Previous Article | Next Article 
Journal of Bacteriology, August 2000, p. 4658-4660, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification, Expression, and Characterization
of Escherichia coli Guanine Deaminase
Jason T.
Maynes,
Richard G.
Yuan, and
Floyd F.
Snyder*
Departments of Medical Genetics and
Biochemistry & Molecular Biology, University of Calgary, Calgary,
Alberta T2N 4N1, Canada
Received 25 May 2000/Accepted 1 June 2000
 |
ABSTRACT |
Using the human cDNA sequence corresponding to guanine deaminase,
the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36%
identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and
characterized enzymatically. The 50.2-kDa protein catalyzed the
conversion of guanine to xanthine, having a Km
of 15 µM with guanine and a kcat of 3.2 s
1. The bacterial enzyme shares a nine-residue heavy
metal binding site with human guanine deaminase, PG[FL]VDTHIH, and
was found to contain approximately 1 mol of zinc per mol of subunit of
protein. The E. coli guanine deaminase locus is 3' from an
open reading frame which shows homology to a bacterial purine base permease.
 |
TEXT |
Guanine deaminase (EC 3.5.4.3) is an
aminohydrolase responsible for the conversion of guanine to xanthine
and ammonia. This reaction is one of two, the other being guanylate
reductase, which removes the guanine base from the pool of
guanine-containing metabolites. As such, these enzymes may under
certain circumstances play a role in the regulation of cellular GTP and
the guanylate nucleotide pool. The levels of GMP reductase increase
with increasing concentrations of guanine in cultures of
Escherichia coli and Salmonella enterica serovar
Typhimurium (3, 12), thereby allowing guanylate to serve as
a substrate for the synthesis of adenine nucleotides. Conversely, the
synthesis of the enzymes IMP dehydrogenase and GMP synthetase
(guaA and guaB), which convert IMP, the terminal product of the de novo purine pathway, to GMP, are both repressed when
wild-type cultures of E. coli are supplemented with guanine (9, 12). Guanine and hypoxanthine have subsequently been shown to be corepressors for purR (10, 14), which regulates transcription of the operons required for de novo purine synthesis and
the synthesis of AMP and GMP from IMP (11, 16).
The human cDNA corresponding to guanine deaminase (GenBank AF095286)
was recently cloned, sequenced, and demonstrated to be part of a family
of amino- and amidohydrolases that share a heavy metal binding motif
associated with zinc or manganese (15). In the present work,
we have identified a putative E. coli gene corresponding to
the human guanine deaminase cDNA using the Basic Local Alignment Search
Tool (BLAST) (1). Expression and kinetic analyses have
verified the identity of the corresponding bacterial gene to be a
previously identified open reading frame of unassigned function.
Strategy for the identification of E. coli guanine
deaminase.
BLAST analysis of the E. coli genome
(accession no., U00096) for homology to the protein sequence
corresponding to the human cDNA for guanine deaminase revealed a
homologous open reading frame of 1,317 nucleotides. This functionally
unassigned gene at map position 65.2 min encompasses nucleotides
3023787 to 3025106 of the E. coli genome. The putative gene
encodes a 439-residue protein having a predicted molecular mass of
50,244 Da that is similar to the human gene product for guanine
deaminase of 51,040 Da (15).
Amplification, expression, purification, and characterization of
the putative E. coli guanine deaminase.
The putative
E. coli guanine deaminase sequence was amplified by PCR
using primers ED1
(5'GGGGAATTCATGATGTCAGGAGAACACA)
and ED2 (5'TGGATGTTAAAGCTTTATTA)
based on the E. coli sequence. PCR was performed with
5 min of denaturation at 95°C prior to the first cycle, followed by 1 min of annealing (52°C), 1 min of polymerization (72°C), and 1 min
of denaturation (94°C) for 30 cycles using vent DNA polymerase (New
England Biolabs) and DNA prepared from E. coli strain MG1655
(CGSC strain no. 6300, provided by M. Berlyn, the E. coli
Genetic Stock Center, Yale University). The 1.3-kb PCR product was
digested with EcoRI and HindIII and cloned
into the multiple cloning site of pMAL-c2 (New England Biolabs) and subsequently transformed into DH5-
cells. The sequence of the amplified gene was identical with that of the E. coli
genome. The expressed maltose fusion protein was purified on an amylose affinity column according to the supplier's instructions, cleaved with
factor Xa, and passed a second time through the affinity column. The
cleaved protein was then purified to homogeneity on a MonoQ (Pharmacia)
column eluted at 1 ml/min by loading in 20 mM bis-TrisHCl-20 mM NaCl
(pH 6.2) (buffer A) and washing for 15 min. The protein was then eluted
by forming a linear gradient between buffer A and buffer B (buffer A
with 600 mM NaCl). The expression and purification steps were monitored
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. As a
consequence of the site of subcloning into pMAL, the cleaved
recombinant product contained an extra four residues at the N terminus,
LSEF. The purified protein had an apparent molecular mass of 50 kDa, in agreement with the calculated mass.
Kinetic characterization of the expressed protein and heavy metal
association.
Verification of the function of the expressed gene
product was obtained by examination of its catalytic potential with
guanine. Guanine deaminase activity was assayed spectrophotometrically by following the conversion of guanine to xanthine in a coupled reaction at 512 nm at 37°C as previously described (15).
The reaction mixture consisted of 1 mM 2,4,6-tribromo-3-hydroxybenzoic acid, 0.1 mM 4-amino-antipyrene, 0.025 U of xanthine oxidase/ml, 0.00325 U of uricase/ml, and 0.002 U of peroxidase/ml, as adapted (8). Optimal activity was obtained with 3 mM
MnCl2. Adenine deaminase activity was similarly assayed by
following the conversion of adenine to hypoxanthine. Initial rates in
kinetic experiments were analyzed by a weighted nonlinear least-squares
curve fitting program (4). The purified protein catalyzed
the conversion of guanine to xanthine having a
Km of 15.4 ± 1.8 µM and a
Vmax of 3,795 ± 135 nmol/min per mg of
protein and a kcat of 3.18 ± 0.12 s
1. The Km is similar to that
described for the mouse erythrocyte (23 µM) and human recombinant (10 µM) enzymes, respectively (15).
Inspection of the primary amino acid sequence of E. coli
guanine deaminase revealed it to contain a nine-residue motif,
PG[F]VDTHIH, that is also found in human and mouse guanine deaminase,
PG[L]VDTHIH (15). This HisXHis-containing motif is found
in other amino- and amidohydrolases that have been shown to be ligated
to the heavy metal ion zinc. For example, Bacillus subtilis
adenine deaminase shares the homologous zinc site (13). The
zinc and manganese content of recombinant E. coli guanine
deaminase was determined by graphite furnace atomic absorption
(Galbraith Laboratories, Knoxville, Tenn.). These analyses revealed
there to be approximately 1 atom of zinc (0.69 atom of zinc versus less
than 0.1 atom of manganese) per monomer guanine deaminase. Exposure of
bacterial guanine deaminase to the heavy metal chelator
1,10-phenanthroline, 7.5 mM at 37°C, resulted in a time-dependent
decrease in activity of 85% in 90 min, consistent with chelation of
the heavy metal atom. Removal of phenanthroline by ultrafiltration
using the BioMax 10,000-Mr-cutoff filter
(Millipore), followed by the addition of either Zn++ or
Mn++, resulted in partial restoration of activity.
Comparison of human and E. coli guanine deaminase
primary sequence and evidence for guanine deaminase in other
microorganisms.
Comparison of the human and E. coli
protein sequences using the CLUSTAL program (6) is shown in
Fig. 1. The proteins are 36% identical
and share several conserved regions, including the HisXHis sequence
near the N-terminal region. The E. coli guanine deaminase
protein sequence was used in a BLAST scan of the microbial genome
databases. Several gene products showing significant alignment and
identity with the E. coli sequence were identified in other organisms (Table 1) as putative loci for
guanine deaminase.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
E. coli and human guanine deaminase sequence
alignment. Shown is a Clustal W alignment of sequences, with symbols
defined as follows: *, identical or conserved residues; :, conserved
substitutions; ., semiconserved substitutions.
|
|
The
E. coli guanine deaminase gene is located 3' to a gene
identified as a putative transport protein (Wisconsin
E. coli K-12
database). There is evidence for purine base permeases
(
2,
7), and BLAST analysis shows that this upstream open
reading
frame shares significant alignment with a xanthine-specific
purine
permease in
B. subtilis (
5). Thus a purine
base permease, possibly
having specificity for guanine, and the gene
encoding guanine
deaminase are found in proximity within the
E. coli genome. Further
genetic and molecular analyses are now
possible with regard to
the regulation of purine base transport and
guanine metabolism
as a consequence of the present
study.
 |
ACKNOWLEDGMENTS |
This work was supported by the Medical Research Council of Canada,
grant MT-6376.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Medical Genetics and Biochemistry & Molecular Biology, University of Calgary, 3330 Hospital Dr. NW, Calgary, Alberta, Canada T2N 4N1. Phone:
(403) 220-6025. Fax: (403) 283-8225. E-mail:
snyder{at}ucalgary.ca.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schäffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Benson, C. E.,
D. L. Hornick, and J. S. Gots.
1980.
Genetic separation of purine transport from phosphoribosyltransferase activity in Salmonella typhimurium.
J. Gen. Microbiol.
121:357-364[Abstract/Free Full Text].
|
| 3.
|
Benson, C. E., and J. S. Gots.
1975.
Regulation of GMP reductase in Salmonella typhimurium.
Biochim. Biophys. Acta
403:47-57[Medline].
|
| 4.
|
Brooks, S. P.
1992.
A simple computer program with statistical tests for the analysis of enzyme kinetics.
BioTechniques
13:906-911[Medline].
|
| 5.
|
Christiansen, L. C.,
S. Schou,
P. Nygaard, and H. H. Saxild.
1997.
Xanthine metabolism in Bacillus subtilis: characterization of the xpt-pbuX operon and evidence for purine- and nitrogen-controlled expression of genes involved in xanthine salvage and catabolism.
J. Bacteriol.
179:2540-2550[Abstract/Free Full Text].
|
| 6.
|
Higgins, O.,
J. Thompson,
T. Gibson,
J. D. Thompson,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: the sensitivity of progressive multiple sequence alignment through sequence weighting position-specific gap penalties with matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 7.
|
Housset, P., and M. Nagy.
1977.
Study of the role of purine phosphoribosyl-transferases in the uptake of adenine and guanine by Schizosaccharomyces pombe cells.
Eur. J. Biochem.
73:99-105[Medline].
|
| 8.
|
Le Tissier, P. R.,
J. Peters, and C. D. Skidmore.
1994.
Development of an assay method for purine catabolic enzymes in the mouse and its adaptation for use on an autoanalyzer.
Anal. Biochem.
222:168-175[CrossRef][Medline].
|
| 9.
|
Mehra, R. K., and W. T. Drabble.
1981.
Dual control of the gua operon of Escherichia coli K12 by adenine and guanine nucleotides.
J. Gen. Microbiol.
123:27-37[Abstract/Free Full Text].
|
| 10.
|
Meng, L. M., and P. Nygaard.
1990.
Identification of hypoxanthine and guanine as the corepressors for the purine regulon genes of Escherichia coli.
Mol. Microbiol.
4:2187-2191[CrossRef][Medline].
|
| 11.
|
Meng, L. M.,
M. Kilstrup, and P. Nygaard.
1990.
Autoregulation of PurR repressor synthesis and involvement of purR in the regulation of purB, purC, purL, purMN, and guaBA expression in Escherichia coli.
Eur. J. Biochem.
187:373-379[Medline].
|
| 12.
|
Nijkamp, H. J. J., and P. G. de Haan.
1967.
Genetic and biochemical studies of the guanosine 5'-monophosphate pathway in Escherichia coli.
Biochim. Biophys. Acta
145:31-40[Medline].
|
| 13.
|
Nygaard, P.,
P. Duckert, and H. H. Saxild.
1996.
Role of adenine deaminase in purine salvage and nitrogen metabolism and characterization of the ade gene in Bacillus subtilis.
J. Bacteriol.
178:846-853[Abstract/Free Full Text].
|
| 14.
|
Rolfes, R. J., and H. Zalkin.
1990.
Purification of the Escherichia coli purine regulon repressor and identification of corepressors.
J. Bacteriol.
172:5637-5642[Abstract/Free Full Text].
|
| 15.
|
Yuan, G.,
J. C. Bin,
D. J. McKay, and F. F. Snyder.
1999.
Cloning and characterization of human guanine deaminase. Purification and partial amino acid sequence of the mouse protein.
J. Biol. Chem.
274:8175-8180[Abstract/Free Full Text].
|
| 16.
|
Zalkin, H., and P. Nygaard.
1996.
Biosynthesis of purine nucleotides, p. 561-579.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reynikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C.
|
Journal of Bacteriology, August 2000, p. 4658-4660, Vol. 182, No. 16
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pope, S. D., Chen, L.-L., Stewart, V.
(2009). Purine Utilization by Klebsiella oxytoca M5al: Genes for Ring-Oxidizing and -Opening Enzymes. J. Bacteriol.
191: 1006-1017
[Abstract]
[Full Text]
-
Tan, Y. P., Zheng, J., Tung, S. L., Rosenshine, I., Leung, K. Y.
(2005). Role of type III secretion in Edwardsiella tarda virulence. Microbiology
151: 2301-2313
[Abstract]
[Full Text]
-
Schultz, A. C., Nygaard, P., Saxild, H. H.
(2001). Functional Analysis of 14 Genes That Constitute the Purine Catabolic Pathway in Bacillus subtilis and Evidence for a Novel Regulon Controlled by the PucR Transcription Activator. J. Bacteriol.
183: 3293-3302
[Abstract]
[Full Text]