INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

To utilize polysaccharides such as glucans to meet carbon and energy requirements, heterotrophic organisms depend on a catabolic pathway involving the interaction of multiple hydrolytic enzymes, transporter complexes, and regulatory systems coordinating gene expression of pathway-specific proteins (41). During hydrolysis of the homopolymer cellulose, for example, the consortium of catalytic enzymes consists of endoglucanases (1,4--D-glucan 4-glucohydrolase [EC 3.2.1.4]), which randomly hydrolyze internal -1,4 glycosidic bonds; cellobiohydrolases (-D-glucan cellobiohydrolase [EC 3.2.1.91]), also referred to as exoglucanases, which remove cellobiose from either the nonreducing or reducing ends of cellooligomers; and -glucosidases (-D-glucoside glucohydrolase [EC 3.2.1.21]), which convert cellobiose to glucose. These classes of enzymes have been documented in a number of fungal and bacterial systems (4, 5, 39), while other glucan-catabolyzing enzymes are less well understood.

Thermotoga neapolitana, a marine hyperthermophile isolated from geothermally heated biotopes, belongs to the order Thermotogales. T. neapolitana shares with other Thermotogales, specifically Thermotoga maritima, both the capacity to catabolize a wide variety of - and -linked glucans and a fermentative metabolism. While Thermotogales elaborate hydrolases such as amylases, cellulases, glucosidases, galactosidases, mannanases, and xylanases (6, 7, 10, 11, 23, 37), neither T. neapolitana (D. Y. Yernool, G. Swiatek, and J.-D. Bok, unpublished data) nor T. maritima (27) has been shown to have a gene for a cellobiohydrolase, a key enzyme in classical cellulolytic systems.

In this paper, we report the characterization of a catabolic gene cluster in T. neapolitana encoding two enzymes: a cellobiose phosphorylase (CbpA) and a -glucan glucohydrolase (GghA). Cellobiose phosphorylases (EC 2.4.1.20) cleave cellobiose by phosphorolysis, yielding glucose-1-phosphate as one of the products, while -glucan glucohydrolases or exoglucohydrolases (1,4--D-glucan glucohydrolase [EC 3.2.1.74]) preferentially act on cellooligomers, releasing glucose (17, 31, 37, 43). In addition to the functional and molecular characterization of GghA and CbpA, we propose a nonconventional, ATP-conserving, catabolic pathway for glucan utilization consisting of endoglucanases CelA and CelB (7), a -glucan glucohydrolase (GghA), and a cellobiose phosphorylase (CbpA).

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains and culture media. T. neapolitana NS-E (kindly provided by K. O. Stetter and R. Huber, University of Regensburg, Regensburg, Germany) was grown anaerobically in MMS medium (9) at 77°C with cellobiose or glucose (1%, wt/vol) as a carbon source in static culture for 24 h. A cosmid DNA library in vector pLAFR3 (36) of T. neapolitana strain NS-E in Escherichia coli DH5 (gift from Kenneth Knoll, University of Connecticut, Storrs, Conn.) was used. Commercially available E. coli strains were grown in Luria-Bertani (LB) medium or super broth (32) containing either ampicillin (50 µg/ml) or tetracycline (25 µg/ml). Some of the abbreviations used in this report are as follows: ORF, open reading frame; oNP, o-nitrophenol; PC, sodium phosphate-sodium citrate; pNPA, pNP--D-arabinoside; pNPC, pNP--D-cellobioside; pNPG, pNP--D-glucoside; pNPL, pNP--D-lactoside; pNP, p-nitrophenol; pNPX, pNP--D-xyloside; pNPG, pNP--D-glucoside; oNPG, oNP--D-glucoside; oNPGal, oNP--D-galactoside.

Purification of glucan glucohydrolase. T. neapolitana was grown on cellobiose, collected by centrifugation, washed twice in Tris-HCl (0.1 M [pH 7.5] at 4°C), resuspended in the same buffer, and lysed by sonication. Cell debris was removed, the proteins in the supernatant were precipitated using ammonium sulfate (final concentration, 80%), collected, and dissolved in 50 mM Tris-HCl (pH 7.5) (20 ml). The ammonium sulfate precipitation was repeated twice, and the resultant cell extract was dissolved in 20 mM piperazine-HCl buffer (pH 5.1) (20 ml) and desalted by ultrafiltration using a PM 10 membrane (Amicon, Cambridge, Mass.). The pH of this cell-free extract was adjusted to 4.3 by addition of sodium citrate (0.15 M, pH 4.1); precipitated proteins were removed by centrifugation. The pH of the supernatant containing aryl -glucosidase activity was raised to 5.1 using 0.2 M sodium citrate. Purification of the aryl-glycosidase was achieved by anion-exchange chromatography using an FFQ-Sepharose column (XK26; 60-ml bed volume; Pharmacia, Piscataway, N.J.) equilibrated with 20 mM piperazine buffer (pH 5.1). Bound proteins were eluted with a linear gradient of 0 to 0.3 M NaCl. Fractions from a single peak with activity towards aryl-glycosides were pooled, desalted by ultrafiltration, and subjected to gel filtration (BioGel P-60 column, 1.5 by 97 cm; 50 mM MOPS [pH 7.0]). Active fractions were pooled, the concentration of ammonium sulfate was adjusted to 0.2 M, and the proteins were then fractionated by hydrophobic-interaction chromatography (Phenyl-Sepharose FF; XK26 column; 20-ml bed volume; Pharmacia). Proteins bound to the column were eluted using a reverse gradient (0.2 M ammonium sulfate in 20 mM Tris-HCl [pH 7.5] to distilled water). Active fractions were pooled, desalted, and further purified using a galactose-agarose column (p-aminobenzyl-1-thio--D-galactopyranoside; Sigma, St. Louis, Mo.) equilibrated with binding buffer (0.1 M NaPO₄ [pH 7.0], 0.15 M NaCl). Bound proteins were eluted with elution buffer (binding buffer with 0.3 M glucose). After buffer exchange to 20 mM BisTris (pH 6.5), pooled active fractions were applied to a Mono-Q column (HR 10/10; Pharmacia) and eluted with a linear gradient of 0.05 to 0.5 M NaCl. Final purification was achieved by discontinuous preparative polyacrylamide gel electrophoresis (PAGE) using a PrepCell (Bio-Rad, Richmond, Calif.) following the manufacturer's instructions.

Purification of recombinant cellobiose phosphorylase. E. coli clone 13CBPFM was grown in 5 liters of LB medium containing ampicillin (50 µg/ml) to an optical density at 600 nm of 0.5. Expression of the cbpA gene was induced by addition of arabinose (final concentration, 0.015%). Four hours postinduction, cells were collected by centrifugation (4,000 × g, 15 min, 4°C). Cell pellets were resuspended in buffer (50 mM Tris-HCl buffer [pH 7.9], 50 mM dextrose, 1 mM EDTA) containing lysozyme (4 mg/ml) (Sigma) and sonicated. Heat-labile E. coli proteins were removed from the cell extract by heat treatment (75°C for 15 min) and precipitated by centrifugation (15,000 × g, 30 min, 4°C). Supernatant was equilibrated with ammonium sulfate (final concentration, 1.0 M) and loaded onto a phenyl-Sepharose column (XK26; Pharmacia; 100-ml bed volume). Bound proteins were eluted with a reverse gradient, ammonium sulfate (1.0 M) in Tris-HCl buffer (20 mM, pH 7.8) to distilled H₂O and distilled H₂O to 50% acetonitrile. Active fractions from a single peak were pooled, desalted, and further purified using immobilized metal-ion chromatography (Ni-nitrilotriacetic acid resin; Qiagen, Valencia, Calif.; 10-ml bed volume) with a linear gradient of 0.01 to 0.3 M imidazole, following the manufacturer's instructions. Active fractions were pooled, buffer exchanged by ultrafiltration (Amicon YM10; Millipore, Bedford, Mass.), and further purified by anion-exchange chromatography (Mono-Q HR 5/5; Pharmacia). The pool was equilibrated with loading buffer (20 mM piperazine [pH 6.0], 10 mM NaCl), and bound protein was eluted with a linear gradient of 0.01 to 0.5 M NaCl. Active fractions from the single peak were pooled and further purified by ultrafiltration (Microcon YM50; Millipore).

Glucan glucohydrolase assays. Aryl-glycosidase activity was determined using either pNP- or oNP-glycoconjugates at 5 mM final concentration in a 15-min assay (42). The glycoconjugates used included pNPA, pNPC, pNPG, pNPL, pNPX, pNPG, oNPG, and oNPGal. Released pNP and oNP were measured at 405 and 420 nm, respectively; activity was calculated using a standard curve developed under assay conditions. Hydrolysis of cellobiose and lactose was analyzed using the glucose hexokinase kit following the manufacturer's instructions (Sigma). One unit of enzyme activity corresponds to release of 1 µmol of pNP, oNP, or glucose/min (for cellobiose as the substrate, one unit corresponds to the release of 2 µmol/min). All assays were carried out in 100 mM (final concentration) PC buffer (pH 6.4) at 85°C unless otherwise cited.

Cellobiose phosphorylase assay. Cellobiose phosphorylase activity was determined by measuring the amount of glucose 1-phosphate formed from phosphorolysis of cellobiose (Sigma). The enzyme was incubated at 85°C for 15 min with 10 mM cellobiose in PC buffer (pH 5.5). The reaction was stopped by boiling for 10 min, and the amount of glucose 1-phosphate produced was determined by a coupled enzyme assay measuring the appearance of NADPH at 340 nm (30). The reaction mixture contained phosphoglucomutase (4 U ml¹), glucose-6-phosphate dehydrogenase (2.0 U ml¹) (Boehringer Mannheim, Indianapolis, Ind.), 3 mM NADP, and 5 µM glucose 1,6-bisphosphate (Sigma) in 80 mM triethanolamine buffer (with 4.4 mM MgCl₂ [pH 7.5]). One unit of activity corresponds to the release of 1 µmol of glucose 1-phosphate/min.

Analytical methods and enzymatic characterization. The molecular mass of glucan glucohydrolase and cellobiose phosphorylase was determined by sodium dodecyl sulfate (SDS)-PAGE according to Laemmli (24) and by gel filtration using an analytical Suparose 12 HR column (Pharmacia). Protein bands in SDS-PAGE gels were visualized with either silver stain for GghA or Coomassie blue for CbpA. To determine the N-terminal sequence, the protein band was transferred to a polyvinylidene difluoride membrane, and the sequence was determined using an Applied Biosystems 475A gas phase sequenator (Applied Biosystems, Foster City, Calif.). Protein concentrations were estimated by the Bradford dye-binding method (Bio-Rad) with bovine serum albumin as the standard and using A₂₈₀ and the molar extinction coefficient (12). Isoelectric focusing was used to determine the isoelectric point (pI) (Phast System; Pharmacia). pH optima were determined using PC buffer (0.1 M, pH 3.6 to 7.0) and phosphate buffer (pH 6.0 to 7.5). To determine the optimum temperature for activity for GghA, a mixture of GghA in PC buffer (0.1 M, pH 6.4) and pNPG (5 mM) were sealed in 2-ml gas chromatography vials (Wheaton, Vineland, N.J.). Activity was measured after heating in an oil bath (70 to 120°C) for 20 min. Released pNP was quantified as described for the enzyme assays. The temperature optimum for CbpA was determined by the cellobiose phosphorylase assay run for 15 min at various temperatures prior to the coupled enzyme assay as described above. The glucan glucohydrolase's thermal stability was evaluated by heating the enzyme (0.19 µg) in sealed vials in an oil bath at 90 and 95°C for up to 9 h in MOPS buffer (20 mM, pH 7.0). After cooling on ice, residual activity was estimated using pNPG as the substrate. The effect of end product on hydrolytic activity was assessed by measuring the rate of release of pNP from pNPG in the presence of increasing concentrations of glucose (0 to 1.0 M).

Determination of anomeric carbon configuration of the hydrolysis products. The method described by Baker and Himmel (3) was used with minor modifications. GghA (0.9 µg) was mixed with oNPG (10 mM final concentration) in 5 mM HEPES buffer (pH 7.2), incubated at 22°C for 10 min, and immediately placed on ice. A 20-µl aliquot of the reaction mixture was fractionated on an Aminex HPX-87C column run at 25°C at 0.5 ml/min. The retention times and the extent of mutarotation were compared to those of freshly prepared controls (-glucose and -glucose). Under these conditions, mutarotation was negligible (/ = 4.26; at equilibrium, / = 1.6).

Cloning, sequencing, and analysis of gghA and cbpA from T. neapolitana. All DNA manipulations were carried out using standard methods (32). A genomic DNA library of T. neapolitana was constructed and screened for thermostable glycosidases as described earlier (7). The DNA sequence (partial) of the inserts contained in selected clones was determined using fluorescent dye terminator sequencing chemistry with an ABI 373 automated sequencer (Applied Biosystems). The sequence was assembled and analyzed using BLAST (2). Initially, clone p46B1 containing part of the sequence of the gghA gene was identified. The sequence at the other end of the p46B1 insert revealed similarities to known cellobiose phosphorylases. Based on this sequence, two PCR primers, OT305PA1 (5'TCCAGTC CGCCCTTCCTATGAG3') and OT317PA1 (5'AAGGCATT TCACAGGAGAG GTC 3'), were designed. A PCR screen was conducted using these primers on a T. neapolitana cosmid library. By analyzing PCR amplicons by agarose gel electrophoresis, two cosmid clones, RUC 270 and RUC 278, containing the gghA and cbpA genes were identified; both gghA and cbpA genes were cloned, and the DNA sequence was determined.

Comparison of amino acid sequences of cellobiose phosphorylases and -(1-2) glucan synthetases. Percent similarity was calculated using the GAP program of GCG version 9.1 (Genetics Computer Group, Madison, Wis.). Complete amino acid sequences were used except for domains from Clostridium thermocellum Cbp (amino acids 564 to 975), Rhizobium meliloti NdvB (amino acids 2090 to 2843), and Brucella abortus Cgs (amino acids 2084 to 2817).

Expression of the cellobiose phosphorylase cbpA gene in E. coli. The cbpA gene was amplified using primers CBP.509 (5'AGGATCCATAGCATGAAGTTCGGCTACTT 3') and CBP.R510 (5'CAAGCTTTCGCTCTTTGCTGTAGTTTG 3'), designed with BamHI and HindIII restriction sites, respectively (underlined sequence). The amplicon was cloned into the pBAD-TOPO-TA vector (Invitrogen, Carlsbad, Calif.) under the control of an inducible arabinose promoter, resulting in the addition of a C-terminal (His)₆ tag.

Nucleotide sequence accession number. The nucleotide sequence reported in this paper has been submitted to GenBank and EMBL Data Bank under accession number AF039487.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Purification of glucan glucohydrolase (GghA). A seven-step protocol was used to purify GghA, giving 184-fold purification and a total recovery of 32% (Table 1). The specific activity of the purified enzyme is 807 U/mg toward oNPG. SDS-PAGE analysis showed that the purified enzyme had an apparent molecular mass of 52.5 kDa (Fig. 1). A few faint bands were visible on the silver-stained gel as purified sample (610 ng) was loaded in excess (sensitivity of silver staining is 2 to 10 ng of protein/band [13]). The N-terminal sequence of GghA was MKKFPEGFLWGVATASYQIEG, which agrees with the DNA sequence data (see below).

View larger version (49K): [in this window] [in a new window]   FIG. 1.   SDS-PAGE analysis of purified native glucan glucohydrolase (GghA) and recombinant cellobiose phosphorylase (CbpA). (A) Glucan glucohydrolase. Lane 1, fraction after hydrophobic interaction chromatography (2 µg); lane 2, fraction after affinity chromatography (1 µg); lane 3, purified GghA after preparative PAGE (0.61 µg). (B) Cellobiose phosphorylase. Lane 1, high-range protein molecular size markers; lane 2, purified CbpA after Mono-Q chromatography (6.7 µg).

Characterization of GghA. GghA exhibited optimal activity over the pH range 6.4 to 7.0 and at 95°C. The enzyme was highly thermostable, retaining 85% activity after incubation for 9 h at 90°C and 88% activity after 1 h at 95°C. Active GghA was a monomer (determined by gel filtration) with an apparent molecular mass of 58.9 kDa. GghA showed broad-spectrum glycosidase activity, releasing oNP from both oNPG and oNPGal with high specific activities, 807 and 778 U/mg, respectively (Table 2). GghA showed higher activity towards aryl-glucosides in which the nitrophenol group was attached to the ortho rather than the para position. In addition, GghA hydrolyzed pNPC and pNPL, and the lower rate of pNP release compared to the release of reducing sugars suggests that the attack on the substrate takes place from the nonreducing end of the glycoside. To determine the true substrate specificity of the enzyme, GghA was tested for its ability to hydrolyze naturally occurring disaccharides, cellobiose and lactose. The specific activity towards lactose (251 U/mg) was marginally higher than that towards cellobiose (236 U/mg). In view of the organism's ability to grow on glucans, and to establish the precise role for GghA in the glucan catabolic pathway, the kinetic constants for hydrolysis of glucooligosaccharides were determined. Comparable k_cat values of 345.7 and 333.7 s¹ were found for cellotriose and cellotetraose, respectively (Table 3). The K_m for cellotetraose (2.15 mM), however, is significantly lower than that for cellotriose (4.55 mM), resulting in a twofold increase in the k_cat/K_m value with cellotetraose as the substrate. Interestingly, the K_m for cellobiose is 13-fold higher than the K_m for cellotetraose, indicating a weak interaction between the enzyme and cellobiose (Table 3).

1

1

View larger version (14K): [in this window] [in a new window]   FIG. 2.   Effect of substrate (pNPG) and end product (glucose) on activity of GghA. (A) Lineweaver-Burke plot of rate of pNP release as a function of pNPG concentration. (B) Effect of end product (glucose) on rate of pNP release from pNPG. , v(U/mg)@[I] = 0; , v(U/mg)@[I] = 50; , v(U/mg)@[I] = 100; , v(U/mg)@[I] = 200. v(U/mg)@[I] = specific activity at various concentrations of inhibitor.

View larger version (10K): [in this window] [in a new window]   FIG. 3.   HPLC analysis of products of hydrolysis and transglycosylation of GghA. (A) Production of cellotriose (G3) and glucose (G1) from cellobiose (G2). (B) Production of cellotetraose (G4), cellobiose (G2), and glucose (G1) from cellotriose (G3). (C) Determination of the configuration at the newly formed anomeric center.

Purification of recombinant cellobiose phosphorylase (CbpA). Recombinant CbpA was purified by a three-step protocol, resulting in 17-fold purification. The specific activity of the purified enzyme is 11.8 U/mg towards cellobiose. SDS-PAGE analysis showed a homogeneous enzyme preparation with an apparent molecular mass of 93 kDa (Fig. 1B), which is in agreement with sequence-derived data.

Characterization of CbpA. CbpA showed optimal activity at 85°C over a pH range of 4.5 to 6.0. Its pI was 4.8. The thermostability of CbpA was affected by the presence or absence of substrate: when incubated with substrate at 85°C, CbpA remained active for 2 h; when incubated without substrate, there was little activity after 15 min. Without phosphate in the reaction mixture, CbpA failed to hydrolyze the substrate. CbpA shows activity only towards cellobiose; it was not active towards cellotriose or the disaccharides lactose, chitobiose, and xylobiose. The kinetic constants were determined for the phosphorolysis of cellobiose by fitting data to the Michaelis-Menten equation using linear regression: the K_m for cellobiose was 1.42 mM, the k_cat was 26.3 s¹, and k_cat/K_m was 18.3 s¹ mM¹.

Cloning, sequencing, and analysis of the glucan catabolic cluster. Preliminary DNA sequencing and analysis were conducted on the inserts from eight clones identified in a prior screening protocol (7). Of these clones, p46B1 contained the partial sequence of the gghA gene and an incomplete upstream ORF with similarities to cellobiose phosphorylases. Together, the two genes constitute a cluster involved, in all likelihood, in the catabolism of glucooligosaccharides. To define this cluster, two cosmid clones, RUC 270 and RUC 278, with similar restriction maps were identified by screening the T. neapolitana cosmid library. An insert within clone RUC 270 was subcloned to obtain the full-length gghA gene, and primer walking was used to completely sequence the cellobiose phosphorylase (cbpA) gene. cbpA and gghA, encoding 812 and 444 amino acid proteins, respectively, are separated by a 103-bp intergenic region (Fig. 4). The structural organization of the cluster consisting of cbpA and gghA was confirmed by Southern blotting. Further analysis of the sequence 3' to the gghA gene revealed the presence of a partial ORF encoding a putative -amylase (amyB); and 5' to the cbpA gene, several short AT-rich sequence motifs are present, one of which has 95% identity over its 23-bp length (Fig. 4) to motifs present 5' of endoglucanase clusters from T. maritima and T. neapolitana (10, 25). Such regions may be involved in the regulation of glucan catabolic gene clusters.

View larger version (15K): [in this window] [in a new window]   FIG. 4.   Molecular organization of oligosaccharide catabolic cluster. Arrows indicate the direction of gene transcription. cbpA, cellobiose phosphorylase; gghA, glucan glucohydrolase; amyB, partial ORF of putative -amylase; AT-rich region, conserved-sequence motif present upstream of other endoglucanase genes in Thermotoga spp.; RBS, ribosome-binding site; bases 1744 to 2889, domain common to C. thermocellum cellodextrin phosphorylase (1, 38); aa, amino acids.

View larger version (39K): [in this window] [in a new window]   FIG. 5.   Comparison of primary sequence of GghA with that of -glucosidase from B. polymyxa. The secondary-structure elements were defined using the crystal structure of B. polymyxa -glucosidase (33). Barrel, helix; arrow, -strand; dashed arrow, secondary structure within loop C; *, conserved active-site amino acids; Gln20 and Glu405, amino acids capable of bidentate hydrogen bonding.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We report the purification, characterization, and cloning of a cellobiose phosphorylase and a -glucan glucohydrolase cluster from T. neapolitana. Few cellobiose phosphorylases or glucan glucohydrolases have been defined at the biochemical and molecular level; this may be due in part to the lack of methods for direct screening and selection of these enzymes. For instance, characterization of an enzyme as a glucan glucohydrolase requires HPLC analysis of the products of hydrolysis of glucooligomers. Also, no direct colorimetric or fluorometric methods are available for analysis of cellobiose phosphorylase activity.

GghA was purified from T. neapolitana extracts using a multistep purification protocol, as Thermotoga spp. have the potential to produce a number of glycosyl hydrolases (7, 8, 10, 11, 23, 37). Purified GghA has broad substrate specificity, with similar specific activities towards the disaccharides lactose and cellobiose, reflecting the polyspecific nature of family 1 glycosyl hydrolases to which it belongs (15). GghA, like other family 1 enzymes, hydrolyzes various aryl--glycosides, but it also exhibits biphasic kinetic behavior towards pNPG: its activity increases at higher substrate concentrations (Fig. 2A). This apparent activation may be due to higher concentrations of substrate or the de novo end product or both. Our data show the involvement of both substrate-directed and end product-directed activation, suggesting that GghA's greater kinetic activity at higher substrate or end product concentrations is due to its transglycosylating capability. For example, the production of oligomers of N + 1 length by GghA (N = length of substrate) is indicative of both substrate-induced and end product-activated (glucose concentrations up to 200 mM) transglycosylation (Fig. 3A and B). This effect is similar to that reported for a cytosolic -glucosidase from guinea pig liver (14). Although similar end product activation of glucoside hydrolases has been reported for a -glucosidase from a Streptomyces sp. (29), and a family 1 glycosyl hydrolase from Microbispora bispora (44), the biochemical basis was not defined. While transglycosylation clearly plays a role in activation of GghA, our data do not rule out other mechanisms of activation operating in concert with transglycosylation.

T. neapolitana GghA was identified initially as an aryl--glycosidase based on its activity towards pNPG, an activity it shares with other glucan glucohydrolases (17, 18, 28, 31). The basis for designating T. neapolitana GghA a glucan glucohydrolase (EC 3.2.1.74) instead of a -glucosidase (EC 3.2.1.21) is its greater catalytic efficiency towards cellotetraose: the k_cat/K_m for GghA's hydrolysis of cellotetraose is 16-fold greater than that for cellobiose, while its overall substrate preference is cellotetraose > cellotriose > cellobiose. GghA's k_cat values for cellotetraose (333.6 s¹) and cellotriose (345.7 s¹) are comparable, indicating that the rate of formation of the covalent glucosyl-enzyme intermediate and subsequent release of glucose from the complex are essentially the same for both cellooligomers. The K_m for cellotetraose, however, is half that of cellotriose, implying a better fit for the enzyme with the longer substrate. Indeed, it can be suggested that GghA has at least four binding subsites, all of which, in the case of cellotetraose, interact with the substrate and result in the strongest enzyme-substrate interaction.

Such tandem multisugar binding sites and a tendency towards greater catalytic efficiency (k_cat/K_m) with increasing degrees of substrate polymerization have been reported for a family 1 glucan glucohydrolase (II) from barley (19), an exoglucosidase from the archaeon Sulfolobus solfataricus (28), and a -glucosidase (BglA) from B. polymyxa (33). Loop C in B. polymyxa BglA (amino acids 297 to 328) (Fig. 5), for example, has been specifically identified both with substrate binding and with providing additional subsites for the binding of larger glucooligomers. Given the high level of primary sequence conservation between T. neapolitana GghA and B. polymyxa BglA (68% sequence similarity and 46% identity over the entire length), it is not surprising that GghA shows greater catalytic efficiency towards glucooligomers longer than cellobiose. In light of GghA's activity towards cellobiose and lactose, it is interesting that conserved amino acids Gln-20 and Glu-405, which enable the enzyme to form bidentate hydrogen bonds with oxygen atoms of glycosides, may account for the dual glycosidase and galactosidase activity of family 1 members, including GghA from T. neapolitana (33, 40).

From a bioenergetic perspective, cellobiose phosphorylases are interesting enzymes, for the energy of the -1,4 glycosidic bond is conserved during phosphorolysis in the form of glucose 1-phosphate. One ATP molecule is needed to activate the other glycosyl product of the reaction. Glucose 1-phosphate is then converted to glucose 6-phosphate by phosphoglucomutase, a non-energy-consuming isomerization. Conversely, when a -glucosidase hydrolyzes cellobiose, glycosidic bond energy is lost, and activation of the two glycosyl products requires two ATP molecules rather than one. To date, only cellobiose phosphorylases from C. gilvus (34), C. thermocellum (1, 38), and C. stercorarium (30) have been purified and characterized. The CbpA from T. neapolitana is the first report of a cellobiose phosphorylase from any hyperthermophile.

T. neapolitana and T. maritima are closely related species with minor differences in their physiological characteristics (20). A comparison of their glycosyl hydrolases, made possible by recent publication of the T. maritima genome (27), reveals that both gene sequences and the arrangement of catabolic gene clusters are highly conserved. Notably, both species apparently lack a gene encoding a cellobiohydrolase (27; D. Y. Yernool, G. Swiatek, and J.-D. Bok, unpublished data). The absence of the enzyme may explain the inability of Thermotoga spp. to hydrolyze crystalline substrates such as Avicel despite their capacity for hydrolysis of noncrystalline substrates such as acid-swollen cellulose and barley -glucan. As cellobiohydrolases play a key role in classical cellulolysis and as sugar catabolism has been studied in detail in several hyperthermophilic genera, including Thermotoga (35), we propose a previously unreported catabolic pathway for glucan utilization. This nonconventional, ATP-conserving pathway consists of endoglucanases (CelA and CelB) (7), a -glucan glucohydrolase (GghA), and a cellobiose phosphorylase (CbpA) (Fig. 6). Other potential components of this catabolic pathway might include a laminarinase (LamA) and a laminaribiase/-glucosidase (BglB), which act on both -1,3 and -1,4 linkages (45, 46).

View larger version (13K): [in this window] [in a new window]   FIG. 6.   Proposed glucan catabolic pathway in T. neapolitana. A schematic conversion of cellooligomers to activated glucosyl molecules. Enzymes indicated are CelA and CelB, endoglucanases (7) active in or on the toga; GghA, glucan glucohydrolase, and CbpA, cellobiose phosphorylase, intracellular enzymes (this work); and LamA and BglB, laminarinase and -glucosidase, respectively (45, 46).

Hydrolysis of internal glycosidic linkages of polymeric glucans by endoglucanases CelA and CelB begins the attack and results in the production of soluble glucooligomers. As CelB has an N-terminal signal peptide sequence, this initial processing probably occurs in or on the toga, the proteinaceous outer sack covering all Thermotogales. That neither CelB nor CelA is secreted but is extracted from the pellet when purified from T. neapolitana grown on cellobiose (6) further suggests that initial activity involves the toga. The subcellular location of CelA, however, is not clear, as it lacks a secretory signal peptide sequence. The soluble products of the initial hydrolysis are then acted on by GghA, presumably an intracellular enzyme, which preferentially attacks the longer glucooligomers cellotriose to cellohexaose (the longer the glucooligomers, the lower their K_ms), releasing glucose from the nonreducing end and eventually producing the disaccharide intermediate cellobiose. At low concentrations of cellobiose (CbpA's K_m for cellobiose is 1.42 mM, compared to 28.6 mM for GghA), and given the enzyme's preference for a single substrate, CbpA, also presumably intracellular, then attacks cellobiose, producing the activated molecule glucose 1-phosphate and glucose.

Some cellobiose might be processed by other resident glycosyl hydrolases; however, the K_m of BglB (46) for cellobiose (50 mM) is 35-fold greater than that of CbpA, a strong indication that CbpA may be the primary enzyme for processing cellobiose in T. neapolitana. Further support for inclusion of CbpA in this pathway is the enzyme's energy-conserving mode of action: when cellobiose is converted to its glycosyl substituents by CbpA, one fewer ATP molecule is expended for every cellobiose molecule processed. For an organism with fermentative metabolism such as T. neapolitana, this represents a significant metabolic advantage. It is interesting that if cellobiohydrolase were present, the energy conserved would be greater, as there would be higher yields of cellobiose per molecule of glucooligosaccharide processed. Other important questions that bear on this issue include the type of glucans and polysaccharides present in the organism's ecological niche and what role, if any, other microbes play in complementing the degradative capability of Thermotogales. Finally, a number of genes encoding putative glycosyl hydrolases have been described in T. maritima (27). Functional analyses of these gene products and studies on regulation of their expression will undoubtedly further our understanding of the process of acquisition of carbon and energy by Thermotogales.