TEXT

Top Abstract Text References

Guanine deaminase (EC 3.5.4.3) is an aminohydrolase responsible for the conversion of guanine to xanthine and ammonia. This reaction is one of two, the other being guanylate reductase, which removes the guanine base from the pool of guanine-containing metabolites. As such, these enzymes may under certain circumstances play a role in the regulation of cellular GTP and the guanylate nucleotide pool. The levels of GMP reductase increase with increasing concentrations of guanine in cultures of Escherichia coli and Salmonella enterica serovar Typhimurium (3, 12), thereby allowing guanylate to serve as a substrate for the synthesis of adenine nucleotides. Conversely, the synthesis of the enzymes IMP dehydrogenase and GMP synthetase (guaA and guaB), which convert IMP, the terminal product of the de novo purine pathway, to GMP, are both repressed when wild-type cultures of E. coli are supplemented with guanine (9, 12). Guanine and hypoxanthine have subsequently been shown to be corepressors for purR (10, 14), which regulates transcription of the operons required for de novo purine synthesis and the synthesis of AMP and GMP from IMP (11, 16).

The human cDNA corresponding to guanine deaminase (GenBank AF095286) was recently cloned, sequenced, and demonstrated to be part of a family of amino- and amidohydrolases that share a heavy metal binding motif associated with zinc or manganese (15). In the present work, we have identified a putative E. coli gene corresponding to the human guanine deaminase cDNA using the Basic Local Alignment Search Tool (BLAST) (1). Expression and kinetic analyses have verified the identity of the corresponding bacterial gene to be a previously identified open reading frame of unassigned function.

Strategy for the identification of E. coli guanine deaminase. BLAST analysis of the E. coli genome (accession no., U00096) for homology to the protein sequence corresponding to the human cDNA for guanine deaminase revealed a homologous open reading frame of 1,317 nucleotides. This functionally unassigned gene at map position 65.2 min encompasses nucleotides 3023787 to 3025106 of the E. coli genome. The putative gene encodes a 439-residue protein having a predicted molecular mass of 50,244 Da that is similar to the human gene product for guanine deaminase of 51,040 Da (15).

Amplification, expression, purification, and characterization of the putative E. coli guanine deaminase. The putative E. coli guanine deaminase sequence was amplified by PCR using primers ED1 (5'GGGGAATTCATGATGTCAGGAGAACACA) and ED2 (5'TGGATGTTAAAGCTTTATTA) based on the E. coli sequence. PCR was performed with 5 min of denaturation at 95°C prior to the first cycle, followed by 1 min of annealing (52°C), 1 min of polymerization (72°C), and 1 min of denaturation (94°C) for 30 cycles using vent DNA polymerase (New England Biolabs) and DNA prepared from E. coli strain MG1655 (CGSC strain no. 6300, provided by M. Berlyn, the E. coli Genetic Stock Center, Yale University). The 1.3-kb PCR product was digested with EcoRI and HindIII and cloned into the multiple cloning site of pMAL-c2 (New England Biolabs) and subsequently transformed into DH5- cells. The sequence of the amplified gene was identical with that of the E. coli genome. The expressed maltose fusion protein was purified on an amylose affinity column according to the supplier's instructions, cleaved with factor Xa, and passed a second time through the affinity column. The cleaved protein was then purified to homogeneity on a MonoQ (Pharmacia) column eluted at 1 ml/min by loading in 20 mM bis-TrisHCl-20 mM NaCl (pH 6.2) (buffer A) and washing for 15 min. The protein was then eluted by forming a linear gradient between buffer A and buffer B (buffer A with 600 mM NaCl). The expression and purification steps were monitored by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. As a consequence of the site of subcloning into pMAL, the cleaved recombinant product contained an extra four residues at the N terminus, LSEF. The purified protein had an apparent molecular mass of 50 kDa, in agreement with the calculated mass.

Kinetic characterization of the expressed protein and heavy metal association. Verification of the function of the expressed gene product was obtained by examination of its catalytic potential with guanine. Guanine deaminase activity was assayed spectrophotometrically by following the conversion of guanine to xanthine in a coupled reaction at 512 nm at 37°C as previously described (15). The reaction mixture consisted of 1 mM 2,4,6-tribromo-3-hydroxybenzoic acid, 0.1 mM 4-amino-antipyrene, 0.025 U of xanthine oxidase/ml, 0.00325 U of uricase/ml, and 0.002 U of peroxidase/ml, as adapted (8). Optimal activity was obtained with 3 mM MnCl₂. Adenine deaminase activity was similarly assayed by following the conversion of adenine to hypoxanthine. Initial rates in kinetic experiments were analyzed by a weighted nonlinear least-squares curve fitting program (4). The purified protein catalyzed the conversion of guanine to xanthine having a K_m of 15.4 ± 1.8 µM and a V_max of 3,795 ± 135 nmol/min per mg of protein and a k_cat of 3.18 ± 0.12 s¹. The K_m is similar to that described for the mouse erythrocyte (23 µM) and human recombinant (10 µM) enzymes, respectively (15).

Comparison of human and E. coli guanine deaminase primary sequence and evidence for guanine deaminase in other microorganisms. Comparison of the human and E. coli protein sequences using the CLUSTAL program (6) is shown in Fig. 1. The proteins are 36% identical and share several conserved regions, including the HisXHis sequence near the N-terminal region. The E. coli guanine deaminase protein sequence was used in a BLAST scan of the microbial genome databases. Several gene products showing significant alignment and identity with the E. coli sequence were identified in other organisms (Table 1) as putative loci for guanine deaminase.

View larger version (47K): [in this window] [in a new window]   FIG. 1.   E. coli and human guanine deaminase sequence alignment. Shown is a Clustal W alignment of sequences, with symbols defined as follows: *, identical or conserved residues; :, conserved substitutions; ., semiconserved substitutions.