Previous Article | Next Article 
Journal of Bacteriology, September 2000, p. 4822-4828, Vol. 182, No. 17
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Analysis of Genetic Elements Controlling
Staphylococcus aureus lrgAB Expression: Potential Role of
DNA Topology in SarA Regulation
David F.
Fujimoto,
Eric W.
Brunskill,
and
Kenneth W.
Bayles*
Department of Microbiology, Molecular Biology
and Biochemistry, University of Idaho, Moscow, Idaho 83844-3052
Received 29 March 2000/Accepted 16 June 2000
 |
ABSTRACT |
Penicillin-induced killing and murein hydrolase activity in
Staphylococcus aureus are dependent on a variety of
regulatory elements, including the LytSR two-component regulatory
system and the virulence factor regulators Agr and Sar. The LytSR
effects on these processes can be explained, in part, by the recent
finding that a LytSR-regulated operon, designated lrgAB,
affects murein hydrolase activity and penicillin tolerance. To
examine the regulation of lrgAB expression in greater
detail, we performed Northern blot and promoter fusion analyses. Both
methods revealed that Agr and Sar, like LytSR, positively regulate
lrgAB expression. A mutation in the agr locus
reduced lrgAB expression approximately sixfold, while the
sar mutation reduced lrgAB expression to
undetectable levels. cis-acting regulatory elements
involved in lrgAB expression were identified by fusing
various fragments of the lrgAB promoter region to the
xylE reporter gene and integrating these constructs into
the chromosome. Catechol 2,3-dioxygenase assays identified DNA
sequences, including an inverted repeat and intrinsic bend sites, that
contribute to maximal lrgAB expression. Confirmation of the
importance of the inverted repeat was achieved by demonstrating that multiple copies of the inverted repeat reduced lrgAB
promoter activity, presumably by titrating out a positive regulatory
factor. The results of this study demonstrate that lrgAB
expression responds to a variety of positive regulatory factors and
suggest that specific DNA topology requirements are important for
optimal expression.
 |
INTRODUCTION |
Peptidoglycan or murein hydrolases
are a family of enzymes that catalyze the cleavage of specific
structural components of the bacterial cell wall. These enzymes are
involved in several important physiological processes, including
peptidoglycan turnover and recycling, cell wall
expansion during bacterial growth, septation, and daughter cell
separation (13, 32). Due to the potential of these enzymes
to compromise cell wall integrity, leading to cell lysis (autolysis),
murein hydrolase activity must be carefully regulated. This regulation
includes transcriptional control, blocked access to the specific
substrate, inhibition by choline or teichoic acid, and substrate
modification (13, 32).
The Staphylococcus aureus lytS and lytR genes,
whose products are members of the two-component regulator family of
proteins, are involved in the control of murein hydrolase activity
(3). A lytS mutant phenotypically displays
altered murein hydrolase activity and an increased rate of penicillin-
and Triton X-100-induced lysis (3, 11). Immediately
downstream of lytS and lytR are two genes,
lrgA and lrgB, whose transcription is dependent
upon lytS and lytR. LrgA and LrgB show no
sequence similarity to known murein hydrolases. Instead, LrgA has
structural characteristics in common with the bacteriophage-encoded
holin proteins involved in murein hydrolase export (4, 11).
Recent data generated in our laboratory indicate that the LrgA and LrgB
gene products inhibit extracellular murein hydrolase activity and
increase tolerance to penicillin (11). Based on these data,
it was proposed that the function of LrgA, and possibly LrgB, is
analogous to that of an antiholin, i.e., blocking murein hydrolase
access to the substrate peptidoglycan (1).
In another study, we have shown that the staphylococcal virulence
factor regulators Agr and Sar affect the rate of penicillin-induced lysis and killing (7). Mutations within the agr
and sar genes result in decreased and increased rates of
penicillin-induced lysis, respectively, possibly as a result of the
different effects that these mutations have on murein hydrolase
activity. In contrast, both mutant strains exhibited increased
sensitivity to the bactericidal effects of penicillin, including the
agr mutant, which exhibited reduced penicillin-induced
lysis. These data demonstrate that, in addition to controlling
virulence factor expression, Agr and Sar affect murein hydrolase
activity and penicillin tolerance.
In the present study, we have extended our analysis of lrgAB
regulation. We show that Agr and Sar, in addition to the LytSR regulatory system, positively regulate lrgAB expression. We
also identified and characterized lrgAB cis-acting elements,
including a region of intrinsic DNA bending (curvature), which
contribute to maximal lrgAB expression. These data suggest
that the effects of Agr and Sar on penicillin tolerance involve the
regulation of lrgAB expression.
 |
MATERIALS AND METHODS |
Strains and growth conditions.
S. aureus strains
(Table 1) were routinely cultivated in
tryptic soy broth (Difco Laboratories, Detroit, Mich.) or NZY broth (3% casein enzymatic hydrolysate [Sigma Chemical Co., St. Louis, Mo.], 1% yeast extract [Fisher Scientific, Fair Lawn, N.J.]
adjusted to pH 7.5). Escherichia coli DH5
(14)
was grown in Luria-Bertani medium (Fisher Scientific). Liquid cultures
were grown with shaking at 250 rpm and 37°C. The antibiotics used
were purchased from either Sigma Chemical Co. or Fisher Scientific and
used at the following concentrations: ampicillin, 50 µg/ml;
chloramphenicol, 5 µg/ml; tetracycline, 3 µg/ml; kanamycin, 50 µg/ml; spectinomycin, 50 µg/ml.
DNA manipulations.
S. aureus genomic DNA was isolated
using the method of Dyer and Iandolo (6). Plasmid DNA
purification was performed using the Wizard Plus kits from Promega,
Inc. (Madison, Wis.). The restriction enzymes and T4 DNA ligase used in
this study were purchased from GIBCO-BRL (Gaithersburg, Md.).
Preparation and transformation of E. coli DH5
were
accomplished as described by Inoue et al. (14).
Electroporation of DNA into S. aureus was carried out using
the procedure of Kraemer and Iandolo (17). S. aureus
11-mediated transduction was performed using the method
of Shafer and Iandolo (30).
Northern blot analysis.
S. aureus RNA was isolated
using the procedure described by Hart et al. (12). A
lrgA-specific probe was PCR amplified using the primers
5'-CCAGCACACTTTTTTCACC-3' and
5'-GGTGCTTGGCTAATGACACC-3', producing a 260-bp fragment. The
PCR products were gel purified and radiolabeled with
[
-32P]ATP by the random priming method as described
previously (28). Northern blot analysis was performed as
described by Sambrook et al. (28).
lrgAB promoter fusion construction.
To construct
a single-copy reporter gene vector, the xylE reporter gene
encoding the catechol 2,3-dioxygenase enzyme was PCR amplified from the
plasmid pCR100. This was achieved using the M13 reverse primer as the
3' primer and a 5' primer designated EX
(5'-CCTGAAT TCATGACTCGAGAAGAGGTGACGTCATGAACAAAGGTGTAATGCG ACC-3') containing EcoRI and XhoI restriction sites
(underlined). The amplified product was digested with EcoRI
and BamHI and directionally ligated into the integration
vector pCL84 (18). The resulting plasmid, designated pDF16,
contained a promoterless xylE gene downstream of two
EcoRI and XhoI restriction sites available for cloning. To examine specific sequences involved in lrgAB
expression, PCR amplification was employed to generate consecutively
smaller lrgAB promoter fragments. Four different 5'
oligomers that anneal to selected regions upstream of the
lrgA gene
(5'-CCTGTTGAAATTGAATTCAAAATTCACATGTTAAAGC-3', 5'-AATGGTGTCAGAATTCAAGTTGGACGTCCA-3',
5'-TACTTTAACAGGAATTCTTTTTTTTATGC-3', and
5'-TTGTATTCGAATTCAAATCACGCAAATCG-3') were used
in separate reactions with the same 3' oligomer
(5'-CCGGAAGCTTGTGCTGGTTTTGATGCGTC-3'). All four
5' oligomers generate an EcoRI restriction site
(underlined), while the 3' oligomer produces a HindIII
site beginning at position +60 with respect to the transcription start
site. The PCRs produced products designated AB396,
147,
85 and
42, respectively, where the names refer to the 5' base present in
each fragment with respect to the transcription start site of the
lrgA gene (see Fig. 1). These fragments were digested with
EcoRI and HindIII and directionally cloned
into the polylinker of pBluescriptSK(+) (Stratagene), transformed into
DH5
, and sequenced using the method developed by Sanger et al.
(29). Each fragment was liberated from pBluescriptSK(+) by
sequential restriction digestion using EcoRI and
XhoI and ligated in front of the xylE gene in
pDF16, producing plasmids pDF17, pDF36, pDF35, and pDF34, respectively
(Table 1). These plasmids (along with pDF16) were electroporated into
S. aureus CYL316, where they specifically integrated into
the geh locus encoding lipase (18). The
integrated loci were transferred into RN6390 by
11-mediated
transduction, producing strains designated KB700, KB707, KB706, and
KB705 that were used for reporter gene assays (Table 1). Proper
integration of the promoter fusion constructs was confirmed by Southern
blot analysis and/or PCR analysis using the 5' primer employed for the
production of the promoter fragment along with a second oligomer
(5'-GTTCTGCACCTTTACGTTG-3') that is complementary to a DNA
sequence downstream of the attB integration site within the
geh locus (19).
Reporter gene assays.
Assays of catechol 2,3-dioxygenase
activity were performed by growing S. aureus strains
containing the reporter gene in 20 ml of NZY medium for 12 h
(stationary phase). A 10-ml sample was removed, and the cells were
pelleted by centrifugation at 4,000 × g. The cell
pellet was washed with 10 ml of TES buffer (50 mM Tris-HCl [pH 7.5],
10 mM EDTA, 30 mM NaCl) and pelleted a second time. The cell pellet was
resuspended in 2 ml of lysis buffer (100 mM potassium acetate, 10%
acetone, 20 mM EDTA), and cells were lysed by incubation at 37°C in
the presence of lysostaphin (AMBI Inc., Tarrytown, N.Y.) at 50 µg/ml.
The cell lysate was homogenized by repeated passage through an 18-gauge
needle, and then the cellular debris was removed by centrifugation at
27,000 × g. The clarified lysate was assayed for
catechol 2,3-dioxygenase activity as described by Zukowski et al.
(37). Specific activity units are defined as milliunits of
the product generated divided by the total cellular protein used in
each reaction mixture (1 mU corresponds to the formation of 1 nmol of
2-hydroxymuconic semialdehyde per min at 37°C). Total cellular
protein concentration was determined using a Bradford protein assay kit
(Bio-Rad, Richmond, Calif.) with bovine serum albumin as the standard.
Two-dimensional polyacrylamide gel electrophoresis.
A
two-dimensional electrophoresis assay to assess the presence of
intrinsic DNA bending was performed as described by Rohde et al.
(26). Briefly, the far left lane(s) of a 5% nondenaturing polyacrylamide gel was loaded with 1 µg of a 1-kb DNA ladder
(GIBCO-BRL) along with a mixture of EcoRI- and
HindIII-digested plasmid clones that liberated different
fragments originating from the lrgAB promoter region. The
fragments were separated in the first dimension at 65°C for 30 min at
100 V. The gel was then rotated 90°, and the fragments were separated
in the second dimension by electrophoresis at 4°C for 5 h at 80 V. The DNA fragments were stained with ethidium bromide and then
visualized with UV light.
Site-directed mutagenesis.
A PCR-based strategy
described by Chen and Przybyla (5) was used to
generate site-directed changes in the lrgAB promoter region.
The 3' primers
5'-TAGGTAAAATGCATAAGCTAAAAAAAAGGATTACTGTTAAAG-3', 5'-TAGGTAAAATGCAGCTCTAGACATAAAAAAAAGGATTACTGTTAAAG-3',
and 5'-GGTAAATGCATAAAAAAAATCGACGCTTTAAAATC-3' were designed to generate lrgAB promoter fragments
containing 5- and 10-bp insertions and the inverted repeat deletion,
respectively (the 5- and 10-bp insertions and the point of deletion in
the primers are underlined). These primers were used in PCRs along with
a common 5' primer, 5'-CCTGTTGAAATTGAATTCAAAATTCACATGTTAAAGC-3'. The PCR fragments generated were used in a second round of
amplification along with the downstream 3' primer
5'-CCGGAAGCTTGTGCTGGTTTTGATGCGTC-3', which amplifies the
entire lrgAB promoter region.
 |
RESULTS |
Regulatory elements involved in lrgAB expression.
In previous studies, it was shown that a lytS mutation
resulted in altered murein hydrolase activity, increased Triton X-100- and penicillin-induced lysis, and undetectable lrgAB
transcription (3, 4, 11). Given that the lrgAB
operon is located immediately downstream of the lytSR locus
(Fig. 1), the possibility that the lytS mutation has a polar effect on lrgAB could
not be ruled out. Thus, to examine the effects of LytSR on
lrgAB expression in greater detail, an lrgAB-xylE
promoter fusion construct was introduced into the lytS
mutant KB300 (3) and the parental strain 8325-4, which were
assayed for catechol 2,3-dioxygenase activity (Fig. 2A). The cloned lrgAB promoter
region produced 3.27 ± 0.60 U of catechol 2,3-dioxygenase
specific activity in 8325-4. In contrast, KB300 produced undetectable
levels of catechol 2,3-dioxygenase activity. These data demonstrate
that the gene products produced by the lytSR operon activate
lrgAB transcription in trans, either directly or
indirectly.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence of the S. aureus lrgAB
promoter region. The potential ribosome binding sites and the 10 and
35 promoter elements are underlined and in bold. The asterisks mark
the two transcription start sites identified previously (4).
The translational stop site for the lytR gene and the
translational start site for the lrgA structural gene are in
bold. The four boxed sequences highlight AT tracts, and inverted repeat
sequences are indicated by arrows.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Catechol 2,3-dioxygenase assays. (A) Reporter gene
assays of 8325-4 (wild-type [wt]) and KB300 (lytSR mutant)
strains containing the plasmid reporter gene pDF3 (Table 1). (B) Enzyme
activity detected in the virulence regulator mutants using the
integrated reporter gene system with the full-length promoter (AB396).
RN6390, wild type; RN6390 agr-1, agr mutant;
ALC488, sar mutant. Control strain RN6390, containing
promoterless reporter gene plasmid pDF16, did not produce detectable
enzyme activity. The specific activities shown are averages of three
independent experiments reported in milliunits (1 mU equals 1 nmol of
2-hydroxymuconic semialdehyde min 1 mg of total
protein 1).
|
|
In addition to the LytSR regulatory system, we have also shown that the
S. aureus Agr and Sar virulence regulators affect
murein
hydrolase activity and the rates of penicillin-induced
lysis and
killing of
S. aureus cells (
7). In light of the
recent
finding that the
lrgAB operon increases tolerance to
penicillin
and inhibits murein hydrolase activity (
11), it
is possible
that Agr and Sar influence these processes via
lrgAB. To test
this hypothesis, Northern blot analyses were
used to compare
lrgAB mRNA levels in
agr and
sar mutants and the parental wild-type
strain. Using a
lrgAB-specific probe, the level of
lrgAB
transcription
was monitored in late-exponential-phase cells, when the
lrgAB operon is maximally expressed (
11). As
shown in Fig.
3, the
agr
mutant RN6911 produced a greater-than-sixfold decrease in
the
lrgAB transcript compared to the wild-type strain. The
sar and
agr sar mutant strains produced
undetectable levels of the
lrgAB transcript. Thus, Agr and
Sar, in addition to LytSR, are
involved in the regulation of
lrgAB expression.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Northern blot analysis. Total RNA was isolated from
S. aureus strains RN6390 (wild type [wt]), RN6911
(agr), ALC136 (sar), and ALC135 (agr
sar), and 10-µg samples were separated in a 1% formaldehyde
gel. Hybridization was performed using an lrgA-specific
probe.
|
|
To further examine the
agr and
sar effects on
lrgAB expression, we generated a promoter fusion vector,
pDF16, that takes advantage
of the pCL84 plasmid integration system
(
18). This allowed the
integration of
lrgAB
promoter fusions, in single copy, into the
bacteriophage L54a
attB site within the staphylococcal chromosome,
thus giving
a better representation of promoter activity compared
to plasmid-based
reporter gene systems. Plasmid pDF17 (containing
a 456-bp
lrgAB promoter fragment designated AB396; Fig.
1) was
integrated into the chromosome of
S. aureus CYL316 and then
transduced
into wild-type strain RN6390,
agr mutant strain
RN6390
agr-1,
and
sar mutant strain ALC488,
producing strains KB700, KB708,
and KB709, respectively. As shown in
Fig.
2B, the
agr mutant displayed
a greater-than-twofold
reduction in reporter gene activity (15.59
± 1.41 U of specific
activity) compared to RN6390 (36.21 ± 12.16
U of specific
activity). The
sar mutant exhibited a 15-fold decrease
in
reporter gene activity (2.12 ± 0.75 U of specific activity)
compared to RN6390. The results of these promoter fusion studies
are
consistent with those of the above-described Northern analysis,
suggesting that the AB396 promoter fragment contains all of the
sequences necessary for normal
lrgAB regulation.
Identification of the lrgAB promoter
cis-acting elements.
Inspection of the
lrgAB promoter region (Fig. 1) revealed the presence of two
inverted repeat sequences, centered at nucleotides (nt) 192 and 375, that are potential binding sites for regulatory proteins. Furthermore,
four homopolymeric AT tracts (Fig. 1) are located immediately upstream
of the
35 and
10 hexamers. Koo et al. (15) determined
that homopolymeric AT tracts at least 4 bp long positioned in phase
with the helical screw contribute to overall DNA bending. As shown in
Fig. 1, AT tracts I and II are in phase with the helical turn and are
thus a potential site containing intrinsic DNA curvature. Tracts III
and IV are also nearly in phase and may also contain intrinsic
curvature. In support of this, the Bend-It software created by
Gabrielian et al. (8) to predict DNA curvature predicts that
both of these sites contain intrinsic DNA curvature (Fig.
4). To examine the potential role of all
these sequences in lrgAB regulation, three consecutively smaller deletions (designated
147,
85, and
42; Fig.
5) of the lrgAB promoter
region were made, cloned in front of the xylE gene in pDF16,
and inserted into the RN6390 chromosome. The
147 construct, which
excluded the inverted repeat sequence centered at nt 192, produced
32.80 ± 6.24 U of enzyme specific activity. This level of
activity is similar to that produced by the fusion strain containing AB396 (36.12 ± 12.16 U of specific activity), suggesting that the
sequences upstream of nt 324 (including the inverted repeat centered at
nt 192) do not affect lrgAB expression under these conditions. However, the
85 construct, which excludes the inverted repeat sequence centered on nt 375, produced 15-fold less enzyme activity (2.3 ± 1.8 U of specific activity) compared to AB396, indicating that the sequence between nt 324 and 386 (including the
inverted repeat sequence) is required for optimal lrgAB
expression. The
42 construct, which eliminates the potential
intrinsic bend sites, produced undetectable levels of reporter gene
activity. Since the removal of the sequences spanning the inverted
repeat sequence centered on nt 375 significantly decreased reporter
gene activity, a full-length promoter fusion construct in which this inverted repeat sequence was specifically deleted was generated and
designated AB396
IR. The AB396
IR fragment was ligated into pDF16
and integrated into the RN6390 chromosome, producing strain KB701.
Reporter gene activity was undetectable in this strain. These
experiments show that cis-acting regulatory elements
controlling lrgAB expression, including the inverted repeat
centered at position 375, are contained within approximately 134 nt
upstream of the transcription start site.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 5.
Deletion analysis. Promoter fusion analysis of four
consecutively smaller fragments of the lrgAB promoter and
the internal deletion fragment of the inverted repeat centered on nt
96 analyzed using the integrated reporter gene construct. The
specific activity values shown are averages of at least three
independent experiments and are in milliunits (1 mU equals 1 nmol of
2-hydroxymuconic semialdehyde min 1 mg of total
protein 1).
|
|
Several studies have used multiple copies of operator sites to titrate
host-encoded
trans-acting proteins (
23,
27). We
took a similar approach to further establish the role of the inverted
repeat in the activation of
lrgAB expression. Specifically,
we
subcloned the AB396 fragment and the identical fragment containing
a
specific deletion of the inverted repeat region, AB396

IR, into
high-copy-number plasmid pMK4, producing plasmids pDF28 and pDF29,
respectively. These plasmids were introduced into RN6390 containing
the
integrated reporter gene construct, producing strain KB700.
As shown in
Fig.
6, the introduction of pDF28
resulted in a twofold
decrease in catechol 2,3-dioxygenase activity
(14.17 ± 3.40 U
of specific activity) compared to the same strain
with pMK4 (28.94
± 6.80 U of specific activity). In contrast, the
strain containing
pDF29 produced reporter gene activity (23.81 ± 6.93 U of specific
activity) similar to that observed with the
pMK4-containing strain.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Operator titration experiment using strain KB700
containing high-copy-number plasmids pMK4, pDF28, and pDF29. The
specific activities shown are in milliunits (1 mU equals 1 nmol of
2-hydroxymuconic semialdehyde min 1 mg of total
protein 1) and are averages of three independent
experiments.
|
|
Two-dimensional gel electrophoresis.
As described above, the
42 construct, which lacks the potential bend sites upstream of the
10 and
35 elements, produced no detectable reporter gene activity,
indicating that these sequences affect lrgAB expression. To
test if this promoter region contains intrinsic DNA bending, a
two-dimensional gel electrophoresis assay was performed (Fig.
7A). First, the AB396,
147, and
85
promoter fragments were mixed with a 1-kb ladder and separated in a 5% polyacrylamide gel at 65°C. In this dimension, the rate of DNA migration was a function of size alone. Next, the gel was rotated 90°
and the DNA fragments were separated at 4°C. During electrophoresis in this dimension, the migration rate of the DNA fragments is a
function of size and secondary structure (intrinsic bending). As shown
in Fig. 7A, significant retardation of the migration rate in the second
dimension of the AB396 and
147 fragments and, to a lesser extent,
the
85 fragment was observed. These data indicate that the
lrgAB promoter region does contain intrinsic DNA bending, as
predicted by DNA sequencing and computer analysis. Furthermore, the
increased rate of migration of the
85 fragment compared to the AB396
and
147 fragments suggests that the bend is centered near the 5' end
of
85, which encompasses the AT tract sites.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 7.
Two-dimensional gel electrophoresis assays. (A)
lrgAB promoter region fragments AB396, 147, and 85.
(B) The 147 fragment and 147 fragments containing the 5- and
10-bp insertions between AT tracts I and II. Fragments are labeled
147, 147+5, and 147+10, respectively.
|
|
To confirm that localized bending was associated with AT tracts I and
II, we generated fragments with 5- and 10-bp insertions
between these
AT tracts within the

147 fragment (Fig.
1). The
5-bp insertion
represents the addition of a half-helical turn,
while the 10-bp
insertion adds a full turn. As shown in Fig.
7B,
the 10-bp insertion
had a retarded mobility rate similar to that
of the wild-type sequence,
indicating that it contains intrinsic
bends. In contrast, the insertion
of 5 bp displayed an increased
rate of migration compared to the
wild-type sequence, similar
to the 1-kb ladder DNA, suggesting that the
fragment had reduced
intrinsic bending. These results strongly support
the hypothesis
that the AT tracts confer intrinsic bending and indicate
that
the altered migration rate due to bending is phase dependent and
positioned near the 5' end of the

85 fragment. Both the 5- and
10-bp
insertions in the AB396 fragment abolish
lrgAB promoter
activity when these promoter alterations are fused with
xylE
(data
not
shown).
 |
DISCUSSION |
In a previous study, the global virulence regulator loci
agr and sar were shown to affect murein hydrolase
activity and tolerance to penicillin-induced lysis (7). Both
the agr and sar mutant strains were found to be
more sensitive to penicillin-induced lysis and killing compared to the
parental strain (7). A more recent study demonstrated that
the lrgAB gene products function to decrease extracellular
murein hydrolase activity and increase tolerance to penicillin
(11). Based on these findings, we hypothesized that the
virulence regulators Agr and Sar may affect the expression of the
lrgAB operon. Indeed, the results of promoter fusion (Fig. 2B) and Northern analyses (Fig. 3) demonstrate that this is the case.
The agr mutation decreased the level of lrgAB
expression detected approximately two- to sixfold, while the
sar mutation reduced lrgAB expression to nearly
undetectable levels. These data suggest that SarA controls
lrgAB expression through an Agr-independent pathway.
Furthermore, results from our laboratory also indicate that the Agr and
Sar effects on lrgAB expression are mediated through a
LytSR-independent pathway (unpublished data).
Inspection of the lrgAB promoter region revealed several
potential cis-acting regulatory sequences, including two
inverted repeat sequences and several AT tracts phased with the DNA
helical turn positioned upstream of the
35 and
10 promoter
elements. To determine if these sequences are involved in
lrgAB expression, we constructed a set of nested deletions
spanning the lrgAB promoter region and fused each fragment
to the xylE reporter gene. These constructs were integrated
into the S. aureus chromosome, and reporter gene activity
was assayed. This analysis revealed that the inverted repeat sequence
centered on nt 375 and the AT tracts present upstream of the
35
hexamer are important for maximal lrgAB expression. To
examine the inverted repeat sequence in greater detail, we produced a
promoter fragment (AB396
IR) that was identical to AB396 except for a
specific deletion of this inverted repeat sequence. This fragment
failed to produce detectable enzyme activity using the integrated
reporter gene system.
To examine the function of the inverted repeat sequence further, we
performed a titration experiment by subcloning the AB396 and AB396
IR
fragments into a high-copy-number plasmid and introducing them into an
S. aureus strain containing the integrated AB396 reporter
gene fusion (KB700). Multiple copies of the full-length promoter
sequence significantly decreased the level of chromosomally encoded
reporter gene activity. These data suggest that the inverted repeat is
a specific binding site for an activator protein, although plasmid copy
number differences could also impact these results. However, this
construct did not completely abolish detectable reporter gene activity.
One explanation for this observation is that the promoter topology
within the plasmid may not accurately reflect the DNA structure of the
promoter region as it exists within the chromosome. Thus, the promoter
sequence located within the chromosome may display higher affinity and
outcompete the plasmid-encoded promoter sequence for
trans-acting factors required for lrgAB
expression. The 10-fold increase in promoter activity obtained using
the integrated reporter gene construct (Fig. 2) supports this idea.
The results of two-dimensional gel electrophoresis analysis show that
the lrgAB promoter also contains a region of intrinsic DNA
curvature. Using the deletion fragments generated for the promoter
fusion analysis, intrinsic DNA curvature was localized between the
inverted repeat sequence centered on nt 375 and the
35 hexamer. This
is based on the observation that the mobility of the
85 fragment was
not affected by low temperature as much as the other promoter fragments
were. It has been shown that when a bend occurs at the center of a DNA
molecule it will affect the shape of that molecule to a greater degree
than if the bend occurs near an end (9). The results of the
two-dimensional gel assay (Fig. 7A) indicate that the intrinsic bend
site is located near the end of the
85 fragment, near AT tracts I
and II. To confirm this, we created 5- and 10-bp insertions between AT
tracts I and II in the
147 fragment. The 5-bp insertion (which
inserts half of a helical turn) would be predicted to disrupt the
overall curvature of this region, producing a zigzag structure and
increasing the migration rate in the second dimension compared to the
wild-type fragment. As shown in Fig. 7B, this is precisely what was
observed. On the other hand, the 10-bp insertion (which inserts a full
helical turn) was predicted to create a deeper curve, reducing the
migration rate compared to the wild-type fragment. Again, the results
shown in Fig. 7B show this to be the case. When these 5- and 10-bp
insertions were introduced into full-length promoter fragment AB396 and
analyzed using the chromosomal reporter gene construct, no detectable
enzyme activity was produced (data not shown). These data argue against an enhancer loop model of lrgAB activation in which the
placement of the operator and the promoter on the same face of the
helix is more important than the spacing between these
cis-acting elements. On the other hand, the data suggest
that the geometry and/or the position of the inverted repeat relative
to the promoter is critical for lrgAB expression to occur.
Alternatively, the insertions may disrupt primary structure elements
necessary for binding of an activator protein.
Intrinsic DNA curvature has been implicated in the activation of
transcription by promoting the juxtaposition of DNA sequences near the
terminal loop of a superhelical domain (35). Yang et al.
(36) suggested that the introduction of a curved DNA
sequence brings about changes in the overall shape of a supercoiled
polymer. These examples raise the possibility that intrinsic DNA
bending influences the supercoiled topology within promoter regions.
Furthermore, there are several cases in which intrinsic DNA bending
and/or protein-induced bending upstream of promoters affect
transcription initiation (24). Thus, it is clear that DNA
bending, supercoiling, and transcription factor binding can work either
in concert or independently to control gene expression.
In S. aureus, the expression of the eta gene has
been shown to be enhanced by DNA relaxation (31). More
recently, Morfeldt et al. (20) hypothesized that SarA
binding to the agr promoter region affects the localized
superhelicity of this promoter. Interestingly, SarA exhibits moderate
sequence similarity to Shigella flexneri VirF
(21), which has been shown to activate virB
transcription by binding upstream in a DNA topology-dependent manner
(34). Based on this observation, along with the results of
the current study, it is possible that SarA recognizes and binds
distinct topological features in the lrgAB promoter region
that may lead to the generation of an active transcription complex.
Recently, it has also been shown that SarA specifically binds upstream
of the collagen adhesion gene (cna), controlling its
expression independently of Agr (2, 10). When applying the
Bend-It software to examine whether this and the agr P3
promoter also contained DNA curvature, we found that both analyses
predicted DNA curvature within these promoter regions (data not shown).
Thus, similar topological features may be required for the activation
of other SarA-regulated promoters.
 |
ACKNOWLEDGMENTS |
This work was funded by NIH grant R29-AI38901 and NSF-Idaho
EPSCoR grant EPS-9720634.
We thank Scott A. Minnich for careful review of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Molecular Biology and Biochemistry, College of
Agriculture, University of Idaho, Moscow, ID 83844-3052. Phone: (208)
885-7164. Fax: (208) 885-6518. E-mail: kbayles{at}uidaho.edu.
Present address: The Childrens' Hospital Research Foundation,
Division of Developmental Biology, Cincinnati, OH 45229.
 |
REFERENCES |
| 1.
|
Bayles, K. W.
2000.
The bactericidal action of penicillin: new clues to an unsolved mystery.
Trends Microbiol.
8:280-283.
|
| 2.
|
Blevins, J. S.,
A. F. Gillaspy,
T. M. Rechtin,
B. K. Hurlburt, and M. S. Smeltzer.
1999.
The Staphylococcal accessory regulator (sar) represses transcription of the Staphylococcus aureus collagen adhesin gene (cna) in an agr-independent manner.
Mol. Microbiol.
33:317-326[CrossRef][Medline].
|
| 3.
|
Brunskill, E. W., and K. W. Bayles.
1996.
Identification and molecular characterization of a putative regulatory locus that affects autolysis in Staphylococcus aureus.
J. Bacteriol.
178:611-618[Abstract/Free Full Text].
|
| 4.
|
Brunskill, E. W., and K. W. Bayles.
1996.
Identification of LytSR-regulated genes from Staphylococcus aureus.
J. Bacteriol.
178:5810-5812[Abstract/Free Full Text].
|
| 5.
|
Chen, B., and A. E. Przybyla.
1994.
An efficient site-directed mutagenesis method based on PCR.
BioTechniques
17:657-659[Medline].
|
| 6.
|
Dyer, D. W., and J. J. Iandolo.
1983.
Rapid isolation of DNA from Staphylococcus aureus.
Appl. Environ. Microbiol.
46:283-285[Abstract/Free Full Text].
|
| 7.
|
Fujimoto, D. F., and K. W. Bayles.
1998.
Opposing roles of the Staphylococcus aureus virulence regulators, Agr and Sar, in Triton X-100- and penicillin-induced autolysis.
J. Bacteriol.
180:3724-3726[Abstract/Free Full Text].
|
| 8.
|
Gabrielian, A.,
K. Vlahovicek, and S. Pongor.
1997.
Distribution of sequence-dependent curvature in genomic DNA sequences.
FEBS Lett.
406:69-74[CrossRef][Medline].
|
| 9.
|
Garabedian, M. J.,
J. LaBaer,
W. Liu, and J. R. Thomas.
1993.
Analysis of protein-DNA interactions, p. 243-293.
In
D. B. Hames, and S. J. Higgins (ed.), Gene transcription: a practical approach. Oxford University Press, New York, N.Y.
|
| 10.
|
Gillaspy, A. F.,
C. Y. Lee,
S. Sau,
A. L. Cheung, and M. S. Smeltzer.
1998.
Factors affecting the collagen binding capacity of Staphylococcus aureus.
Infect. Immun.
66:3170-3178[Abstract/Free Full Text].
|
| 11.
|
Groicher, K. H.,
B. A. Firek,
D. F. Fujimoto, and K. W. Bayles.
2000.
The Staphylococcus aureus lrgAB operon modulates murein hydrolase activity and penicillin tolerance.
J. Bacteriol.
182:1794-1801[Abstract/Free Full Text].
|
| 12.
|
Hart, M. E.,
M. S. Smeltzer, and J. J. Iandolo.
1993.
The extracellular protein regulator (xpr) affects exoprotein and agr mRNA levels in Staphylococcus aureus.
J. Bacteriol.
175:7875-7879[Abstract/Free Full Text].
|
| 13.
|
Holtje, J.-V., and E. I. Tuomanen.
1991.
The murein hydrolases of Escherichia coli: properties, functions and impact on the course of infections in vivo.
J. Gen. Microbiol.
137:441-454[Medline].
|
| 14.
|
Inoue, H.,
H. Nojima, and H. Okayama.
1990.
High efficiency transformation of Escherichia coli with plasmids.
Gene
96:23-28[CrossRef][Medline].
|
| 15.
|
Koo, H. S.,
H. M. Wu, and D. M. Crothers.
1986.
DNA bending at adenine/thymine tracts.
Nature
320:501-506[CrossRef][Medline].
|
| 16.
|
Kornblum, J.,
B. N. Kreiswirth,
S. J. Projan,
H. Ross, and R. P. Novick.
1990.
Agr: a polycistronic locus regulating exoprotein synthesis in Staphylococcus aureus, p. 373-402.
In
R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, Inc., New York, N.Y.
|
| 17.
|
Kraemer, G. R., and J. J. Iandolo.
1990.
High-frequency transformation of Staphylococcus aureus by electroporation.
Curr. Microbiol.
21:373-376[CrossRef].
|
| 18.
|
Lee, C. Y.,
S. L. Buranen, and Z. Ye.
1991.
Construction of single-copy integration vector for Staphylococcus aureus.
Gene
103:101-105[CrossRef][Medline].
|
| 19.
|
Lee, C. Y., and J. J. Iandolo.
1986.
Lysogenic conversion of staphylococcal lipase is caused by insertion of the bacteriophage L54a genome into the lipase structural gene.
J. Bacteriol.
166:385-391[Abstract/Free Full Text].
|
| 20.
|
Morfeldt, E.,
K. Tegmark, and S. Arvidson.
1996.
Transcriptional control of the agr-dependent virulence gene regulator, RNAIII, in Staphylococcus aureus.
Mol. Microbiol.
21:1227-1237[CrossRef][Medline].
|
| 21.
|
Novick, R. P.
2000.
Pathogenicity factors and their regulation, p. 392-407.
In
V. A. Fischetti, R. P. Novick, J. J. Ferretti, D. A. Portnoy, and J. I. Rood (ed.), Gram-positive pathogens. ASM Press, Washington, D.C.
|
| 22.
|
Novick, R. P.,
H. F. Ross,
S. J. Projan,
J. Kornblum,
B. Kreiswirth, and S. Moghazeh.
1993.
Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule.
EMBO J.
12:3967-3975[Medline].
|
| 23.
|
Osuna, R.,
A. Schwacha, and R. A. Bender.
1994.
Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis.
J. Bacteriol.
176:5525-5529[Abstract/Free Full Text].
|
| 24.
|
Perez-Martin, J.,
F. Rojo, and V. de Lorenzo.
1994.
Promoters responsive to DNA bending: a common theme in prokaryotic gene expression.
Microbiol. Rev.
58:268-290[Abstract/Free Full Text].
|
| 25.
|
Ray, C.,
R. E. Hay,
H. L. Carter, and C. P. Moran, Jr.
1985.
Mutations that affect utilization of a promoter in stationary-phase Bacillus subtilis.
J. Bacteriol.
163:610-614[Abstract/Free Full Text].
|
| 26.
|
Rohde, J. R.,
X. S. Luan,
H. Rohde,
J. M. Fox, and S. A. Minnich.
1999.
The Yersinia enterocolitica pYV virulence plasmid contains multiple intrinsic DNA bends which melt at 37°C.
J. Bacteriol.
181:4198-4204[Abstract/Free Full Text].
|
| 27.
|
Saint-Girons, I.,
H. J. Fritz,
C. Shaw,
E. Tillmann, and P. Starlinger.
1981.
Integration specificity of an artificial kanamycin transposon constructed by the in vitro insertion of an internal Tn5 fragment into IS2.
Mol. Gen. Genet.
183:45-50[CrossRef][Medline].
|
| 28.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 30.
|
Shafer, M. W., and J. J. Iandolo.
1979.
Genetics of staphylococcal enterotoxin B in methicillin-resistant isolates of Staphylococcus aureus.
Infect. Immun.
25:902-911[Abstract/Free Full Text].
|
| 31.
|
Sheehan, B. J.,
T. J. Foster,
C. J. Dorman,
S. Park, and G. S. A. B. Stewart.
1992.
Osmotic and growth-phase dependent regulation of the eta gene of Staphylococcus aureus: a role for DNA supercoiling.
Mol. Gen. Genet.
232:49-57[CrossRef][Medline].
|
| 32.
|
Shockman, G. D., and J.-V. Holtje.
1994.
Microbial peptidoglycan (murein) hydrolases, p. 131-166.
In
J.-M. Ghuysen, and R. Hakenbeck (ed.), Bacterial cell wall, vol. 27. Elsevier Science B.V., Amsterdam, The Netherlands.
|
| 33.
|
Sullivan, M. A.,
R. E. Yasbin, and F. E. Young.
1984.
New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments.
Gene
29:21-26[CrossRef][Medline].
|
| 34.
|
Tobe, T.,
M. Yoshikawa, and C. Sasakawa.
1995.
Thermoregulation of virB transcription in Shigella flexneri by sensing of changes in local DNA superhelicity.
J. Bacteriol.
177:1094-1097[Abstract/Free Full Text].
|
| 35.
|
Tsen, H., and S. D. Levene.
1997.
Supercoiling-dependent flexibility of adenosine-tract-containing DNA detected by a topological method.
Proc. Natl. Acad. Sci. USA
94:2817-2822[Abstract/Free Full Text].
|
| 36.
|
Yang, Y.,
T. P. Westcott,
S. C. Pedersen,
I. Tobias, and W. K. Olson.
1995.
Effects of localized bending on DNA supercoiling.
Trends Biochem. Sci.
20:313-319[CrossRef][Medline].
|
| 37.
|
Zukowski, M. M.,
D. F. Gaffney,
D. Speck,
M. Kauffmann,
A. Findeli,
A. Wisecup, and J. P. Lecocq.
1983.
Chromogenic identification of genetic regulatory signals in Bacillus subtilis based on expression of a cloned Pseudomonas gene.
Proc. Natl. Acad. Sci. USA
80:1101-1105[Abstract/Free Full Text].
|
Journal of Bacteriology, September 2000, p. 4822-4828, Vol. 182, No. 17
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Somerville, G. A., Proctor, R. A.
(2009). At the Crossroads of Bacterial Metabolism and Virulence Factor Synthesis in Staphylococci. Microbiol. Mol. Biol. Rev.
73: 233-248
[Abstract]
[Full Text]
-
Renzoni, A., Barras, C., Francois, P., Charbonnier, Y., Huggler, E., Garzoni, C., Kelley, W. L., Majcherczyk, P., Schrenzel, J., Lew, D. P., Vaudaux, P.
(2006). Transcriptomic and Functional Analysis of an Autolysis-Deficient, Teicoplanin-Resistant Derivative of Methicillin-Resistant Staphylococcus aureus.. Antimicrob. Agents Chemother.
50: 3048-3061
[Abstract]
[Full Text]
-
Chang, W., Small, D. A., Toghrol, F., Bentley, W. E.
(2006). Global Transcriptome Analysis of Staphylococcus aureus Response to Hydrogen Peroxide. J. Bacteriol.
188: 1648-1659
[Abstract]
[Full Text]
-
Voyich, J. M., Braughton, K. R., Sturdevant, D. E., Whitney, A. R., Said-Salim, B., Porcella, S. F., Long, R. D., Dorward, D. W., Gardner, D. J., Kreiswirth, B. N., Musser, J. M., DeLeo, F. R.
(2005). Insights into Mechanisms Used by Staphylococcus aureus to Avoid Destruction by Human Neutrophils. J. Immunol.
175: 3907-3919
[Abstract]
[Full Text]
-
Li, D., Renzoni, A., Estoppey, T., Bisognano, C., Francois, P., Kelley, W. L., Lew, D. P., Schrenzel, J., Vaudaux, P.
(2005). Induction of Fibronectin Adhesins in Quinolone-Resistant Staphylococcus aureus by Subinhibitory Levels of Ciprofloxacin or by Sigma B Transcription Factor Activity Is Mediated by Two Separate Pathways. Antimicrob. Agents Chemother.
49: 916-924
[Abstract]
[Full Text]
-
Rice, K. C., Nelson, J. B., Patton, T. G., Yang, S.-J., Bayles, K. W.
(2005). Acetic Acid Induces Expression of the Staphylococcus aureus cidABC and lrgAB Murein Hydrolase Regulator Operons. J. Bacteriol.
187: 813-821
[Abstract]
[Full Text]
-
Chatfield, C. H., Koo, H., Quivey,, R. G. Jr
(2005). The putative autolysin regulator LytR in Streptococcus mutans plays a role in cell division and is growth-phase regulated. Microbiology
151: 625-631
[Abstract]
[Full Text]
-
Bischoff, M., Dunman, P., Kormanec, J., Macapagal, D., Murphy, E., Mounts, W., Berger-Bachi, B., Projan, S.
(2004). Microarray-Based Analysis of the Staphylococcus aureus {sigma}B Regulon. J. Bacteriol.
186: 4085-4099
[Abstract]
[Full Text]
-
Rice, K. C., Patton, T., Yang, S.-J., Dumoulin, A., Bischoff, M., Bayles, K. W.
(2004). Transcription of the Staphylococcus aureus cid and lrg Murein Hydrolase Regulators Is Affected by Sigma Factor B. J. Bacteriol.
186: 3029-3037
[Abstract]
[Full Text]
-
Sterba, K. M., Mackintosh, S. G., Blevins, J. S., Hurlburt, B. K., Smeltzer, M. S.
(2003). Characterization of Staphylococcus aureus SarA Binding Sites. J. Bacteriol.
185: 4410-4417
[Abstract]
[Full Text]
-
Boyle-Vavra, S., Challapalli, M., Daum, R. S.
(2003). Resistance to Autolysis in Vancomycin-Selected Staphylococcus aureus Isolates Precedes Vancomycin-Intermediate Resistance. Antimicrob. Agents Chemother.
47: 2036-2039
[Abstract]
[Full Text]
-
Yoshida, A., Kuramitsu, H. K.
(2002). Multiple Streptococcus mutans Genes Are Involved in Biofilm Formation. Appl. Environ. Microbiol.
68: 6283-6291
[Abstract]
[Full Text]
-
Koch, A. L.
(2001). Autolysis Control Hypotheses for Tolerance to Wall Antibiotics. Antimicrob. Agents Chemother.
45: 2671-2675
[Full Text]
-
Bischoff, M., Entenza, J. M., Giachino, P.
(2001). Influence of a Functional sigB Operon on the Global Regulators sar and agr in Staphylococcus aureus. J. Bacteriol.
183: 5171-5179
[Abstract]
[Full Text]