Previous Article | Next Article ![]()
Journal of Bacteriology, September 2000, p. 4811-4821, Vol. 182, No. 17
Microbial Pathogenesis Unit, de Duve
Institute of Cellular and Molecular Pathology, and Faculté de
Médecine, Université Catholique de Louvain, B-1200
Brussels, Belgium
Received 16 December 1999/Accepted 13 June 2000
A type III secretion-translocation system allows
Yersinia adhering at the surface of animal cells to deliver
a cocktail of effector Yops (YopH, -O, -P, -E, -M, and -T) into the
cytosol of these cells. Residues or codons 1 to 77 contain all the
information required for the complete delivery of YopE into the target
cell (release from the bacterium and translocation across the
eukaryotic cell membrane). Residues or codons 1 to 15 are sufficient
for release from the wild-type bacterium under
Ca2+-chelating conditions but not for delivery into target
cells. Residues 15 to 50 comprise the binding domain for SycE, a
chaperone specific for YopE that is necessary for release and
translocation of full-length YopE. To understand the role of this
chaperone, we studied the delivery of YopE-Cya reporter proteins and
YopE deletants by polymutant Yersinia devoid of most of the
Yop effectors ( The three Yersinia
species that are pathogenic to humans (Y. pestis,
Y. pseudotuberculosis, and Y. enterocolitica) all
share the ability to deliver toxins, called YopE, YopH, YopM, YopT, YopO/YpkA, and YopP/YopJ, into eukaryotic host cells (8).
These toxic Yop effectors induce a range of modifications to the normal processes of eukaryotic cells. For example, YopE has a
GTPase-activating protein activity which downregulates Rho activity and
leads to actin filament disruption and inhibition of phagocytosis by
macrophages (21, 22, 28, 31). Together with their complex
type III Ysc machinery for export and translocation, the Yops are
encoded by a 70-kb virulence plasmid (8). Similar to
structures observed in other bacteria endowed with type III secretion,
the Yop secretion apparatus A secretion signal for the Yops is located at the 5' end of the gene
(16, 29). It has been proposed that this signal could be in
the mRNA, so that the Yops are cotranslationally secreted from the
bacteria (1, 2). In the case of YopE, the first 15 codons or amino acids constitute this 5' secretion signal. In
addition, efficient secretion of some Yops requires the assistance of
individual cytosolic chaperones, called Sycs (32, 33). These
chaperones are small acidic proteins that possess a leucine repeat
in their C-terminal moiety. SycE, the chaperone of YopE, binds amino
acids 15 to 50 (the chaperone binding domain) of YopE (27,
35), and it prevents the intrabacterial degradation of this Yop
(5, 10). The chaperone binding domain is not required for
secretion of YopE fusion proteins by the 5' secretion signal (5,
27, 28). Moreover, in the absence of this chaperone binding
domain, SycE becomes dispensable for secretion of YopE, suggesting that
it is the presence of the chaperone binding domain that creates the
need for the chaperone (35). However, data have been
presented to show that hybrid YopE-neomycin phosphotransferase (designated YopE-Npt) proteins lacking the first 5' secretion signal are still secreted by the Ysc apparatus, suggesting that YopE could contain a second secretion signal (5). This
proposed second secretion signal is localized to the site of the
chaperone binding domain and, correspondingly, it is only operational
in the presence of SycE (5).
Translocation of the effector Yops across the eukaryotic cell membrane
was shown by several laboratories (4, 12, 20, 23) to be
dependent on YopB and YopD, two other proteins exported by the
bacterium, but this view has recently been questioned (15). Translocation of effector Yops can be demonstrated by several methods.
A classical approach makes use of a calmodulin-dependent adenylate
cyclase (Cya) reporter strategy (29). Translocation of Yop
effectors can also be demonstrated by fractionation of the infected
cell culture or by indirect immunofluorescence and confocal scanning
laser microscopy (23). Demonstration of the translocation
turned out to be more difficult with some Yops than with others, and it
has been observed that translocation can be improved if expression of
the other Yop effectors is abolished (4, 11). This could be
due to a decrease in competition between the different Yop effectors
for the secretion and translocation machineries. Strains of Y. enterocolitica that carry multiple yop mutations are
thus sensitive tools for studying the translocation of Yop effectors.
It has been shown previously that a Cya reporter protein fused to just
the first 15 amino acids of YopE (YopE15-Cya) can be released by wild-type (wt) bacteria upon Ca2+ chelation;
however, this fusion protein is not delivered into eukaryotic cells.
Indeed, at least the first 50 amino acids are required for the reporter
protein to be translocated into eukaryotic cells by wt bacteria
(27, 28). Therefore, amino acids 15 to 50, which are the
residues that bind the SycE chaperone and which constitute the proposed
second secretion signal, were thought to be a translocation domain
(27, 28), although they are not sufficient, in the absence
of the 5' secretion signal, to direct delivery of YopE by wt bacteria
into eukaryotic cells (14).
In this study, we investigated the requirement for the two proposed
secretion signals for delivery of YopE into eukaryotic cells. We
confirmed that SycE and residues 15 to 50 of YopE are required for
delivery of YopE by wt bacteria, but we observed that they are
dispensable for delivery by a multimutant strain. This suggests that
SycE could be a hierarchy factor for YopE delivery. Moreover, we
identified a secretion-inhibitory domain between residues 50 and 77.
Bacterial strains, plasmids, and growth conditions.
Parental
wt strain Y. enterocolitica MRS40(pYV40) is an
ampicillin-sensitive derivative of serotype O:9 clinical isolate
E40(pYV40) (25, 29). Escherichia coli LK111, XL-1
Blue, and BL21(DE3) were used for plasmid construction and protein
expression. E. coli SM10
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Competition between the Yops of Yersinia
enterocolitica for Delivery into Eukaryotic Cells: Role of the
SycE Chaperone Binding Domain of YopE

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
HOPEM and
THE strains). We first tested YopE-Cya
hybrid proteins and YopE proteins deleted of the SycE-binding site. In
contrast to wild-type strains, these mutants delivered
YopE15-Cya as efficiently as YopE130-Cya. They
were also able to deliver YopE
17-77. SycE was
dispensable for these deliveries. These results show that residues or
codons 1 to 15 are sufficient for delivery into eukaryotic cells and
that there is no specific translocation signal in Yops. However, the
fact that the SycE-binding site and SycE were necessary for delivery of
YopE by wild-type Yersinia suggests that they could
introduce hierarchy among the effectors to be delivered. We then tested
a YopE-Cya hybrid and YopE proteins deleted of amino acids 2 to 15 but
containing the SycE-binding domain. These constructs were neither
released in vitro upon Ca2+ chelation nor delivered
into cells by wild-type or polymutant bacteria, casting doubts on the
hypothesis that SycE could be a secretion pilot. Finally, it appeared
that residues 50 to 77 are inhibitory to YopE release and that binding
of SycE overcomes this inhibitory effect. Removal of this domain
allowed in vitro release and delivery in cells in the absence as well
as in the presence of SycE.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
the injectisome
is thought to form
a "syringe" directly projecting through the bacterial
membranes with a "needle" that connects to the translocation
apparatus in the eukaryotic cell membrane (8, 10a).
Secretion and translocation of the Yop effectors are normally triggered
by contact with a eukaryotic cell. However, secretion can be
artificially induced by chelating Ca2+ ions, which leads to
a massive release of Yops into the culture supernatant.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
pir+ was
used to conjugate plasmids into Y. enterocolitica. The full list of plasmids used in this study is given in Table
1. Bacterial strains were routinely grown
in tryptic soy broth and plated on tryptic soy agar. For in vitro
induction of the yop genes, Y. enterocolitica was
grown in brain heart infusion (BHI), supplemented with 20 mM sodium
oxalate, 20 mM MgCl2, and 0.4% (wt/vol) glucose (BHI-Ox).
Yop induction under minimal-medium conditions was performed as
described previously (5). Selective agents were used at the
following concentrations: ampicillin, 200 µg · ml
1; chloramphenicol, 10 µg · ml
1;
nalidixic acid, 35 µg · ml
1; streptomycin, 100 µg · ml
1; sucrose, 5% (wt/vol); and arsenite,
0.4 mM.
TABLE 1.
Plasmids used in this study
Molecular biology techniques.
Molecular biology techniques
were essentially performed as previously described (24). All
chemicals were obtained from Sigma unless stated otherwise. Yops were
precipitated from culture supernatants by ammonium sulfate (0.5 g
· ml
1) (9), analyzed by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and, where
appropriate, transferred to nitrocellulose membranes. Immunoblots were
developed with secondary antibody conjugated to horseradish peroxidase
(HRP) and Supersignal (NEN) as a chemiluminescent substrate. For
detection of Cya fusion proteins on nitrocellulose membranes,
biotinylated calmodulin (Calbiochem) was used according to the
supplier's instructions, except that streptavidin-biotinylated HRP
complex (Amersham Life Science) was substituted for
streptavidin-alkaline phosphatase, and Supersignal was used as the
chemiluminescent substrate.
pir+. After allelic exchange, the
mutations were confirmed by PCR analysis or sequencing and, where
appropriate, by Yop induction and SDS-PAGE analysis of the secreted
proteins or by Western blot analysis of the bacterial proteins.
Plasmid constructions. (i) pAPBD18.
The 2.4-kb
BamHI-ClaI fragments of pMSLE15 (containing
yopE15-cya and sycE) were cloned into
the corresponding sites of pBluescript KS(
) to create pAPBD16.
pAPBD16 was digested with EcoRI, the ends were filled in
with Klenow, and the DNA was religated to create pAPBD17. The 2.4-kb
BamHI-ClaI fragments of pAPBD17 (containing yopE15-cya and sycE54)
were cloned into the corresponding sites of pTM100 to create pAPBD18.
(ii) pAPBL49, pAPBL50, pAPBL47, and pAPBL48.
The 2.5-kb
BamHI-ClaI fragments of pMS111 (containing
yopE130-cya and sycE) and of pMSL30
(containing yopE130-cya and
sycE54) were cloned into the corresponding sites
of pBluescript KS(
) to create pAPBL40 and pAPBL38, respectively.
pAPBL40 and pAPBL38 were then mutagenized with oligonucleotide MIPA 679 (GGGAATAAATAGTCATGTCAGTGTCAGGATCTAG), which is identical to
nucleotides
14 to 3 and 46 to 62 of yopE, to produce
pAPBL43 and pAPBL42, respectively, which contain
yopE130(
2-15). pAPBL40 and pAPBL38 were then
mutagenized with oligonucleotide MIPA 680 (TAAATAGTCATGGAAAATA TCATCATTTATTTCTACATCACTGCCCCTGCCGGGAGCTCAGTGTCA GGA),
which introduces a G at position +4 and in which GAGC replaces CA
at +44 to 45 to produce pAPBL45 and pAPBL44, respectively, containing yopE130[+1(2-15)]
(replacement sites are indicated by boldface type). The 2.5-kb
BamHI-ClaI fragments of pAPBL42, pAPBL43,
pAPBL44, and pAPBL45 were cloned into the corresponding sites of pTM100
to produce pAPBL49, pAPBL50, pAPBL47, and pAPBL48, respectively.
(iii) pYOB2. The 2.2-kb yopO gene was amplified by PCR with oligonucleotides MIPA 471 (GCATGAACATATGGGAACTA) and MIPA 473 (TATATCAAATGCATGGCTTAGGG) using pBC5 as a template. After digestion with NdeI (underlined) and NsiI (underlined), the DNA fragment was cloned into the NdeI and PstI sites of pCNR26 to give plasmid pYOB2. This construction places the second start codon of yopO at the NdeI site.
(iv) pAPBG30, pAPBL34, pAPB35, pAPB36, pAPB37, and pIL14.
Plasmid pAPB26 was mutagenized with (i) oligonucleotide MIPA 635 (CTGGAACCCTGAGGTGATGCCGGCAG), which is complementary to
nucleotides 37 to 48 and 148 to 161 of the yopE gene, to
produce plasmid pAPBG30 which encodes YopE
17-49; (ii)
oligonucleotide MIPA 671 (GCTCCCCTCCGATGATGCCGGCAG), which
is complementary to nucleotides 37 to 48 and 235 to 246 of the
yopE gene, to produce plasmid pAPBL34 which encodes
YopE
17-77; (iii) oligonucleotide MIPA 677 (CTAGATCCTGACACTGACATATGTATTTCCTCCTT), which is
complementary to nucleotides
15 to 3 and 46 to 62 of the
yopE gene to produce plasmid pAPB35 which encodes
YopE
2-15; (iv) oligonucleotide MIPA 678 (TCCTGACACTGAGCTCCCGGCAGGGGCAGTGATGTAGAAATAAATGATGATATTTTCCATATGTATTTC), which adds a G at the +4 position and in which GAGC replaces CA at positions +44 and 45 of the yopE gene to produce plasmid
pAPB36 which encodes YopE+1(2-15) (noncoding strand;
replacement sites shown in boldface); (v) oligonucleotide MIPA 681 (GCTCCCCTCCGACATATGTATTTCCTCCTT), which is complementary to
nucleotides
15 to 3 and 232 to 243 of the yopE gene to
produce plasmid pAPB37 which encodes YopE
2-77; and (vi)
oligonucleotide MIPA 892 (GCTCCCCTCCGAGCTTTCAGTGCG), which
is complementary to nucleotides 135 to 147 and 234 to 246 of the
yopE gene to produce plasmid pIL14 which encodes
YopE
50-77.
(v) pAPB24. SycE was amplified by PCR with oligonucleotides MIPA 599 (CGGGATCCTATTCATTTGAACAAGCTA), which is complementary to nucleotides 4 to 22 of sycE, and MIPA 521 (CTCAAGCTTCTACTCAACTAAATGACCG), which is identical to nucleotides 379 to 393 of sycE and four additional bases with pAPBD16 as a template (introduced restriction sites are underlined). The 400-bp product was digested with BamHI and HindIII and cloned into the corresponding sites of pQE-30 to create pAPB24.
Yop translocation assay.
The PU5-1.8 mouse
monocyte/macrophage cell line (ATCC TIB-61) used in these studies was
grown in RPMI 1640 medium (Gibco BRL) supplemented with 10% (wt/vol)
fetal bovine serum, 2 mM L-glutamine, and streptomycin, 100 µg · ml
1. Translocation assays were carried out
essentially as described by Sory and Cornelis (29). Cells
were seeded into 24-well tissue culture plates at a density of 5 × 105 cells per ml of medium per well and allowed to
adhere for 20 h. Before infection with Y. enterocolitica, cells were washed and covered with RPMI 1640 supplemented only with 2 mM L-glutamine. Cytochalasin D was
added 30 min before infection, at a final concentration of 5 µg
ml
1 (stock solution, 2 mg ml
1 in dimethyl
sulfoxide). Cytochalasin D is not toxic to Y. enterocolitica at this concentration (29). A freshly isolated
transconjugant colony of Y. enterocolitica was cultured
overnight at 22°C and diluted the next day to an optical density at
600 nm of 0.2 in 5 ml of BHI medium. After being grown with shaking at
22°C for 2 h, bacteria were washed and suspended in saline.
Samples of 100 µl, containing about 107 bacteria
(multiplicity of infection, 20:1), were added to the monolayer, and the
infected cultures were incubated at 37°C for 2 h in a 6%
CO2 atmosphere. Cells were washed and then lysed under denaturing conditions (100°C for 5 min in 50 mM HCl and 0.1%
[wt/vol] Triton X-100). The lysate was neutralized by NaOH, and
cyclic AMP (cAMP) was extracted with ethanol. After centrifugation, the supernatant was dried, and cAMP was assayed by an enzyme immunoassay (Biotrak Amersham). All experiments were performed three times.
Cytotoxicity assay.
The HeLa human epithelial cell line
(ATCC CCL-2) used in these studies was grown in RPMI 1640 supplemented
with 10% (wt/vol) fetal bovine serum, 2 mM L-glutamine,
and streptomycin (100 µg · ml
1) and prepared
similarly to the PU5-1.8 macrophages as described above except that the
HeLa cells were seeded at a density of 7 × 104
cells · ml
1. Bacteria were pregrown as described
above, and cells were infected with Y. enterocolitica at a
multiplicity of infection of 70. Two to three hours after infection,
the morphology of the cells was observed by phase-contrast microscopy.
The cells became rounded as a result of cytotoxicity.
Staining of actin filaments with phalloidin. Rat I fibroblasts grown on coverslips were infected with the different strains. After 2.5 h of infection, the cells were fixed in 2% (wt/vol) paraformaldehyde for 20 min. After being washed with phosphate-buffered saline (PBS) (136 mM NaCl, 2.7 mM KCl, 10.1 mM Na2HPO4, 1.8 mM KH2PO4 [pH 7.4]), membranes were permeabilized with 0.5% (wt/vol) Triton X-100 in PBS for 10 min. Cells were then incubated for 40 min at 37°C with fluorescein isothiocyanate-conjugated phalloidin. Samples were mounted on Mowiol and examined by fluorescence microscopy.
SycE-binding assays.
Native SycE was produced and purified
as described in reference 33. His6-SycE
was produced in E. coli XL-1 Blue(pAPB24) and purified on a
His-Trap column by elution with 300 mM imidazole according to the
manufacturer's instructions (Pharmacia Biotech). Total cell proteins
of Y. enterocolitica were separated by SDS-PAGE and
transferred to nitrocellulose membranes. After blockage in PBST plus
BSA (PBS plus 0.1% Tween 20 plus 0.5% bovine serum albumin [BSA]),
the membrane was incubated with His6-SycE (0.5 µg · ml
1) in PBST plus BSA for 2 h at room
temperature. Bound SycE or His6-SycE was revealed with
anti-SycE or anti-His antibody (Pharmacia Biotech), respectively,
followed by HRP-conjugated secondary antibody and chemiluminescence detection.
| |
RESULTS |
|---|
|
|
|---|
Translocation of YopE15-Cya into eukaryotic cells
by Yop effector polymutant Y. enterocolitica.
It has been
previously demonstrated that wt bacteria deliver
YopE130-Cya, but not YopE15-Cya, into
eukaryotic cells, suggesting that the 5' secretion signal is not
sufficient for YopE translocation (28). We repeated
these experiments using
HOPEM polymutant bacteria that
lack the YopH, YopO, YopP, YopE, and YopM effectors (Table 1). Delivery
of YopE15-Cya (encoded by plasmid pMSLE15 [8]) into the PU5-1.8 macrophage-monocyte cell line by
HOPEM and by wt Y. enterocolitica was compared. As a
control, translocation of YopE130-Cya (encoded by plasmid
pMS111 [29]) by the same bacteria was also monitored.
In agreement with previously published results (28),
wt bacteria delivered YopE130-Cya, but not
YopE15-Cya, into eukaryotic cells. In
contrast,
HOPEM bacteria delivered YopE15-Cya just as efficiently as
YopE130-Cya (Table 2).
Likewise, YopE20-Cya, YopE24-Cya, and
YopE30-Cya (28) were delivered into eukaryotic cells by
HOPEM bacteria (data not shown). To confirm that delivery of YopE15-Cya into eukaryotic cells by
HOPEM bacteria was due to the type III
secretion-translocation system, the delivery of
YopE15-Cya by
HOPEMYscN bacteria (secretion
deficient) and
HOPEMYopB and
HOPEMYopD bacteria (both
translocation deficient) was tested (Table 2). YopE15-Cya
was not translocated by these strains, confirming that
YopE15-Cya was indeed delivered into eukaryotic cells by
the type III injectisome (Table 2). To assess the necessity for the 5'
secretion signal, delivery of Cya fused to the first two amino acids of
YopE (encoded by plasmid pMSL56) (Table 1) into eukaryotic cells was
measured. This fusion protein was not delivered into macrophages
by either wt (0.1 ± 0.1 nmole of cAMP/mg) or
HOPEM
(0.1 ± 0.1 nmole of cAMP/mg) bacteria, showing that a Yop
secretion signal is required for delivery of a protein by
HOPEM Y. enterocolitica. These results show that the
translocation system of
HOPEM bacteria is still specific for the
Yops. In conclusion, translocation of YopE-Cya hybrids is possible
without the previously described translocation domain, which comprises
amino acids 15 to 50, but not without the 5' secretion signal (residues
or codons 1 to 15 and upstream RNA).
|
Production and secretion levels of YopE15-Cya by wt and
HOPEM bacteria.
It was next investigated whether the
delivery of YopE15-Cya by
HOPEM, but not wt Y. enterocolitica, could result from differences between strains in
the production and secretion of this hybrid protein. Protein levels
were analyzed following growth of the bacteria in
Ca2+-chelating conditions, which induce Yop production and
release. No differences were seen between the two strains in the levels of YopE15-Cya associated with the bacteria or released into
the extracellular medium (Fig. 1A and
Fig. 1B, lanes 5 and 6). Secretion of YopE15-Cya by both
strains was strictly dependent on the Ysc system, since no secretion
was observed in a yscN background (Fig. 1C). Although Yop
release upon Ca2+ chelation may not necessarily reflect
exactly what occurs upon contact of Y. enterocolitica with
eukaryotic cells, these data do show that synthesis of the two fusion
proteins and their passage through the bacterial membranes was equally
efficient in the two strains and equally dependent on Ysc. The only
difference between the two strains with regard to
YopE15-Cya was thus the level of translocation of this
protein into eukaryotic cells (Table 2). This suggests that the
presence of additional Yops in the wild type directly reduces
translocation of YopE15-Cya and that in order to enter into
eukaryotic cells the Yops must thus compete with one another for
passage through the secretion-translocation machinery.
|
Influence of SycE on secretion and translocation of
YopE15-Cya.
In order to investigate the
requirement for SycE for translocation of YopE15-Cya and
YopE130-Cya into eukaryotic cells, an sycE
mutation was introduced into the wt and
HOPEM strains
(Table 1). The experiment was carried out with plasmids pMS111 and
pMSLE15, which encode SycE along with YopE130-Cya and
YopE15-Cya, respectively, and with plasmids pMSL30 and
pAPBD18, which encode only the YopE-Cya fusion proteins (Table 1). The
presence or absence of SycE did not affect the steady-state levels of
YopE130-Cya or YopE15-Cya associated with the
wt or
HOPEM bacteria when grown under BHI-Ox conditions (Fig.
1A). However, SycE was required for efficient secretion and
translocation of YopE130-Cya into eukaryotic cells not only
by wild-type but also by
HOPEM bacteria (Fig. 1B, compare lanes
1 and 3 and lanes 2 and 4; Table 2). In contrast, the presence or
absence of SycE did not influence secretion or translocation of
YopE15-Cya into eukaryotic cells by
HOPEM bacteria
(Fig. 1B, compare lanes 5 and 7 and lanes 6 and 8; Table 2). Thus,
efficient delivery of YopE15-Cya by
HOPEM bacteria
occurred in the absence of SycE. We conclude from this that SycE is
only required for efficient secretion and subsequent translocation when
its binding domain is present. However, when the chaperone binding
domain is present, the chaperone is required, irrespective of the
presence of other effectors.
Translocation into eukaryotic cells of YopE lacking the SycE
chaperone binding domain.
In order to confirm that codons or
amino acids 1 to 15 of YopE are sufficient to translocate YopE into
eukaryotic cells, we removed the chaperone binding domain
(YopE
17-77) from YopE (Fig.
2), and we checked this removal by a SycE
overlay experiment (33). Purified SycE or
His6-SycE bound YopE but failed to bind YopE
17-77, verifying that the chaperone binding domain had been deleted from the latter protein (Fig.
3B and D).
HOPEM bacteria could
not be used for cytotoxicity experiments because they still
produce the YopT cytotoxin (8). We thus turned to
THE
bacteria (Table 1), which do not induce any morphological changes
in eukaryotic cells (Fig. 4).
YopE
17-77 was produced and released by
THE
bacteria (Fig. 3A and 3C), and release of YopE
17-77 did
not occur in an yscN background (Fig. 5), confirming that this release was type
III dependent. Delivery was then assayed by monitoring the rounding up
of HeLa epithelial cells and by staining the actin of Rat-I cells.
THE Y. enterocolitica strains producing YopE or
YopE
17-77 were cytotoxic for HeLa epithelial
cells (results not shown) and Rat I fibroblasts (Fig. 4), while
THEB
bacteria producing YopE
17-77 were not cytotoxic,
indicating that translocation of YopE
17-77 was YopB
dependent. This result confirmed that the first 16 amino acids of YopE
are sufficient for delivery into eukaryotic cells and that the
chaperone binding domain is not required.
|
|
|
|
Competition could play an important role in determining the level
of translocation.
YopE15-Cya was delivered into
eukaryotic cells by
HOPEM bacteria, but not by wt bacteria,
suggesting that competition between the Yops is an important
determinant for secretion and translocation and that the
chaperone binding domain plays a significant role with regards
to this competition. To investigate this theory, the ability of
HOPEM bacteria to deliver YopE15-Cya (encoded by
pMSLE15) into eukaryotic cells when overproducing another Yop effector in trans was tested. Therefore, the translocation
of YopE15-Cya into eukaryotic cells by
HOPEM
bacteria overproducing YopH, YopO, YopP, YopE, or YopM was
measured.
HOPEM(pMSLE15)(pBC18R) served as a vector
control. In each case, the rate of translocation of
YopE15-Cya into eukaryotic cells was lower than
that of
HOPEM bacteria not overexpressing one of these Yop
effectors in trans (Table
3). In contrast, translocation into
eukaryotic cells of YopE130-Cya by
HOPEM was
unaffected by overproducing another Yop in trans. The
strongest effect on delivery of YopE15-Cya was observed with YopE and YopH (Table 3). As a control, we checked the
profile of proteins released by these strains upon Ca2+
chelation. This control (data not shown) confirmed the overproduction of the Yops encoded in trans. Unfortunately, it also showed
a concomitant reduction in the release of the Cya reporter and of the
translocators LcrV, YopB, and YopD, indicating that the previous results must be interpreted with caution. To circumvent these difficulties, presumably linked to titration, we tested whether YopE15-Cya could be delivered into cells by Y. enterocolitica bacteria missing only YopE (
YopE strain, plasmid
pAB4052). Delivery by the
YopE strain led to the synthesis of
2.7 ± 0.6 nmole of cAMP/mg of protein, while delivery by the wt
strain led only to the synthesis of 0.4 ± 0.2 nmole of cAMP/mg of
protein. Thus, lack of YopE alone significantly increased delivery of
YopE15-Cya into eukaryotic cells. These results are
consistent with the idea that amino acids 15 to 50 promote
translocation of YopE by wt bacteria by assisting YopE to compete with
other Yops for the secretion-translocation apparatus. If this was so,
one would expect that YopE deprived of its chaperone binding
domain (YopE
17-77) would not compete with
YopE15-Cya for delivery into eukaryotic cells. We thus overproduced YopE
17-77 in
trans, and we monitored translocation of
YopE15-Cya. As expected, overproduction of
YopE
17-77 did not inhibit translocation of
YopE15-Cya (Table 3). Thus, amino acids 15 to 50 of YopE,
in conjunction with SycE, seem to give YopE a competitive advantage
over the other Yops for the secretion-translocation process.
|
Role of proposed second secretion signal in translocation.
Since the first secretion signal (amino acids or codons 1 to 15)
was found to be sufficient for translocation into eukaryotic cells, we
wondered whether the second secretion signal (amino acids 15 to 100)
proposed by Cheng et al. (5) would also be sufficient
to direct translocation into eukaryotic cells by the Yop effector
multimutant strain
HOPEM. This second signal was previously
shown to be insufficient for delivery into eukaryotic cells by wt
bacteria (14). Therefore, three plasmids were constructed encoding YopE proteins lacking the first secretion signal (amino acids
or codons 2 to 15). Plasmid pAPB35 encodes
YopE
2-15. Plasmid pAPB36 encodes
YopE(+1[2-15]) in which amino acids 2 to 15 have
been shifted out of frame by the addition of 1 bp after the ATG and by
compensatory changes before codon 16. A similar construct has
previously been shown to have an inactive first secretion signal and to
be secreted by the proposed second secretion signal (5). As
well, plasmid pAPB37 encodes YopE
2-77. The three
constructs were checked first for their capacity to bind
His6-SycE in an overlay assay. As expected, YopE
2-77 did not bind SycE, while
YopE
2-15 and YopE(+1[2-15]) were
recognized by the chaperone (Fig. 3D). Each of the three proteins was
produced by
THE bacteria, but no secretion when grown in BHI-Ox
medium could be detected (Fig. 3A). This result was expected for
YopE
2-77, since it lacks both the first 5' signal and
the proposed second secretion signal, but not for the two others.
Surprised by the inability of amino acids 15 to 50 (the proposed
second secretion signal) to promote secretion of
YopE
2-15 or YopE(+1[2-15]), the
secretion of these proteins was tested under the same
minimal-medium conditions as those used by Cheng et al. (5).
Under these conditions, the proteins were produced but not secreted by
THE bacteria (Fig. 6). In accordance
with their non-secretion phenotype, neither
THE encoding
YopE
2-15,
THE encoding
YopE(+1[2-15]), nor
THE encoding
YopE
2-77 was cytotoxic for HeLa cells (data not shown)
and Rat I cells (Fig. 4).
|
2-15)-Cya and plasmid pAPBL48 encodes YopE130(+1[2-15])-Cya. These proteins were not
translocated into eukaryotic cells by either of these strains of
Y. enterocolitica (intracellular cAMP concentration, 0.1 ± 0.1 ng of cAMP/mg). From the experiments with modified
full-length YopE and YopE130-Cya, we conclude that under
our experimental conditions, the proposed second secretion signal is
not functional and that the only functional secretion signal for YopE
is contained within amino acids or codons 1 to 15.
A secretion-inhibitory sequence localized between residues 50 and
77.
While constructing plasmids encoding YopE deleted of its
SycE-binding site, we constructed pAPBG30, which encodes
YopE
17-49 (Table 1). Like YopE
17-77,
YopE
17-49 did not bind SycE in an overlay experiment,
since they both lack the chaperone binding domain at amino acids 15 to
50 (Fig. 3D). Unlike YopE
17-77, which was efficiently
secreted by Y. enterocolitica, YopE
17-49 was
neither secreted (Fig. 3A) nor delivered into HeLa (data not shown) and
Rat-I cells (Fig. 4), even though it was well produced (Fig. 3C). This
suggested that the portion of YopE between amino acids 49 and 77 inhibits YopE secretion and that binding of SycE overcomes this inhibition.
17-77, and this release was independent of SycE.
This contrasted with wt YopE, which was only released in the presence
of SycE (Fig. 5). Thus, amino acids 50 to 77 of YopE inhibit secretion
of YopE in the absence of SycE. Interestingly, although this construct
does not need SycE for secretion, it still binds SycE. Thus the
secretion-inhibitory domain is distinct from the minimal SycE-binding
domain, although this secretion-inhibitory domain must be somehow
covered by SycE.
| |
DISCUSSION |
|---|
|
|
|---|
In this paper, we have analyzed the N-terminal domain of Y. enterocolitica YopE in order to clarify its roles in the in vitro release of YopE and its delivery into eukaryotic cells.
The results, summarized in Fig. 7,
confirm previous data in showing that residues 1 to 50 of YopE are
required for delivery of YopE into eukaryotic cells by wt Y. enterocolitica (27, 28). However, the current results
also show that delivery of YopE by Yop effector multimutant bacteria
does not require amino acids 15 to 50 but rather that the secretion
signal encompassing amino acids or codons 1 to 15 is sufficient.
This implies that the chaperone binding domain does not need to
interact with the Yop translocators for Yop effector translocation. In
addition, this suggests that any protein that can be released by the
Ysc secretion machinery also has the capacity to be delivered into
eukaryotic cells. This conclusion hence implies a continuity between
the secretion and translocation apparatuses, so that a Yop can pass
through the secretion channel, syringe and needle, and then directly
through the translocation apparatus into the target cell.
|
The requirement for amino acids 15 to 50 for translocation of YopE into eukaryotic cells by wt Y. enterocolitica, but not by Yop effector multimutant bacteria, implies that these amino acids give YopE a competitive advantage over the other Yops for the Ysc secretion-translocation apparatus. Due to the competition, only the Yops that are avidly recognized by the Ysc apparatus would be successfully delivered inside eukaryotic cells. Competition between the Yops could determine the order of precedence of Yop entry into eukaryotic cells and/or the relative quantities of each Yop delivered inside a cell.
However, if there is continuity between secretion and translocation, how could one explain that domains 15 to 50 of YopE are required for translocation by wt bacteria but not for release of YopE under Ca2+-chelating conditions? This could be due to differences in the structure of the Ysc apparatus when opening is caused by Ca2+ chelation and when opening is triggered by contact with eukaryotic cells. It is possible that Ca2+ chelation shears the external part of the Ysc apparatus, resulting in a secretion channel (syringe) on the surface of the bacteria with an inner diameter that is much wider than that of the channel (needle) bridging the bacteria and the eukaryotic cell (Fig. 7). In support of this hypothesis, Ca2+ chelation leads to the release of some external parts of the Ysc apparatus, such as YscP (19, 30). Thus, passage through the secretion channel under Ca2+-chelating conditions would be far more abundant and far more permissive than upon bacteria-eukaryotic cell interaction.
In agreement with the observations of Lee et al. (14), domain encompassing amino acids 15 to 50 was not sufficient to direct YopE to the eukaryotic cytosol (14). However, unlike previous data (5), release of YopE to the extracellular milieu by this domain could not be detected, despite the use of various gene constructions, protein systems, and growth conditions. Although the same +1 frame-shift mutation of codons 2 to 15 was used here as that employed by Cheng et al. (5), in the present work the mutation was inserted in yopE and yopE130-cya, while Cheng et al. (5, 14) tested yopE-npt hybrids. This difference in protein backbone may explain the disparity of our results. In conclusion, the domain encompassing amino acids 15 to 50 is a secretion-translocation enhancer signal that is required for efficient delivery of YopE into eukaryotic cells by wt Y. enterocolitica, but it can not be considered as a physiological secretion signal.
Our results indicate that SycE plays a role as a factor introducing a hierarchical order in effector delivery, by abetting YopE to compete with the other Yops. This role should not be considered as exclusive, as SycE is required in addition when YopE contains amino acids 50 to 77. Indeed, the presence of this domain creates a need for the chaperone. This fits with older observations that bacteria missing SycE are unable to efficiently release or deliver full-length YopE or YopE130-Cya but are able to secrete YopE40-Cya (35). According to our previous observations, we suggested that it was the Syc-binding domain (residues 15 to 50) that created the need for the chaperone. The more refined present observations indicate that the secretion-inhibitory domain is localized immediately downstream of the minimal domain needed for Syc binding. Although residues 50 to 77 are neither sufficient nor necessary for SycE binding, they are likely to be covered by SycE. The determination of the three-dimensional structure of the YopE-SycE complex will clarify this.
The reason why residues 50 to 77 of YopE interfere with secretion of
YopE is not clear. These amino acids could interfere with secretion
through the Ysc machinery and/or they could affect the stability or
solubility of YopE. Recently, Cheng et al. (6) have shown
that SycE fused to glutathione S-transferase was unable to
complement
SycE bacteria for delivery of YopE into eukaryotic cells,
even though the SycE hybrid protein bound YopE in the bacterial cytosol
and stabilized this Yop (6). These experiments support the
results presented here, as they show that in addition to stabilizing YopE in the bacterial cytosol, SycE is also required for efficient Yop
translocation by wt bacteria. It seems that glutathione
S-transferase-SycE fusion proteins do not have this
secondary function. In conclusion, the data presented in this paper
present a more-complete picture of the functions of the N-terminal
domains of YopE for secretion and translocation of this protein. Amino
acids or codons 1 to 15 (secretion domain) are sufficient and
absolutely necessary to direct translocation of YopE into eukaryotic
cells by Yop effector multimutant Y. enterocolitica. Amino
acids 15 to 50 bind the SycE chaperone and aid YopE to compete with the
other Yops for entry into eukaryotic cells via the
secretion-translocation machinery. Finally, amino acids 49 to 77 are
inhibitory to YopE secretion, and this inhibition is overcome by
binding of SycE to amino acids 15 to 50. Future crystallography studies
of YopE alone and in complex with SycE will be very beneficial to the
further studies of these domains, as would detailed studies on the
other Yop-Syc interactions. It will be of great interest to investigate
whether these other combinations have properties similar to those of
YopE and SycE described here.
| |
ACKNOWLEDGMENTS |
|---|
We thank D. Desnoeck for excellent technical assistance and N. Grosdent for assistance with plasmid constructions. We also thank S. Tötemeyer, C. Geuijen, S. Bleves, N. Sauvonnet, and I. Stainier for discussions and a critical reading of the manuscript. In addition, we are grateful to Cecile Geuijen for plasmid pYOB2, Marie-Paule Sory and Corinne Kerbouch for plasmid pMSL56 and strain MRS40(pMSK50), and Maite Iriarte for pIM153.
A.P.B. was the recipient of an H. and A. Brenninkmeijer ICP fellowship
and also received funding from EU TMR Programme Research Network
contract FMRX-CT98-0164. This work was supported by the Belgian Fonds
National de la Recherche Scientifique Médicale (Convention
3.4595.97), the Direction générale de la Recherche Scientifique-Communauté Française de Belgique (Action de
Recherche Concertée 94/99-172) and the Interuniversity Poles of
Attraction Program
Belgian State, Prime Minister's Office, Federal
Office for Scientific, Technical and Cultural affairs (PAI 4/03).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Microbial Pathogenesis Unit, Université de Louvain, Avenue Hippocrate, 74, UCL 74.49, B-1200 Brussels, Belgium. Phone: (32)(2)764 74 49. Fax: (32)(2)764 74 98. E-mail: cornelis{at}mipa.ucl.ac.be.
Present address: Intercell, A-1030 Vienna, Austria.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Anderson, D. M., and O. Schneewind.
1997.
A mRNA signal for the type III secretion of Yop proteins by Yersinia enterocolitica.
Science
278:1140-1143 |
| 2. | Anderson, D. M., and O. Schneewind. 1999. Yersinia enterocolitica type III secretion: an mRNA signal that couples translation and secretion of YopQ. Mol. Microbiol. 31:1139-1148[CrossRef][Medline]. |
| 3. |
Boland, A., and G. R. Cornelis.
1998.
Role of YopP in suppression of tumor necrosis factor alpha release by macrophages during Yersinia infection.
Infect. Immun.
66:1878-1884 |
| 4. | Boland, A., M.-P. Sory, M. Iriarte, C. Kerbourch, P. Wattiau, and G. R. Cornelis. 1996. Status of YopM and YopN in the Yersinia Yop virulon: YopM of Y. enterocolitica is internalized inside the cytosol of PU5-1.8 macrophages by the YopB, D, N delivery apparatus. EMBO J. 15:5191-5201[Medline]. |
| 4a. | Boyd, A. P., N. Grosdent, S. Tötemeyer, C. Geuijen, S. Bleves, M. Iriarte, I. Lambermont, J.-N. Octave, and G. R. Gornelis. Yersinia enterocolitica can deliver Yop proteins into a wide range of cell types: development of a delivery system for heterologous proteins. Eur. J. Cell Biol., in press. |
| 5. | Cheng, L. W., D. M. Anderson, and O. Schneewind. 1997. Two independent type III secretion mechanisms for YopE in Yersinia enterocolitica. Mol. Microbiol. 24:757-765[CrossRef][Medline]. |
| 6. |
Cheng, L. W., and O. Schneewind.
1999.
Yersinia enterocolitica type III secretion. On the role of SycE in targeting YopE into HeLa cells.
J. Biol. Chem.
274:22102-22108 |
| 7. | China, B., T. Michiels, and G. R. Cornelis. 1990. The pYV plasmid of Yersinia encodes a lipoprotein, YlpA, related to TraT. Mol. Microbiol. 4:1585-1593[CrossRef][Medline]. |
| 8. |
Cornelis, G. R.,
A. Boland,
A. P. Boyd,
C. Geuijen,
M. Iriarte,
C. Neyt,
M.-P. Sory, and I. Stainier.
1998.
The virulence plasmid of Yersinia, an antihost genome.
Microbiol. Mol. Biol. Rev.
62:1315-1352 |
| 9. | Cornelis, G. R., J. C. Vanooteghem, and C. Sluiters. 1987. Transcription of the yop regulon from Y. enterocolitica requires trans acting pYV and chromosomal genes. Microb. Pathog. 2:367-379[CrossRef][Medline]. |
| 10. | Frithz-Lindsten, E., R. Rosqvist, L. Johansson, and A. Forsberg. 1995. The chaperone-like protein YerA of Yersinia pseudotuberculosis stabilizes YopE in the cytoplasm but is dispensible for targeting to the secretion loci. Mol. Microbiol. 16:635-647[CrossRef][Medline]. |
| 10a. |
Galan, J. E., and A. Collmer.
1999.
Type III secretion machines: bacterial devices for protein delivery into host cells.
Science.
284:1322-1328 |
| 11. | Håkansson, S., E. E. Galyov, R. Rosqvist, and H. Wolf-Watz. 1996. The Yersinia YpkA Ser/Thr kinase is translocated and subsequently targeted to the inner surface of the HeLa cell plasma membrane. Mol. Microbiol. 20:593-603[CrossRef][Medline]. |
| 12. | Håkansson, S., K. Schesser, C. Persson, E. E. Galyov, R. Rosqvist, F. Homble, and H. Wolf-Watz. 1996. The YopB protein of Yersinia pseudotuberculosis is essential for the translocation of Yop effector proteins across the target cell plasma membrane and displays a contact-dependent membrane disrupting activity. EMBO J. 15:5812-5823[Medline]. |
| 13. | Kaniga, K., I. Delor, and G. R. Cornelis. 1991. A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137-141[CrossRef][Medline]. |
| 14. | Lee, V. T., D. M. Anderson, and O. Schneewind. 1998. Targeting of Yersinia Yop proteins into the cytosol of HeLa cells: one-step translocation of YopE across bacterial and eukaryotic membranes is dependent on SycE chaperone. Mol. Microbiol. 28:593-601[CrossRef][Medline]. |
| 15. | Lee, V. T., and O. Schneewind. 1999. Type III machines of pathogenic yersiniae secrete virulence factors into the extracellular milieu. Mol. Microbiol. 31:1619-1629[CrossRef][Medline]. |
| 16. |
Michiels, T., and G. R. Cornelis.
1991.
Secretion of hybrid proteins by the Yersinia Yop export system.
J. Bacteriol.
173:1677-1685 |
| 17. |
Mills, S. D.,
A. Boland,
M.-P. Sory,
P. Van Der Smissen,
C. Kerbourch,
B. B. Finlay, and G. R. Cornelis.
1997.
YopP, a novel Yersinia effector protein, is delivered into macrophages to induce apoptosis.
Proc. Natl. Acad. Sci. USA
94:12638-12643 |
| 18. | Neyt, C., and G. R. Cornelis. 1999. Insertion of a Yop translocation pore into the macrophage plasma membrane: requirement for YopB and YopD, but not LcrG. Mol. Microbiol. 33:971-981[CrossRef][Medline]. |
| 19. |
Payne, P. L., and S. C. Straley.
1999.
YscP of Yersinia pestis is a secreted component of the Yop secretion system.
J. Bacteriol.
181:2852-2862 |
| 20. | Persson, C., R. Nordfelth, A. Holmström, S. Håkansson, R. Rosqvist, and H. Wolf-Watz. 1995. Cell-surface-bound Yersinia translocate the protein tyrosine phosphatase YopH by a polarized mechanism into the target cell. Mol. Microbiol. 18:135-150[CrossRef][Medline]. |
| 21. | Rosqvist, R., A. Forsberg, M. Rimpiläinen, T. Bergman, and H. Wolf-Watz. 1990. The cytotoxic protein YopE of Yersinia obstructs the primary host defence. Mol. Microbiol. 4:657-667[Medline]. |
| 22. |
Rosqvist, R.,
A. Forsberg, and H. Wolf-Watz.
1991.
Intracellular targeting of the Yersinia YopE cytotoxin in mammalian cells induces actin microfilament disruption.
Infect. Immun.
59:4562-4569 |
| 23. | Rosqvist, R., K. E. Magnusson, and H. Wolf-Watz. 1994. Target cell contact triggers expression and polarized transfer of Yersinia YopE cytotoxin into mammalian cells. EMBO J. 13:964-972[Medline]. |
| 24. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 25. |
Sarker, M. R.,
C. Neyt,
I. Stainier, and G. R. Cornelis.
1998.
The Yersinia Yop virulon: LcrV is required for extrusion of the translocators YopB and YopD.
J. Bacteriol.
180:1207-1214 |
| 26. |
Sarker, M. R.,
M.-P. Sory,
A. P. Boyd,
M. Iriarte, and G. R. Cornelis.
1998.
LcrG controls internalization of Yersinia Yop effector proteins into eukaryotic cells.
Infect. Immun.
66:2976-2979 |
| 27. |
Schesser, K.,
E. Frithz-Lindsten, and H. Wolf-Watz.
1996.
Delineation and mutational analysis of the Yersinia pseudotuberculosis YopE domains which mediate translocation across bacterial and eukaryotic cellular membranes.
J. Bacteriol.
178:7227-7233 |
| 28. |
Sory, M.-P.,
A. Boland,
I. Lambermont, and G. R. Cornelis.
1995.
Identification of the YopE and YopH domains required for secretion and internalization into the cytosol of macrophages, using the cyaA gene fusion approach.
Proc. Natl. Acad. Sci. USA
92:11998-12002 |
| 29. | Sory, M.-P., and G. R. Cornelis. 1994. Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol. Microbiol. 14:583-594[Medline]. |
| 30. | Stainier, I., S. Bleves, C. Josenhans, L. Karmani, C. Kerbourch, I. Lambermont, S. Tötemeyer, A. Boyd, and G. R. Cornelis. YscP, a Yersinia protein required for Yop secretion that is surface exposed, and released in low Ca2+. Mol. Microbiol., in press. |
| 31. | Von Pawel-Rammingen, U., M. V. Telepnev, G. Schmidt, K. Aktories, H. Wolf-Watz, and R. Rosqvist. 2000. GAP activity of the Yersinia YopE cytotoxin specifically targets the Rho pathway: a mechanism for disruption of action microfilament structure. Mol. Microbiol. 36:737-748[CrossRef][Medline]. |
| 32. |
Wattiau, P.,
B. Bernier,
P. Deslee,
T. Michiels, and G. R. Cornelis.
1994.
Individual chaperones required for Yop secretion by Yersinia.
Proc. Natl. Acad. Sci. USA
91:10493-10497 |
| 33. | Wattiau, P., and G. R. Cornelis. 1993. SycE, a chaperone-like protein of Yersinia enterocolitica involved in the secretion of YopE. Mol. Microbiol. 8:123-131[Medline]. |
| 34. |
Woestyn, S.,
A. Allaoui,
P. Wattiau, and G. R. Cornelis.
1994.
YscN, the putative energizer of the Yersinia Yop secretion machinery.
J. Bacteriol.
176:1561-1569 |
| 35. | Woestyn, S., M.-P. Sory, A. Boland, O. Lequenne, and G. R. Cornelis. 1996. The cytosolic SycE and SycH chaperones of Yersinia protect the region of YopE and YopH involved in translocation across eukaryotic cell membranes. Mol. Microbiol. 20:1261-1271[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»