Previous Article | Next Article ![]()
Journal of Bacteriology, September 2000, p. 5013-5016, Vol. 182, No. 17
Department of Biochemistry (0308), Virginia
Polytechnic Institute and State University, Blacksburg, Virginia
24061
Received 4 February 2000/Accepted 6 June 2000
Two putative Methanococcus jannaschii isocitrate
dehydrogenase genes, MJ1596 and MJ0720, were cloned and overexpressed
in Escherichia coli, and their gene products were tested
for the ability to catalyze the NAD- and NADP-dependent oxidative
decarboxylation of DL-threo-3-isopropylmalic
acid, threo-isocitrate, erythro-isocitrate, and
homologs of threo-isocitrate. Neither enzyme was found to use any of the isomers of isocitrate as a substrate. The protein product of the MJ1596 gene, designated AksF, catalyzed the
NAD-dependent decarboxylation of intermediates in the biosynthesis of
7-mercaptoheptanoic acid, a moiety of methanoarchaeal coenzyme B
(7-mercaptoheptanylthreonine phosphate). These intermediates included
( Recent work has established the
biochemistry of the thirteen steps involved in the conversion of
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of Enzymes Homologous to Isocitrate Dehydrogenase
That Are Involved in Coenzyme B and Leucine Biosynthesis in
Methanoarchaea
![]()
ABSTRACT
Top
Abstract
Text
References
)-threo-isohomocitrate [(
)-threo-1-hydroxy-1,2,4-butanetricarboxylic acid],
(
)-threo-iso(homo)2citrate [(
)-threo-1-hydroxy-1,2,5-pentanetricarboxylic acid],
and (
)-threo-iso(homo)3citrate [(
)-threo-1-hydroxy-1,2,6-hexanetricarboxylic acid].
The protein product of MJ0720 was found to be
-isopropylmalate
dehydrogenase (LeuB) and was found to catalyze the NAD-dependent
decarboxylation of one isomer of
DL-threo-isopropylmalate to 2-ketoisocaproate; thus, it is involved in the biosynthesis of leucine. The AksF enzyme
proved to be thermostable, losing only 10% of its enzymatic activity
after heating at 100°C for 10 min, whereas the LeuB enzyme lost 50%
of its enzymatic activity after heating at 80°C for 10 min.
![]()
TEXT
Top
Abstract
Text
References
-ketoglutarate and acetyl coenzyme A (CoA) to
-ketosuberate (aks)
a precursor to coenzyme B (7-mercaptoheptanoylthreonine phosphate) and
biotin, in the methanoarchaea (Fig. 1)
(4). The gist of these steps consists of the repeated
application of the
-ketoacid chain elongation series of reactions to
increase the number of methylenes from two, as found in
-ketoglutaric acid, to five, as found in
-ketosuberic acid, the
final product of this
-ketoacid chain elongation series of
reactions. The
-ketosuberic acid then serves as a precursor to the
biosynthesis of the 7-mercaptoheptanoic acid moiety of coenzyme B, as
shown in Fig. 1 (15).

View larger version (20K):
[in a new window]
FIG. 1.
Biosynthetic pathway for coenzyme B.
Previous work has shown that the protein product of the
Methanococcus jannaschii MJ0503 gene aksA, AksA,
catalyzes the condensation of
-ketoglutarate and acetyl-CoA to form
trans-homoaconitate and the condensation of
-ketoadipate
or
-ketopimelate with acetyl-CoA to form, respectively, the
(R)-(homo)2citrate[(R)-2-hydroxy-1,2,5-pentanetricarboxylic acid] or (homo)3citrate
[(R)-2-hydroxy-1,2,6-hexanetricarboxylic acid]
(4). These steps are shown in Fig. 1 as steps 1, 6, and 10. In this biosynthetic pathway there are also three reactions in which
homologs of (
)-threo-isocitrate undergo reactions
mechanistically like the NAD-dependent isocitrate dehydrogenase
reactions to form
-ketoacids (Fig. 1, steps 5, 9, and 13). Based on
the expected mechanism of these reactions and the observed
stereochemistry of the reaction products, it is very likely that genes
homologous to NAD-dependent isocitrate dehydrogenase may be responsible
for producing the enzymes that catalyze these reactions. M. jannaschii has two open reading frames (ORFs) that can produce
proteins homologous to isocitrate dehydrogenase, the
NADP-dependent isocitrate dehydrogenase gene MJ0720 (37.3%
identity in 193 amino acids to the Escherichia coli
isocitrate dehydrogenase), and the NAD-dependent isocitrate dehydrogenase gene MJ1596 (32.0% identity in 219 amino acids to the E. coli isocitrate dehydrogenase) (1). These
ORFs correspond, respectively, to the MTH0184 and MTH1388 genes
in Methanobacterium thermoautotrophicum (11). We
have cloned the genes for these proteins from M. jannaschii,
overproduced their enzymes in E. coli, isolated the enzymes,
and determined the enzymatic reactions that each catalyzes. We can now
report that the gene product of the MJ1596 gene is the AksF enzyme
involved in the biosynthesis of coenzyme B that carries out the
NAD-dependent decarboxylation of the homologs of
(
)-threo-isocitrate and that the MJ0720 gene encodes a
NAD-dependent 3-isopropylmalate dehydrogenase (LeuB).
Identification, cloning, and high-level expression of the gene product. Expression of the MJ1596 and MJ0720 genes in E. coli was accomplished by the following procedure. The MJ1596 and MJ0720 genes were amplified by PCR using genomic DNA from M. jannaschii (David E. Graham, Urbana, Ill.) as the template. The synthetic oligonucleotide primers 5'CATGCATATGATGAAGGTGTGTGTTATAGAA3' and 5'CAGTGGATCCTTAATATCCCTTTAACTTCTTTCT3' (derived from the MJ1596 DNA sequence) and the primers 5'CATGCATATGGTGATAAGTATGGATAAA3' and 5'GATCGGATCCTTATTCTTCTCTTACTCTTTT3' (derived from the MJ0720 DNA sequence) were used. Each set of primers was used to insert the NdeI and BamHI restriction sites at the 5' and 3' ends. PCR was performed, with 1 µg of genomic DNA as the template, with 20 µmol of each primer, 3.75 U of AmpliTaq DNA polymerase, and 10 µl of 10× PCR buffer (Perkin Elmer, Branchburg, N.J.) in a final volume of 100 µl. Each cycle was set for 1 min of denaturation at 95°C, 2 min of annealing at 60°C, and 3 min of extention at 72°C, and 35 reaction cycles were carried out in a DNA thermal cycler. After purification of the PCR products via absorption and desorption with a QIAquick spin column (QIAGEN, Valencia, Calif.), the products were digested with NdeI and BamHI and were cloned into a NdeI-BamHI-digested pT7-7 plasmid vector to obtain the constructs pT7-7-MJ1596 and pT7-7-MJ0720. The constructs were transformed into E. coli TB1 for plasmid preparation and into E. coli BL21(DE3) for protein expression. The cells of E. coli BL21(DE3) transformed with pT7-7-MJ1596 or pT7-7-MJ0720 plasmid were grown in Luria-Bertani medium (200 ml), supplemented with 100 mg of ampicillin/liter at 37°C to an absorbance at 600 nm of 1.0.
Protein production was then induced by the addition of isopropylthio-
-D-galactoside (IPTG) to a final
concentration of 0.1 mM, and the cells were grown for an additional
4 h at 37°C. The cells were harvested by centrifugation (5 min,
4,000 × g) and frozen at
20°C until used.
High-level expression of the desired protein was confirmed by sodium
dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (12%
polyacrylamide) of the SDS-soluble cellular proteins.
Preparation and analysis of cell extracts. Cell extracts were prepared by sonication of the cell pellets (~300 mg [wet weight]) suspended in 2 to 3 ml of buffer [50 mM N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES) (pH 7.0), 10 mM MgCl2, and 20 mM mercaptoethanol], followed by centrifugation (10 min, 14,000 × g). SDS-PAGE analysis of the pellets and the cell extracts showed that most (>90%) of the overexpressed proteins were present in a soluble form. Heating the extracts at 60°C for 10 min, followed by centrifugation (10 min, 14,000 × g), removed most of the E. coli proteins and left essentially pure solutions of the overexpressed proteins (>95% pure by SDS-PAGE). These solutions were used for the analyses reported here. The protein concentrations were determined using the Bio-Rad protein assay.
Measurement of enzymatic activities.
The activities of the
enzymes were measured spectrophotometrically in 1-ml quartz cuvettes at
60°C by following NAD reduction at 340 nm. A molar absorptivity of
6.2 × 103 M
1 cm
1 was used
to determine the concentrations of NADH and NADPH. Thus, into a quartz
cell at 60°C we added 500 µl of TES buffer (50 mM TES [pH 7.4],
10 mM MgCl2 and 20 mM mercaptoethanol), 6 µl of a 0.1 M
solution of the desired substrate, 2 µl of a 0.1 M solution of NAD or
NADP, and water to 1 ml. After equilibration to 60°C for ~5 min, 10 µl of the enzyme solution was added with mixing. For determination of
Km and Vmax values,
concentrations of the various substrates were varied over a range of 0 to 1.0 mM in this 1.0-ml assay mixture. One unit of enzyme activity was
defined as the reduction of 1 µmol NAD or NADP per min.
DL-(threo)Isopropylmalic acid was obtained from
Waco Pure Chemical Industries, Ltd., Osaka, Japan.
threo-Ds(+)Isocitrate,
threo-isocitrate, and DL-isocitrate were
obtained from Sigma Chemical Co. threo-Isohomocitrate
(1-hydroxy-1,2,4-butanetricarboxylic acid),
threo-iso(homo)2citrate
(1-hydroxy-1,2,5-pentanetricarboxylic acid), and
threo-iso(homo)3citrate
(1-hydroxy-1,2,6-hexanetricarboxylic acid), their (
) isomers, and a
mixture of threo-isocitrate and erythro-isocitrate were synthesized as previously described
(4).
Product identification. The products of the NAD-dependent oxidations of each of the substrates were identified by gas chromatography-mass spectrometry (GC-MS). The general procedure in each case was to incubate the enzyme with the substrates, isolate the products, convert the products into suitable methyl ester derivatives, and analyze them by GC-MS using a known sample as a reference. Incubations were conducted as described above except that an excess of NAD and enzyme was used to drive the reaction to completion. The procedures for the preparation, isolation, and subsequent GC-MS analyses of the methyl esters have been described previously (4).
Reactions catalyzed by cloned enzymes.
As reported in Table
1, the MJ1596-encoded enzyme was able to
use only the homologs of threo-isocitrate as substrates. The enzyme was also unable to use any isomer of isocitrate or
isopropylmalate as a substrate. This behavior is to be contrasted with
the MJ0720-encoded enzyme, which was found to use only
threo-isopropylmalate as a substrate. Neither enzyme was
found to use NADP as an oxidant. This coenzyme specificity is the same
as that observed for the isopropylmalate dehydrogenase isolated from
Salmonella enterica serovar Typhimurium (10).
|
-ketosuberate used for coenzyme B biosynthesis,
and the MJ0720-encoded enzyme is proposed to be the isopropylmalate
dehydrogenase involved in leucine biosynthesis. The
Km and
Vmax/Km values for these
enzymes are also consistent with the metabolic functions for those
enzymes having Km values in the range of 20 to
40 µM. These values are typical for related or identical enzymes from
other organisms. Thus, the isocitrate dehydrogenase from
Sulfolobus solfataricus has a Km for
isocitrate of 130 µM and a Vmax of 68 µmol/min/mg of protein (2), whereas the same enzyme from
Archaeoglobus fulgidus has a Km for
isocitrate of 118 µM and a Vmax of 141 µmol/min/mg of protein (12). The Km
and Vmax values for
threo-isopropylmalate for the isopropylmalate dehydrogenases
from S. enterica serovar Typhimurium (10) and Saccharomyces cerevisiae (5) have been measured
and are, respectively, 20 µM and 54 µmol/min/mg of protein and 23 µM and 19 µmol/min/mg of protein for the respective organisms. The
Km for this substrate for the isopropylmalate
dehydrogenase from Sulfolobus sp. strain 7 has been
determined to be 1.2 µM (13).
Thermostability of cloned enzymes.
The crude extracts
containing the cloned enzymes were heated for 10 min at different
temperatures, and after the precipitated proteins were removed by
centrifugation, the remaining activity was measured at 60°C using
either threo-isohomocitrate,
threo-iso(homo)2citrate, threo-iso(homo)3citrate, or
threo-isopropylmalate and NAD as substrates. As can be seen
from Fig. 2, the MJ1596-encoded enzyme
was stable at 100°C for 10 min, whereas the LeuB enzyme lost 50% of
its enzymatic activity when heated at 80°C for 10 min. Thus, the
enzyme is not quite as thermostable as the LeuB enzyme isolated from
Thermus thermophilus (6).
|
3citrate synthase (4). The MJ0503 gene
does not appear to be in a cluster of genes related to coenzyme B
biosynthesis in M. jannaschii, but its ortholog in
M. thermoautotrophicum (MTH1630) is downstream of MTH1631,
an ortholog to the M. jannaschii gene MJ1003
(aksD). The MJ1003 encodes a gene for the large
subunit of an aconitase that is specific for the dehydration
and hydration reactions involved in coenzyme B biosynthesis
(Graupner et al., unpublished results). As expected, the genes MJ0504
and MTH1630 for the (homo)1
3citrate synthases, which are
involved in the biosynthesis of coenzyme B, which is only needed for
methane formation, are exclusively found in the methanoarchaea.
The aconitase small subunit for coenzyme B biosynthesis MJ1271
(aksE) is an ortholog of MTH0829, which has next to it a
putative kinase MTH830, which could be the enzyme responsible for
the addition of the phosphate in the last step of coenzyme B
biosynthesis (4).
The MJ0720-encoded isopropylmalate dehydrogenase has clear orthologs in
all four of the published archaea genomes (M. jannaschii, M. thermoautotrophicum, A. fulgidus, and
Pyrococcus horikoshii) (7). Although the
M. jannaschii MJ0720 gene is not in a gene cluster
containing other genes related to leucine biosynthesis, it clearly is
in a cluster of leucine-related genes in all the other archaea. The
ortholog for this gene in M. thermoautotrophicum is
MHT1388, in a cluster with three other genes that are related to
leucine biosynthesis, MTH1387, MTH1386, and MTH1385. This cluster has
been established since the first two of these genes correspond, respectively, to MJ1277 and MJ0499, genes now known to function as the
small and large subunits of 3-isopropylmalate dehydratase (Graupner et
al., unpublished results). The MTH1385 gene putatively encodes an
aminotransferase (11). This grouping of genes is analogous
to that seen for the leuABCD operon in E. coli (14).
| |
ACKNOWLEDGMENTS |
|---|
We thank Kim Harich for the GC-MS analyses of enzymatic products, Jonathan Lau for assistance in the measurement of enzymatic activities, and Walter G. Niehaus for reviewing the manuscript prior to submission.
This work was supported in part by the National Science Foundation Grant MCB963086.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry (0308), Virginia Polytechnic Institute and State University, Blacksburg, VA 24061. Phone: (540) 231-6605. Fax: (540) 231-9070. E-mail: rhwhite{at}vt.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bult, C. J., O. White, G. J. Olsen, L. Zhou, R. D. Fleischmann, G. G. Sutton, J. A. Blake, L. M. FitzGerald, R. A. Clayton, J. D. Gocayne, A. R. Kerlavage, B. A. Dougherty, J.-F. Tomb, M. D. Adams, C. I. Reich, R. Overbeek, E. F. Kirkness, K. G. Weinstock, J. M. Merrick, A. Glodek, J. L. Scott, N. S. M. Geoghagen, J. F. Weidman, J. L. Fuhrmann, D. Nguyen, T. R. Utterback, J. M. Kelley, J. D. Peterson, P. W. Sadow, M. C. Hanna, M. D. Cotton, K. M. Roberts, M. A. Hurst, B. P. Kaine, M. Borodovsky, H.-P. Klenk, C. M. Fraser, H. O. Smith, C. R. Woese, and J. C. Venter. 1997. Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii. Science 273:1058-1073[Abstract]. |
| 2. | Camacho, M. L., R. A. Brown, M.-J. Bonete, M. J. Danson, and D. W. Hough. 1995. Isocitrate dehydrogenase from Haloferax volcanii and Sulfolobus solfataricus: enzyme purification, characterization and N-terminal sequence. FEMS Microbiol. Lett. 134:85-90[CrossRef][Medline]. |
| 3. | Crane, R. K. 1962. Hexokinases and pentokinases, p. 47-66. In P. D. Boyer, H. Lardy, and K. Myrback (ed.), The enzymes, vol. 6. Academic Press, New York, N.Y. |
| 4. |
Howell, D. M.,
K. Harich,
H. Xu, and R. H. White.
1998.
The -keto acid chain elongation reactions involved in the biosynthesis of coenzyme B (7-mercaptoheptanoylthreonine phosphate) in methanogenic Archaea.
Biochemistry
37:10108-10117[CrossRef][Medline].
|
| 5. |
Hsu, Y.-P., and G. B. Kohlhaw.
1980.
Leucine biosynthesis in Saccharomyces cerevisiae.
J. Biol. Chem.
255:7255-7260 |
| 6. | Kirino, H., M. Aoki, M. Aoshima, Y. Hayashi, M. Ohba, A. Yamagishi, T. Wakagi, and T. Oshima. 1994. Hydrophobic interaction at the subunit interface contributes to the thermostability of 3-isopropylmalate dehydrogenase from the extreme thermophile, Thermus thermophilus. Eur. J. Biochem. 220:275-281[Medline]. |
| 7. |
Makarova, K. S.,
L. Aravind,
M. Y. Galperin,
N. V. Grishin,
R. L. Tatusov,
Y. I. Wolf, and E. V. Koonin.
1999.
Comparative genomics of the archaea (Euryarchaeota): evolution of conserved protein families, the stable core, and the variable shell.
Genome Res.
9:608-628 |
| 8. | Pittard, A. J. 1996. Biosynthesis of the aromatic amino acids, p. 458-484. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 9. | Parks, R. E., Jr., and R. P. Agarwal. 1973. Nucleoside diphosphokinases, p. 307-333. In P. D. Boyer (ed.), The enzymes, 3rd ed., vol. 8. Academic Press, New York, N.Y. |
| 10. |
Parsons, S. J., and R. O. Burns.
1969.
Purification and properties of -isopropylmalate dehydrogenase.
J. Biol. Chem.
244:996-1003.
|
| 11. |
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautophicum.
J. Bacteriol.
179:7135-7155 |
| 12. | Steen, I. H., T. Lien, and N.-K. Birkeland. 1997. Biochemical and phylogenetic characterization of isocitrate dehydrogenase from a hyperthermophilic archaeon, Archaeoglobus fulgidus. Arch. Microbiol. 168:412-420[CrossRef][Medline]. |
| 13. |
Suzuki, T.,
Y. Inoki,
A. Yamagisi,
T. Iwasaki,
T. Wakagi, and T. Oshima.
1997.
Molecular and phylogenetic characterization of isopropylmalate dehydrogenase from a thermoacidophilic archaeon, Sulfolobus sp. strain 7.
J. Bacteriol.
179:1174-1179 |
| 14. | Umbarger, H. E. 1996. Biosynthesis of branched-chain amino acids, p. 442-457. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 15. |
White, R. H.
1989.
Steps in the conversion of -ketosuberate to 7-mercaptoheptanoic acid in methanogenic bacteria.
Biochemistry
28:9417-9423[CrossRef][Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |