Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4647-4653, Vol. 182, No. 16
Department of Biotechnology, Graduate School
of Agriculture and Life Sciences, The University of Tokyo,
Bunkyo-ku, Tokyo 113-8657, Japan
Received 13 April 2000/Accepted 30 May 2000
In Streptomyces griseus, A-factor
(2-isocapryloyl-3R-hydroxymethyl- The filamentous, soil-inhabiting,
gram-positive bacterial genus Streptomyces is characterized
by the ability to produce a wide variety of secondary metabolites and
by complex morphological differentiation culminating in sporulation
(5). In Streptomyces griseus, A-factor
(2-isocapryloyl-3R-hydroxymethyl- Exo-oligoribonuclease activity of Orf1.
Orf1 shows high
sequence similarity (44% identity) to the oligoribonuclease of
E. coli (31). Figure
1A shows amino acid alignment of Orf1 and
homologues in prokaryotes and eukaryotes. We examined oligoribonuclease
activity of Orf1 by using ApCpC[32P]pC (as a substrate)
and histidine-tagged Orf1 produced in E. coli, essentially
by the method of Ghosh and Deutscher (9). The expression
plasmid pET-ORNA was constructed and histidine-tagged Orf1 was purified
as follows. With two oligonucleotides,
5' - GGCGAAT TCATATGAACGACCGCATGGTGTGG - 3'
(the italic and bold letters indicate an NdeI
cleavage sequence for cloning into pET16b and the initiation codon of
orf1, respectively; the underline indicates an
EcoRI cleavage sequence) and
5'-CGCGGATCCTACGGTGCGGCCGGAGCCGAC-3' (the bold letters indicate the termination codon of
orf1, and the underline indicates a BamHI
cleavage sequence), the orf1 sequence was amplified by PCR.
The amplified fragment was digested with EcoRI and
BamHI and cloned between the EcoRI and
BamHI sites on pUC19. After the sequence was checked by
sequencing, an NdeI-BamHI fragment was excised
from the recombinant plasmid and ligated with NdeI-plus-
BamHI-digested pET16b, resulting in pET-ORNA. The
histidine-tagged Orf1 encoded by pET-ORNA had a structure of
Met-Gly-His10-Ser2-Gly-His-Ile-Glu-Gly-Arg-His-Orf1.
For purification of His-tagged Orf1, E. coli BL21(DE3)
harboring pET-ORNA was cultured overnight at 37°C without
isopropyl-
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
An Oligoribonuclease Gene in
Streptomyces griseus
ABSTRACT
Top
Abstract
Text
References
-butyrolactone) serves
as a microbial hormone that switches on many genes required for
streptomycin production and morphological development. An open reading
frame (Orf1) showing high sequence similarity to oligoribonucleases of
various origins is present just downstream of adpA, one of
the A-factor-dependent genes. Orf1 was named OrnA (oligoribonuclease A)
because it showed 3'-to-5' exo-oligoribonuclease activity, releasing
[32P]CMP from ApCpC[32P]pC used as a
substrate. Reverse transcription-PCR and S1 nuclease mapping analyses
revealed that ornA was transcribed from two promoters; one
was a developmentally regulated, A-factor-dependent promoter in front
of adpA, and the other was a constitutive promoter in front
of the ornA coding sequence. Transcription of
ornA was thus additively enhanced at the initiation stage
for secondary metabolism and aerial mycelium formation.
ornA-disrupted strains grew slowly and scarcely formed
aerial mycelium. ornA homologues were distributed in a wide
variety of Streptomyces species, including S. coelicolor A3(2), as determined by Southern hybridization
analysis. Disruption of the ornA homologue in S. coelicolor A3(2) also caused phenotypes similar to those of the
S. griseus 
ornA strains. The OrnA oligoribonucleases in
Streptomyces species are therefore not essential but play
an important role in vegetative growth and in the initiation of differentiation.
TEXT
Top
Abstract
Text
References
-butyrolactone) is
required for streptomycin (Sm) production and cell differentiation (13-15). A-factor at an extremely low concentration
triggers Sm production and aerial mycelium formation by binding a
repressor-type receptor protein (ArpA) and dissociating it from the DNA
(23, 24). Recently we identified adpA, which
encodes a transcriptional activator for strR, a
pathway-specific regulatory gene responsible for transcription of other
Sm biosynthetic genes, as one of the target genes of ArpA
(22). ArpA binds the adpA promoter and represses
its transcription in the absence of A-factor during early growth phase.
adpA is thus developmentally regulated by A-factor. During
these studies, we found an open reading frame (Orf1) showing end-to-end
similarity to the oligoribonuclease of Escherichia coli
(31) only 10 bp downstream from the termination codon of
adpA. Because orf1 is located just downstream of
adpA and was expected to be developmentally regulated by
A-factor and because little is known about RNA degradation in members
of Streptomyces with a complex life cycle, we analyzed the
enzyme activity of Orf1 and disrupted orf1 to examine the
function of the gene product.
-D-thiogalactopyranoside. The cells were
harvested and disrupted by sonication. Cell debris was removed by
centrifugation and filtration using a Millipore filter (pore size, 0.45 µm). The cleared lysate was applied to a column with His-bind resin
(Novagen), and His-tagged Orf1 was eluted with a linear gradient of 60 to 1,000 mM imidazole (Fig. 2A). The
substrate was prepared as follows. [5'-32P]pCp was
attached to ApCpC with T4 RNA ligase. The
ApCpC[5'-32P]pCp product was treated with bacterial
alkaline phosphatase, and the ApCpC[5'-32P]pC product was
separated by thin-layer chromatography (TLC) on PSC-Fertigplatten
cellulose (Merck) by using 1 M ammonium acetate-95% ethanol (60:40,
vol/vol) as the solvent. The radioactive tetraribonucleotide was eluted
with H2O from cellulose powder collected from the
thin-layer chromatography plate and used directly for the
oligoribonuclease assay.
View larger version (63K):
[in a new window]
FIG. 1.
Amino acid sequences of OrnA and OrnA-c (A) and gene
organizations of the ornA-c and ornA loci and
schematic representation of plasmids used in this study (B). (A) Amino
acid alignment with the oligoribonuclease of E. coli
(31) and homologues found in Schizosaccharomyces
pombe (protein database accession no. CAB37438) and Homo
sapiens (protein database accession no. AAD34109) is also shown.
Solid boxes indicate that among five proteins, more than three amino
acid residues in the alignment are identical. Between OrnA and OrnA-c,
identical amino acid residues are indicated by grey boxes. Dashes
indicate gaps introduced for alignment. (B) The percentages of
identical amino acid residues of corresponding gene products are shown.
The following abbreviations for restriction enzymes are used: Bs,
BstPI; Fb, FbaI; Kp, KpnI; Pm,
PmaCI; Ps, PstI; Sc, SacI; Sl,
SalI; Sp, SphI; and Pv, PvuII.
View larger version (36K):
[in a new window]
FIG. 2.
Exo-oligoribonuclease activity of His-tagged OrnA. (A)
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of protein
samples. Lane 1, the crude lysate from E. coli BL21(DE3)
harboring pET-ORNA; lane 2, after His-bind resin column chromatography;
and lane M, molecular size markers. (B) Release of
[32P]CMP from ApCpC[32P]pC by His-tagged
OrnA. After the product had been separated by paper chromatography, the
paper was analyzed by using an image analyzer. The origin,
[32P]CMP, and ApCpC[32P]pC are indicated by
arrows. The concentrations (in micrograms per milliliter) of His-tagged
OrnA in the reaction mixtures were 11.2 (lane 1), 5.6 (lane 2), 2.8 (lane 3), 1.4 (lane 4), and 0.7 (lane 5).
Transcription of ornA by two promoters.
ornA
is located just downstream of adpA, one of the targets of
ArpA (Fig. 1B) (22). The nucleotide sequence of this region has been registered in the DDBJ, EMBL, and GenBank databases under accession no. AB023785. Because of only a 10-bp space between the
termination codon, TAG, of adpA and the initiation codon, ATG, of ornA (Fig. 3D) and
because of the absence of typical transcriptional terminator sequences
in the region downstream from adpA, we tried to detect a
possible polycistronic mRNA by reverse transcription (RT)-PCR. Two
primers, 5'-AGCGTCATGAGCCAGGACTCCGCC-3' (primer A; the underline indicates the initiation codon of adpA) and
5'-CTACGGTGCGGCCGGAGCCGACAAGCG-3' (primer B; the
underline indicates the termination codon of ornA), were
used. First strand cDNA was synthesized by using primer B (10 pmol) and
3 µg of total RNA prepared from the mycelium grown at 30°C for
24 h in YMPD liquid medium (22). The RNA complementary to the cDNA was removed with RNase H. The cDNA was amplified by PCR
with primers A and B (10 pmol each) at 94°C for 30 s, 58°C for
30 s, and 72°C for 3 min in a total of 30 cycles. Agarose gel
electrophoresis of the RT-PCR product revealed a 1.8-kb fragment (Fig.
3A), indicating that adpA and ornA were
cotranscribed from the A-factor-dependent promoter in front of
adpA.
|
DNA digested with HindIII and
X174 DNA digested with HincII were used as size markers
(lane 3). (B) Low-resolution S1 nuclease analysis of ornA.
RNA was isolated from the mycelium of S. griseus IFO13350
(WT) and that of the A-factor-deficient mutant (HH1) after they were
grown at 30°C for 24 h. For analysis of ornA
transcription, the ornA probe B (nt 
348
to +52 [probe A] and from 189 to +210 [probe B], with respect to
the transcriptional start point of ornA that was later
determined by high-resolution S1 mapping). A single start point was
detected near the initiation codon with the two probes. This transcript
was detected in both the wild-type (WT) and an A-factor-deficient
mutant strain, HH1 (Fig. 3B), indicating that this promoter was
independent of A-factor. Transcription of hrdB encoding
HrdB was used to monitor the quantity and quality of the
mRNA used. The transcripts of adpA and hrdB in
strains WT and HH1 were analyzed by low-resolution S1 mapping, as
previously described (22). The amount of the ornA
mRNA relative to that of the hrdB mRNA was smaller than that
of the adpA mRNA, but it was still distinct. High-resolution
S1 mapping with probe A determined the transcriptional start points to
be the C that was one nucleotide upstream from the initiation codon and
the A of the initiation codon ATG (Fig. 3C). The assignment is based on
the fact that the fragments generated by the chemical sequencing
reactions migrate 1.5 nt further than the corresponding fragments
generated by S1 nuclease digestion of the DNA-RNA hybrids (half a
residue from the presence of the 3'-terminal phosphate group and one
residue from the elimination of the 3'-terminal nucleotide)
(27). In front of the start point, CTGCCG and
TAGGGT with an 18-bp space, which are similar to one type
(TTGACR for 35 and TAGRRT for 10; R: A or G
[28]) of Streptomyces promoters, are
present (Fig. 3D). Promoters of this type are believed to be active
during vegetative growth (12). Although the translation of
ornA mRNA presents a contrast to the conventional
interaction between ribosomes and Shine-Dalgarno sequences in
translational initiation in other bacteria, this transcription-translation feature is not uncommon in members of Streptomyces. For example, the 23S rRNA methylase mediating
erythromycin resistance in Streptomyces erythraeus
(4), the aminoglycoside phosphotransferase mediating
neomycin resistance in Streptomyces fradiae (3),
and the streptothricin acetyltransferase mediating streptothricin
resistance in Streptomyces lavendulae (16) are translated from leaderless transcripts.
Disruption of ornA causes slow growth in S. griseus.
We disrupted the chromosomal ornA gene by
insertion of a kanamycin resistance gene to determine the function of
ornA in S. griseus (Fig.
4A). For this purpose, plasmid pORN-2
(Fig. 1B) was constructed as follows. DNA was manipulated in
Streptomyces species (11) and in E. coli (19). The 4.5-kb SphI fragment containing the whole ornA gene was cloned on pUC19,
resulting in pSPH5-1. pSPH5-1 was digested with BstPI, and
the ends were flush ended with Klenow fragment. The linear plasmid was
digested by BamHI, and the resultant 4.8-kb fragment
(containing the whole vector and upstream and 5'-end regions of
ornA) was ligated with a 1.3-kb
SmaI-BamHI fragment containing the kanamycin
resistance gene from Tn5 (2), resulting in
pORN-1. pORN-1 had a unique KpnI site in the
multicloning site of pUC19. A 2.0-kb KpnI fragment containing a 3' end and downstream regions of ornA was
excised from pSPH5-1 and inserted into the KpnI site of
pORN-1 in the correct orientation to construct pORN-2, used for
gene disruption. Plasmid pORN-2 was linearized by digestion of the
vector sequence with HindIII and DraI,
denatured with NaOH, and introduced by protoplast transformation into
the wild-type strain S. griseus IFO13350. Correct gene
replacement by means of double crossover was confirmed by Southern
hybridization (data not shown). The kanamycin resistance gene was
inserted between Thr-30 and Tyr-42. The ornA strains grew
more slowly than the wild-type strain and scarcely formed aerial hyphae
(Fig. 4B). Even after 3 to 4 weeks of cultivation, the
ornA strains formed very sparse aerial hyphae and spores.
We assume that the sparse aerial hyphae formation was due to
disturbance of growth. Sm production by the ornA mutants was also repressed until 5 to 6 days, but after 2 weeks of growth the
mutants produced Sm at a very low yield, assayed by bioassay with
Bacillus subtilis as an indicator (17). We
therefore assume that the ornA mutation does not directly
affect, if at all, Sm production. The delay in Sm production appears to
be due to slow growth. As described below, ornA mutants
of Streptomyces coelicolor A3(2) produced actinorhodin
almost normally. ornA on a low-copy-number (1 to 2 per
genome [18]) plasmid pKU209 (plasmid pADP12LSP2) (Fig. 1B) recovered its growth and spore formation in the
ornA strains (Fig. 4C). In pADP12LSP2, a 2.1-kb
fragment, which contained a 0.9-kb upstream region of adpA,
an in-frame-deleted adpA, and the intact ornA,
was inserted in the BamHI site of pKU209.
|
Wide distribution of ornA in Streptomyces. To search for oligoribonuclease homologues in Streptomyces, we analyzed the genomes of several Streptomyces species by Southern hybridization using a 32P-labeled 0.8-kb SalI-PvuII fragment containing ornA of S. griseus (Fig. 1B) as a probe and BamHI-digested chromosomal DNAs (data not shown). The actinomycetes examined were Streptomyces albus IFO3710, Streptomyces antibioticus IFO12652, S. coelicolor A3(2) M130, Streptomyces flaveolus IFO3408, Streptomyces fradiae ATCC 21096, Streptomyces globisorus IFO12208, Streptomyces lividans HH21, and Streptomyces viridochromogenes IFO3710. In all the eight species, signals were detected (data not shown), indicating wide distribution of ornA among members of Streptomyces. Because a single signal was detected for every strain, there must be only one copy of the ornA gene in each species.
An oligoribonuclease gene in S. coelicolor A3(2).
We cloned an ornA homologue from S. coelicolor
A3(2), which is the most genetically characterized strain among
Streptomyces. A 2.4-kb FbaI fragment showing a
positive signal on the Southern blot was cloned in the
BamHI site of pUC19 by the standard DNA probing
method, including colony hybridization (plasmid pFBA2.4) (Fig. 1B). The
nucleotide sequence of the cloned fragment predicted the presence of an
open reading frame which showed high sequence similarity to OrnA of
S. griseus and two truncated open reading frames (Fig. 1B).
The alignment of the amino acid sequences of OrnA and the S. coelicolor A3(2) OrnA homologue is shown in Fig. 1A. Because 88%
of amino acid residues are identical in the two sequences, the S. coelicolor A3(2) OrnA homologue is assumed to have
oligoribonuclease activity. We hence designate the ornA
homologue of S. coelicolor A3(2) ornA-c. A
homology search using the database of the S. coelicolor
A3(2) genome project in Sanger Centre revealed that part (from nt 1 to
707, starting at one of the FbaI sites; see Fig. 1B) of the
determined sequence had been deposited and was the same as the 3' end
region (nt 26257 to 26963) of cosmid StC105 (Fig. 1B). The gene
organization upstream of ornA in S. griseus and
S. coelicolor A3(2) is identical, although downstream of
ornA, an additional gene, orf4, encoding a
protein very similar to a chitin binding protein, is present in
S. griseus. The percent identities in amino acid sequences
of corresponding gene products are shown in Fig. 1B. On the S. coelicolor A3(2) genome, an adpA homologue
(adpA-c) is located upstream from the ornA
homologue. Both genes are spaced by a 341-nucleotide sequence, while
only 10 nucleotides intervene between adpA and
ornA in S. griseus. At present, whether
ornA-c and adpA-c are cotranscribed and how ornA-c is controlled are not clear. adpA
encoding a transcriptional activator is controlled by a
repressor-type regulator, ArpA, in S. griseus
(22). Upstream of the initiation codon of adpA-c, there are no sequences resembling a consensus sequence for ArpA, CprA,
or CprB binding. These proteins are specific receptors for -butyrolactones (24, 29). Transcriptional studies of
adpA-c and ornA-c are necessary to elucidate the
regulation of these genes.
Phenotypes of ornA-c mutants of S. coelicolor A3(2).
The S. coelicolor A3(2)
chromosomal ornA-c was disrupted by inserting between His-92
and Val-93 the kanamycin resistance gene on plasmid pFBA2.4-Km,
resulting in ornA-c strains (Fig. 4D). pFBA2.4-Km was
constructed by inserting a 1.3-kb SmaI fragment containing
the kanamycin resistance gene from Tn5 into the unique PmaCI site (nt 973) of pFBA2.4. Southern hybridization
confirmed the correct insertion (data not shown). Like the S. griseus ornA mutants, the ornA-c strain grew
slowly in comparison with the parent strain and formed sparse aerial
mycelium (Fig. 4E). Despite the slow growth, no great effect of the
ornA-c disruption on production of the pigmented
antibiotics, actinorhodin, and undecylprodigiosin was observed. This is
a contrast with the ornA mutations of S. griseus,
which caused a delay in Sm production that probably resulted from slow
growth. The difference may have resulted from a difference in the
regulation of the secondary metabolism in the two strains. For
complementation of ornA-c mutations, plasmid pORNAcL
(Fig. 1B) was constructed by inserting a 1.6-kb
HindIII-PstI fragment (nt 1 to 1551) between
the PstI and HindIII sites of pKU209. When pORNAcL was introduced, the ornA-c strains grew normally
and formed aerial mycelium (Fig. 4F), which showed that the slow growth and sparse aerial mycelium formation of the ornA-c
strains were due solely to the ornA-c mutation.
A possible role of OrnA.
Disruption of ornA in both
S. griseus and S. coelicolor A3(2) caused slow
growth and sparse aerial mycelium formation. This is a contrast to the
lethal effect of mutations in the E. coli oligoribonuclease
(9). The E. coli oligoribonuclease is a 3'-to-5' hydrolytic exoribonuclease specific for small oligoribonucleotides (6, 21, 30) and an essential component in the mRNA decay pathway (9). Why is the oligoribonuclease of
Streptomyces not essential for growth? One possibility is
that Streptomyces species have other oligoribonucleases
which partially compensate for the loss of OrnA. In relation to this
point, B. subtilis, which is relatively close to
Streptomyces in evolution, contains no OrnA homologues. In
B. subtilis, mRNA degradative activity is primarily phosphorolytic, whereas in E. coli it is primarily
hydrolytic (7, 8). Ghosh and Deutscher (9)
pointed out that this might account for the lack of an
oligoribonuclease requirement in B. subtilis. Transcription
of ornA must be greatly enhanced during the second
exponential growth period because of its A-factor dependence; it is
conceivable that some additional oligoribonucleases, of either the
hydrolytic or phosphorolytic type, are produced during the first period
of exponential growth. A poor supply of monoribonucleotides in the
ornA mutants supposedly causes slow growth, which results
in the loss of aerial mycelium formation and the delay in Sm production.
Nucleotide sequence accession no. The nucleotide sequence of the ornA homologue cloned from S. coelicolor A3(2) was submitted to the DDBJ, EMBL, and GenBank databases under accession no. AB036424.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported, in part, by the Waksman Foundation of Japan, by the "Research for the Future" Program of JSPS, and by the Bio Design Program of the Ministry of Agriculture, Forestry, and Fisheries of Japan (BDP-00-VI-2-2).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biotechnology, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan. Phone: 81 (3) 5841 5123. Fax: 81 (3) 5841 8021. E-mail: asuhori{at}mail.ecc.u-tokyo.ac.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Aceti, D. J., and W. C. Champness.
1998.
Transcriptional regulation of Streptomyces coelicolor pathway-specific antibiotic regulators by the absA and absB loci.
J. Bacteriol.
180:3100-3106 |
| 2. | Beck, E., G. Ludwig, A. Auerswald, B. Reiss, and H. Schaller. 1982. Nucleotide sequence and exact localisation of the neomycin phosphotransferase gene from transposon Tn5. Gene 19:327-336[CrossRef][Medline]. |
| 3. | Bibb, M. J., and G. R. Janssen. 1987. Unusual features of transcription and translation of antibiotic resistance genes in antibiotic-producing Streptomyces, p. 309-318. In M. Alacevic, D. Hranueli, and Z. Toman (ed.), Genetics of industrial microorganisms. Ognjen Prica Printing Works, Karlovac, Yugoslavia. |
| 4. | Bibb, M. J., G. R. Janssen, and J. M. Ward. 1986. Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus. Gene 41:E357-E368[CrossRef]. |
| 5. | Chater, K. F. 1993. Genetics of differentiation in Streptomyces. Annu. Rev. Microbiol. 47:685-713[CrossRef][Medline]. |
| 6. |
Datta, A. K., and S. K. Niyogi.
1975.
A novel oligoribonuclease of Escherichia coli. II. Mechanism of action.
J. Biol. Chem.
250:7313-7319 |
| 7. |
Deutscher, M. P., and N. B. Reuven.
1991.
Enzymatic basis for hydrolytic versus phosphorolytic mRNA degradation in Escherichia coli and Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
88:3277-3280 |
| 8. |
Donovan, W. P., and S. R. Kushner.
1986.
Polynucleotide phosphorylase and ribonuclease II are required for cell viability and mRNA turnover in Escherichia coli K-12.
Proc. Natl. Acad. Sci. USA
83:120-124 |
| 9. |
Ghosh, S., and M. P. Deutscher.
1999.
Oligoribonuclease is an essential component of the mRNA decay pathway.
Proc. Natl. Acad. Sci. USA
96:4372-4377 |
| 10. | Hagége, J. M., and S. N. Cohen. 1997. A developmentally regulated Streptomyces endoribonuclease resembles ribonuclease E of Escherichia coli. Mol. Microbiol. 25:1077-1090[CrossRef][Medline]. |
| 11. | Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces: a laboratory manual. The John Innes Foundation, Norwich, United Kingdom. |
| 12. |
Hopwood, D. A.,
M. J. Bibb,
K. F. Chater,
G. R. Janssen,
F. Malpartida, and C. P. Smith.
1986.
Regulation of gene expression in antibiotic-producing Streptomyces, p. 251-276.
In
I. R. Booth, and C. F. Higgins (ed.), Regulation of gene expression 25 years on. Cambridge University Press, Cambridge, England.
|
| 13. |
Horinouchi, S.
1999.
-Butyrolactones that control secondary metabolism and cell differentiation in Streptomyces, p. 193-207.
In
G. M. Dunny, and S. C. Winans (ed.), Cell-cell signaling in bacteria. American Society for Microbiology, Washington, D.C.
|
| 14. | Horinouchi, S., and T. Beppu. 1992. Autoregulatory factors and communication in actinomycetes. Annu. Rev. Microbiol. 46:377-398[CrossRef][Medline]. |
| 15. | Horinouchi, S., and T. Beppu. 1994. A-factor as a microbial hormone that controls cellular differentiation and secondary metabolism in Streptomyces griseus. Mol. Microbiol. 12:859-864[Medline]. |
| 16. |
Horinouchi, S.,
K. Furuya,
M. Nishiyama,
H. Suzuki, and T. Beppu.
1987.
Nucleotide sequence of the streptothricin acetyltransferase gene from Streptomyces lavendulae and its expression in heterologous hosts.
J. Bacteriol.
169:1929-1937 |
| 17. |
Horinouchi, S.,
Y. Kumada, and T. Beppu.
1984.
Unstable genetic determinant of A-factor biosynthesis in streptomycin-producing organisms: cloning and characterization.
J. Bacteriol.
158:481-487 |
| 18. | Kakinuma, S., Y. Takada, H. Ikeda, H. Tanaka, and S. Omura. 1991. Cloning of large DNA fragments, which hybridize with actinorhodin biosynthesis genes, from kalafungin and nanaomycin A methyl ester producers and identification of genes for kalafungin biosynthesis of the kalafungin producer. J. Antibiot. 44:995-1005[Medline]. |
| 19. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 20. | Nicholson, A. W. 1999. Function, mechanism and regulation of bacterial ribonucleases. FEMS Microbiol. Rev. 23:371-390[CrossRef][Medline]. |
| 21. |
Niyogi, S. K., and A. K. Datta.
1975.
A novel oligoribonuclease of Escherichia coli. I. Isolation and properties.
J. Biol. Chem.
250:7307-7312 |
| 22. | Ohnishi, Y., S. Kameyama, H. Onaka, and S. Horinouchi. 1999. The A-factor regulatory cascade leading to streptomycin biosynthesis in Streptomyces griseus: identification of a target gene of the A-factor receptor. Mol. Microbiol. 34:102-111[CrossRef][Medline]. |
| 23. |
Onaka, H.,
N. Ando,
T. Nihira,
Y. Yamada,
T. Beppu, and S. Horinouchi.
1995.
Cloning and characterization of the A-factor receptor gene from Streptomyces griseus.
J. Bacteriol.
177:6083-6092 |
| 24. | Onaka, H., and S. Horinouchi. 1997. DNA-binding activity of the A-factor receptor protein and its recognition DNA sequences. Mol. Microbiol. 24:991-1000[CrossRef][Medline]. |
| 25. |
Price, B.,
T. Adamidis,
R. Kong, and W. Champness.
1999.
A Streptomyces coelicolor antibiotic regulatory gene, absB, encodes an RNase III homolog.
J. Bacteriol.
181:6142-6151 |
| 26. | Rauhut, R., and G. Klug. 1999. mRNA degradation in bacteria. FEMS Microbiol. Rev. 23:353-370[CrossRef][Medline]. |
| 27. | Sollner-Webb, B., and R. H. Reeder. 1979. The nucleotide sequence of the initiation and termination sites for ribosomal RNA transcription in X. laevis. Cell 18:485-499[CrossRef][Medline]. |
| 28. |
Strohl, W. R.
1992.
Compilation and analysis of DNA sequences associated with apparent streptomycete promoters.
Nucleic Acids Res.
20:961-974 |
| 29. | Sugiyama, M., H. Onaka, T. Nakagawa, and S. Horinouchi. 1998. Site-directed mutagenesis of the A-factor receptor protein: Val-41 important for DNA-binding and Trp-119 important for ligand-binding. Gene 222:133-144[CrossRef][Medline]. |
| 30. |
Yu, D., and M. P. Deutscher.
1995.
Oligoribonuclease is distinct from the other known exoribonucleases of Escherichia coli.
J. Bacteriol.
177:4137-4139 |
| 31. |
Zhang, X.,
L. Zhu, and M. P. Deutscher.
1998.
Oligoribonuclease is encoded by a highly conserved gene in the 3'-5' exonuclease superfamily.
J. Bacteriol.
180:2779-2781 |
Journal of Bacteriology, August 2000, p. 4647-4653, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marushima, K., Ohnishi, Y., Horinouchi, S.
(2009). CebR as a Master Regulator for Cellulose/Cellooligosaccharide Catabolism Affects Morphological Development in Streptomyces griseus. J. Bacteriol.
191: 5930-5940
[Abstract] [Full Text] -
Zhang, X.-X., Lilley, A. K., Bailey, M. J., Rainey, P. B.
(2004). Functional and phylogenetic analysis of a plant-inducible oligoribonuclease (orn) gene from an indigenous Pseudomonas plasmid. Microbiology
150: 2889-2898
[Abstract] [Full Text] -
Bralley, P., Jones, G. H.
(2003). Overexpression of the polynucleotide phosphorylase gene (pnp) of Streptomyces antibioticus affects mRNA stability and poly(A) tail length but not ppGpp levels. Microbiology
149: 2173-2182
[Abstract] [Full Text] -
Zuo, Y., Deutscher, M. P.
(2001). Exoribonuclease superfamilies: structural analysis and phylogenetic distribution. Nucleic Acids Res
29: 1017-1026
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»