor Spo0A switches the localization of the cell division protein FtsZ from a medial to a bipolar pattern in Bacillus subtilis.
Genes Dev.
10:478-488[Abstract/Free Full Text].
|
| 14.
|
Lutkenhaus, J., and S. G. Addinall.
1997.
Bacterial cell division and the Z ring.
Annu. Rev. Biochem.
66:93-116[CrossRef][Medline].
|
| 15.
|
Margolin, W.,
J. C. Corbo, and S. R. Long.
1991.
Cloning and characterization of a Rhizobium meliloti homolog of the Escherichia coli cell division gene ftsZ.
J. Bacteriol.
173:5822-5830[Abstract/Free Full Text].
|
| 16.
|
Mukherjee, A., and J. Lutkenhaus.
1998.
Dynamic assembly of FtsZ regulated by GTP hydrolysis.
EMBO J.
17:462-469[CrossRef][Medline].
|
| 17.
|
Nanninga, N.
1998.
Morphogenesis of Escherichia coli.
Microbiol. Mol. Biol. Rev.
62:110-129[Abstract/Free Full Text].
|
| 18.
|
Ohashi, Y.,
Y. Chijiwa,
K. Suzuki,
K. Takahashi,
H. Nanamiya,
T. Sato,
Y. Hosoya,
K. Ochi, and F. Kawamura.
1999.
The lethal effect of a benzamide derivative, 3-methoxybenzamide, can be suppressed by mutations within a cell division gene, ftsZ, in Bacillus subtilis.
J. Bacteriol.
181:1348-1351[Abstract/Free Full Text].
|
| 19.
|
Pla, J.,
P. Sanchez,
P. Palacios,
M. Vincente, and M. Aldea.
1991.
Preferential cytoplasmic location of FtsZ, a protein essential for Escherichia coli septation.
Mol. Microbiol.
5:1681-1686[Medline].
|
| 20.
|
Quardokus, E.,
N. Din, and Y. V. Brun.
1996.
Cell cycle regulation and cell type-specific localization of the FtsZ division initiation protein in Caulobacter.
Proc. Natl. Acad. Sci. USA
93:6314-6319[Abstract/Free Full Text].
|
| 21.
|
Rippka, R.,
J. Deruelles,
J. B. Waterbury,
M. Herdman, and R. Y. Stanier.
1979.
Generic assignments, strain histories and properties of pure cultures of cyanobacteria.
J. Gen. Microbiol.
111:1-61.
|
| 22.
|
Rothfield, L. I., and S. S. Justice.
1997.
Bacterial cell division: the cycle of the ring.
Cell
88:581-584[CrossRef][Medline].
|
| 23.
|
Ward, J. E., Jr., and J. Lutkenhaus.
1985.
Overproduction of FtsZ induces minicell formation in E. coli.
Cell
42:941-949[CrossRef][Medline].
|
| 24.
|
Wilcox, M.,
G. J. Mitchison, and R. J. Smith.
1973.
Pattern formation in the blue-green alga Anabaena. II. Controlled proheterocyst regression.
J. Cell Sci.
13:637-649[Abstract/Free Full Text].
|
| 25.
|
Wolk, C. P.,
A. Ernst, and J. Elhai.
1994.
Heterocyst metabolism and development, p. 769-823.
In
D. F. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Norwell, Mass.
|
| 26.
|
Wolk, C. P.
1996.
Heterocyst formation.
Annu. Rev. Genet.
30:59-78[CrossRef][Medline].
|
| 27.
|
Yoon, H.-S., and J. W. Golden.
1998.
Heterocyst pattern formation controlled by a diffusible peptide.
Science
282:935-938[Abstract/Free Full Text].
|
| 28.
|
Zhang, C.-C.
1993.
A gene encoding a protein related to eukaryotic protein kinases from the filamentous heterocystous cyanobacterium Anabaena PCC 7120.
Proc. Natl. Acad. Sci. USA
90:11840-11844[Abstract/Free Full Text].
|
| 29.
|
Zhang, C.-C.,
S. Huguenin, and A. Friry.
1995.
Analysis of genes encoding the cell division protein FtsZ and a glutathione synthetase homologue in the cyanobacterium Anabaena PCC 7120.
Res. Microbiol.
146:445-455[Medline].
|
| 30.
|
Zhang, C.-C., and L. Libs.
1998.
Cloning and characterisation of the pknD gene encoding an eukaryotic type protein kinase in the cyanobacterium Anabaena sp. PCC 7120.
Mol. Gen. Genet.
258:26-33[CrossRef][Medline].
|
Journal of Bacteriology, August 2000, p. 4640-4643, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, J.-Y., Chen, W.-L., Zhang, C.-C.
(2009). hetR and patS, two genes necessary for heterocyst pattern formation, are widespread in filamentous nonheterocyst-forming cyanobacteria. Microbiology
155: 1418-1426
[Abstract]
[Full Text]
-
Sakr, S., Thyssen, M., Denis, M., Zhang, C.-C.
(2006). Relationship among Several Key Cell Cycle Events in the Developmental Cyanobacterium Anabaena sp. Strain PCC 7120.. J. Bacteriol.
188: 5958-5965
[Abstract]
[Full Text]
-
Sakr, S., Jeanjean, R., Zhang, C.-C., Arcondeguy, T.
(2006). Inhibition of Cell Division Suppresses Heterocyst Development in Anabaena sp. Strain PCC 7120. J. Bacteriol.
188: 1396-1404
[Abstract]
[Full Text]
-
Wang, Y., Xu, X.
(2005). Regulation by hetC of Genes Required for Heterocyst Differentiation and Cell Division in Anabaena sp. Strain PCC 7120. J. Bacteriol.
187: 8489-8493
[Abstract]
[Full Text]
-
Koksharova, O. A., Wolk, C. P.
(2002). A Novel Gene That Bears a DnaJ Motif Influences Cyanobacterial Cell Division. J. Bacteriol.
184: 5524-5528
[Abstract]
[Full Text]
-
Holtzendorff, J., Partensky, F., Jacquet, S., Bruyant, F., Marie, D., Garczarek, L., Mary, I., Vaulot, D., Hess, W. R.
(2001). Diel Expression of Cell Cycle-Related Genes in Synchronized Cultures of Prochlorococcus sp. Strain PCC 9511. J. Bacteriol.
183: 915-920
[Abstract]
[Full Text]
Top
Abstract
Text
