TEXT

Top Abstract Text References

Recent work has established the biochemistry of the thirteen steps involved in the conversion of -ketoglutarate and acetyl coenzyme A (CoA) to -ketosuberate (aks) a precursor to coenzyme B (7-mercaptoheptanoylthreonine phosphate) and biotin, in the methanoarchaea (Fig. 1) (4). The gist of these steps consists of the repeated application of the -ketoacid chain elongation series of reactions to increase the number of methylenes from two, as found in -ketoglutaric acid, to five, as found in -ketosuberic acid, the final product of this -ketoacid chain elongation series of reactions. The -ketosuberic acid then serves as a precursor to the biosynthesis of the 7-mercaptoheptanoic acid moiety of coenzyme B, as shown in Fig. 1 (15).

View larger version (20K): [in this window] [in a new window]   FIG. 1.   Biosynthetic pathway for coenzyme B.

Previous work has shown that the protein product of the Methanococcus jannaschii MJ0503 gene aksA, AksA, catalyzes the condensation of -ketoglutarate and acetyl-CoA to form trans-homoaconitate and the condensation of -ketoadipate or -ketopimelate with acetyl-CoA to form, respectively, the (R)-(homo)₂citrate[(R)-2-hydroxy-1,2,5-pentanetricarboxylic acid] or (homo)₃citrate [(R)-2-hydroxy-1,2,6-hexanetricarboxylic acid] (4). These steps are shown in Fig. 1 as steps 1, 6, and 10. In this biosynthetic pathway there are also three reactions in which homologs of ()-threo-isocitrate undergo reactions mechanistically like the NAD-dependent isocitrate dehydrogenase reactions to form -ketoacids (Fig. 1, steps 5, 9, and 13). Based on the expected mechanism of these reactions and the observed stereochemistry of the reaction products, it is very likely that genes homologous to NAD-dependent isocitrate dehydrogenase may be responsible for producing the enzymes that catalyze these reactions. M. jannaschii has two open reading frames (ORFs) that can produce proteins homologous to isocitrate dehydrogenase, the NADP-dependent isocitrate dehydrogenase gene MJ0720 (37.3% identity in 193 amino acids to the Escherichia coli isocitrate dehydrogenase), and the NAD-dependent isocitrate dehydrogenase gene MJ1596 (32.0% identity in 219 amino acids to the E. coli isocitrate dehydrogenase) (1). These ORFs correspond, respectively, to the MTH0184 and MTH1388 genes in Methanobacterium thermoautotrophicum (11). We have cloned the genes for these proteins from M. jannaschii, overproduced their enzymes in E. coli, isolated the enzymes, and determined the enzymatic reactions that each catalyzes. We can now report that the gene product of the MJ1596 gene is the AksF enzyme involved in the biosynthesis of coenzyme B that carries out the NAD-dependent decarboxylation of the homologs of ()-threo-isocitrate and that the MJ0720 gene encodes a NAD-dependent 3-isopropylmalate dehydrogenase (LeuB).

Identification, cloning, and high-level expression of the gene product. Expression of the MJ1596 and MJ0720 genes in E. coli was accomplished by the following procedure. The MJ1596 and MJ0720 genes were amplified by PCR using genomic DNA from M. jannaschii (David E. Graham, Urbana, Ill.) as the template. The synthetic oligonucleotide primers 5'CATGCATATGATGAAGGTGTGTGTTATAGAA3' and 5'CAGTGGATCCTTAATATCCCTTTAACTTCTTTCT3' (derived from the MJ1596 DNA sequence) and the primers 5'CATGCATATGGTGATAAGTATGGATAAA3' and 5'GATCGGATCCTTATTCTTCTCTTACTCTTTT3' (derived from the MJ0720 DNA sequence) were used. Each set of primers was used to insert the NdeI and BamHI restriction sites at the 5' and 3' ends. PCR was performed, with 1 µg of genomic DNA as the template, with 20 µmol of each primer, 3.75 U of AmpliTaq DNA polymerase, and 10 µl of 10× PCR buffer (Perkin Elmer, Branchburg, N.J.) in a final volume of 100 µl. Each cycle was set for 1 min of denaturation at 95°C, 2 min of annealing at 60°C, and 3 min of extention at 72°C, and 35 reaction cycles were carried out in a DNA thermal cycler. After purification of the PCR products via absorption and desorption with a QIAquick spin column (QIAGEN, Valencia, Calif.), the products were digested with NdeI and BamHI and were cloned into a NdeI-BamHI-digested pT7-7 plasmid vector to obtain the constructs pT7-7-MJ1596 and pT7-7-MJ0720. The constructs were transformed into E. coli TB1 for plasmid preparation and into E. coli BL21(DE3) for protein expression. The cells of E. coli BL21(DE3) transformed with pT7-7-MJ1596 or pT7-7-MJ0720 plasmid were grown in Luria-Bertani medium (200 ml), supplemented with 100 mg of ampicillin/liter at 37°C to an absorbance at 600 nm of 1.0.

Preparation and analysis of cell extracts. Cell extracts were prepared by sonication of the cell pellets (~300 mg [wet weight]) suspended in 2 to 3 ml of buffer [50 mM N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES) (pH 7.0), 10 mM MgCl₂, and 20 mM mercaptoethanol], followed by centrifugation (10 min, 14,000 × g). SDS-PAGE analysis of the pellets and the cell extracts showed that most (>90%) of the overexpressed proteins were present in a soluble form. Heating the extracts at 60°C for 10 min, followed by centrifugation (10 min, 14,000 × g), removed most of the E. coli proteins and left essentially pure solutions of the overexpressed proteins (>95% pure by SDS-PAGE). These solutions were used for the analyses reported here. The protein concentrations were determined using the Bio-Rad protein assay.

Measurement of enzymatic activities. The activities of the enzymes were measured spectrophotometrically in 1-ml quartz cuvettes at 60°C by following NAD reduction at 340 nm. A molar absorptivity of 6.2 × 10³ M¹ cm¹ was used to determine the concentrations of NADH and NADPH. Thus, into a quartz cell at 60°C we added 500 µl of TES buffer (50 mM TES [pH 7.4], 10 mM MgCl₂ and 20 mM mercaptoethanol), 6 µl of a 0.1 M solution of the desired substrate, 2 µl of a 0.1 M solution of NAD or NADP, and water to 1 ml. After equilibration to 60°C for ~5 min, 10 µl of the enzyme solution was added with mixing. For determination of K_m and V_max values, concentrations of the various substrates were varied over a range of 0 to 1.0 mM in this 1.0-ml assay mixture. One unit of enzyme activity was defined as the reduction of 1 µmol NAD or NADP per min. DL-(threo)Isopropylmalic acid was obtained from Waco Pure Chemical Industries, Ltd., Osaka, Japan. threo-D_s(+)Isocitrate, threo-isocitrate, and DL-isocitrate were obtained from Sigma Chemical Co. threo-Isohomocitrate (1-hydroxy-1,2,4-butanetricarboxylic acid), threo-iso(homo)₂citrate (1-hydroxy-1,2,5-pentanetricarboxylic acid), and threo-iso(homo)₃citrate (1-hydroxy-1,2,6-hexanetricarboxylic acid), their () isomers, and a mixture of threo-isocitrate and erythro-isocitrate were synthesized as previously described (4).

Product identification. The products of the NAD-dependent oxidations of each of the substrates were identified by gas chromatography-mass spectrometry (GC-MS). The general procedure in each case was to incubate the enzyme with the substrates, isolate the products, convert the products into suitable methyl ester derivatives, and analyze them by GC-MS using a known sample as a reference. Incubations were conducted as described above except that an excess of NAD and enzyme was used to drive the reaction to completion. The procedures for the preparation, isolation, and subsequent GC-MS analyses of the methyl esters have been described previously (4).

Reactions catalyzed by cloned enzymes. As reported in Table 1, the MJ1596-encoded enzyme was able to use only the homologs of threo-isocitrate as substrates. The enzyme was also unable to use any isomer of isocitrate or isopropylmalate as a substrate. This behavior is to be contrasted with the MJ0720-encoded enzyme, which was found to use only threo-isopropylmalate as a substrate. Neither enzyme was found to use NADP as an oxidant. This coenzyme specificity is the same as that observed for the isopropylmalate dehydrogenase isolated from Salmonella enterica serovar Typhimurium (10).

Thermostability of cloned enzymes. The crude extracts containing the cloned enzymes were heated for 10 min at different temperatures, and after the precipitated proteins were removed by centrifugation, the remaining activity was measured at 60°C using either threo-isohomocitrate, threo-iso(homo)₂citrate, threo-iso(homo)₃citrate, or threo-isopropylmalate and NAD as substrates. As can be seen from Fig. 2, the MJ1596-encoded enzyme was stable at 100°C for 10 min, whereas the LeuB enzyme lost 50% of its enzymatic activity when heated at 80°C for 10 min. Thus, the enzyme is not quite as thermostable as the LeuB enzyme isolated from Thermus thermophilus (6).

View larger version (19K): [in this window] [in a new window]   FIG. 2.   Heat stabilities of the iso(homo)13citrate dehydrogenase () and isopropylmalate dehydrogenase (). The crude extracts containing the overexpressed enzymes were heated for 10 min at the indicated temperatures, and after the precipitated proteins were removed by centrifigation, the remaining activity was measured at 60°C using NAD plus threo-isohomocitrate or threo-isopropylmalate. Identical inactivation curves were obtained for the iso(homo)13citrate dehydrogenase with threo-iso(homo)2citrate and threo-iso(homo)3citrate.

13

13