Previous Article | Next Article 
Journal of Bacteriology, October 2000, p. 5325-5331, Vol. 182, No. 19
Center for Pharmaceutical Biotechnology,
University of Illinois, Chicago, Illinois
606071; Department of Biochemistry and
Molecular Biology, Odense University, DK-5230 Odense M,
Denmark2; and Infectious Diseases
Research, Pharmacia Corporation, Kalamazoo, Michigan
490013
Received 1 May 2000/Accepted 14 July 2000
Oxazolidinone antibiotics inhibit bacterial protein synthesis by
interacting with the large ribosomal subunit. The structure and exact
location of the oxazolidinone binding site remain obscure, as does the
manner in which these drugs inhibit translation. To investigate the
drug-ribosome interaction, we selected Escherichia coli
oxazolidinone-resistant mutants, which contained a randomly mutagenized
plasmid-borne rRNA operon. The same mutation, G2032 to A, was
identified in the 23S rRNA genes of several independent resistant
isolates. Engineering of this mutation by site-directed mutagenesis in
the wild-type rRNA operon produced an oxazolidinone resistance
phenotype, establishing that the G2032A substitution was the
determinant of resistance. Engineered U and C substitutions at G2032,
as well as a G2447-to-U mutation, also conferred resistance to
oxazolidinone. All the characterized resistance mutations were clustered in the vicinity of the central loop of domain V of 23S rRNA,
suggesting that this rRNA region plays a major role in the interaction
of the drug with the ribosome. Although the central loop of domain V is
an essential integral component of the ribosomal peptidyl transferase,
oxazolidinones do not inhibit peptide bond formation, and thus these
drugs presumably interfere with another activity associated with the
peptidyl transferase center.
During the course of evolution, a
disproportionately large number of natural antibiotics have been
selected to act upon the ribosome. In the majority of cases, these
drugs bind to ribosomes by interacting directly with rRNA
(8). Due to the presence of multiple copies of rRNA genes in
most species, it is difficult for a sensitive organism to develop
resistance by mutating the antibiotic binding site, which is probably
one of the main reasons why the ribosome has been repeatedly selected
as an antibiotic target.
Conditions created by the extensive and sometimes uncontrolled use of
natural and synthetic antibiotics for antimicrobial therapy have
promoted the selection and rapid spread of resistant pathogens that
exhibit high tolerance to many drugs, including those which are
targeted against the ribosome. Although the occurrence of antibiotic
resistance mutations in rRNA genes is fairly rare in comparison with
other types of resistance, a number of such cases have been reported,
especially in those pathogens which contain only one or two copies of
rRNA operons in their chromosome (B. Vester and S. Douthwaite,
submitted for publication).
The rapidly growing incidence of drug resistance in pathogenic bacteria
urges the development of new antibiotics. Several new drugs targeted
against the ribosome are currently being developed, including the
oxazolidinones (3, 18). After first being identified as
prospective antimicrobial agents in 1987 (32),
oxazolidinones were abandoned for some time due to their high toxicity.
Later on, new derivatives with superior pharmacological properties were found (3, 16), and recently one of the oxazolidinone
antibiotics, linezolid (Fig. 1A), has been approved for clinical use.
Linezolid shows excellent activity against gram-positive bacteria,
including those resistant to other ribosome-targeted drugs
(36).
Oxazolidinones inhibit protein synthesis in Bacteria both in
vivo and in cell-free systems (9, 15, 30). Several
hypotheses regarding the mode of oxazolidinone action have been
proposed; these include hampering mRNA and/or tRNA binding, inhibition
of formation of the first peptide bond, and interference with
translocation (5, 9, 14, 15, 21, 30, 33). However, a
convincing description of the mechanism of the drug action still
remains elusive. Binding studies have revealed interaction of the drug with the large ribosomal subunit (20). Discovery of the
mutations G2447U and G2576U (Escherichia coli numeration) in
the 23S rRNA of laboratory-generated oxazolidinone-resistant
Staphylococcus aureus and Enterococcus faecium
strains have underscored the importance of rRNA for drug binding and/or
action (S. M. Swaney, D. L. Shinabarger, R. D. Schaadt,
J. H. Bock, J. L. Slightom, and G. E. Zurenko, Abstr.
38th Intersci. Conf. Antimicrob. Agents Chemother., abstr. C-104, 1998;
G. E. Zurenko, W. M. Todd, B. Hafkin, B. Meyers, C. Kauffman,
J. Bock, J. Slightom, and D. Shinabarger, Abstr. 39th Intersci. Conf.
Antimicrob. Agents Chemother., abstr. C-848, 1999) (see Fig. 1B). This
notion was strongly supported by analysis of oxazolidinone-resistant
mutants of the archaeon Halobacterium halobium
(19). All of more than 20 analyzed spontaneous
Linr H. halobium mutants contained mutations in
23S rRNA. The mutations were clustered within the central loop of
domain V, arguably the most functionally important rRNA region in the
ribosome. Thus, resistance mutations in gram-positive bacteria and in
archaea clearly implicate the central region of domain V of 23S rRNA as a primary component of the oxazolidinone binding site on the ribosome.
The results of these in vivo experiments are, however, in apparent
conflict with the recent in vitro studies claiming that oxazolidinones
protect A2114 and A2119 in E. coli 23S rRNA, as well as A864
in 16S rRNA, from chemical modification (21). Furthermore, in this study, a photochemically active oxazolidinone derivative was
cross-linked to the 23S rRNA in the E. coli ribosome at
positions U2113, U2118, and C2153. The seeming discrepancy between
these data and those from the mutational analysis could result either from differences in the approaches used or from idiosyncrasies in the
drug interaction with E. coli ribosomes.
In order to clarify the location of the drug binding site on the
bacterial ribosomes, we characterized oxazolidinone-resistant mutations
in E. coli rRNA. Isolation of Linr mutants
containing the G2032A mutation in 23S rRNA, and the resistance conferred by other substitutions at position 2032 as well as at position 2447, strongly argued in favor of the central region of domain
V being the main site of oxazolidinone interaction with the ribosome.
Strains, plasmids, materials, and enzymes.
E. coli
strains JM109 (35) [endA1 recA1 gyrA96 thi
hsdR17(rK
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Oxazolidinone Resistance Mutations in 23S rRNA of
Escherichia coli Reveal the Central Region of Domain V
as the Primary Site of Drug Action
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
mK+)
relA1 supE44 
(lac-proAB) (F' traD36
proAB lacIqZM15)] and HN818 (K-12
acrAB::Tn903) (provided by H. Nikaido, University of California, Berkeley) were used for propagation of the
wild-type and mutant plasmids and for drug sensitivity testing. The
E. coli mutator strain XL1-Red (Stratagene) (endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac mutD5 mutS mutT
Tn10) was used for mutagenesis of plasmid pKK3535. Cells
were grown at 37°C in Luria-Bertani (LB) medium (29)
containing antibiotics when necessary.
TABLE 1.
Plasmids used in this study
Isolation of Linr mutants in JM109 cells. Plasmid pKK3535, which contains the entire rrnB operon of E. coli (4), was randomly mutagenized by being passed through the E. coli mutator strain XL1-Red (Stratagene), as recommended by the supplier. E. coli strains JM109 and HN818 were transformed with the mutagenized pKK3535 and then plated onto LB agar plates containing 100 µg of ampicillin/ml and either 4 mM linezolid (for strain JM109) or 8 µM linezolid (for strain HN818). After 24 h of incubation, individual colonies were picked and grown overnight in 3 ml of LB medium containing 100 µg of ampicillin/ml. Plasmids were then isolated and used to transform fresh competent cells. Plasmids conferring a Linr phenotype upon retransformation were used for sequence analysis in which the 3' half of the 23S rRNA, including domains IV, V, and VI, was sequenced from a set of specific primers.
Testing antibiotic sensitivity. Antibiotic sensitivity was determined in liquid cultures and on plates. The overnight cultures of E. coli HN818 cells transformed with the wild-type or mutant plasmids grown in LB medium containing 100 µg of ampicillin/ml were diluted 500-fold (to a final concentration that gave an A650 of 0.01) into fresh medium containing 100 µg of ampicillin/ml and varying linezolid concentrations and were grown overnight. Optical densities (expressed as A650) of cell cultures were determined and plotted. Antibiotic sensitivity testing on agar plates was performed by diluting exponentially growing cultures and spotting 20-µl drops onto the surfaces of agar plates (27). Plates were photographed after incubation for 12 to 24 h at 37°C.
Quantification of mutant rRNA expression. E. coli HN818 cells transformed with wild-type or mutant pNK plasmids were grown in liquid cultures in the presence of 50 µg of ampicillin/ml. RNA was extracted from exponentially growing cells or from ribosomes using TRIzol reagent (GIBCO BRL). The ratio of mutant to wild-type 23S rRNA was determined by a primer extension technique (31) using an oligonucleotide primer (TCTTGCCGCGGGTACACTGC) complementary to the 23S rRNA segment 2035 to 2054.
Peptidyl transferase assay. The effect of linezolid on peptidyl transferase activity was tested under "fragment reaction" conditions (23). The reaction was performed in 50 µl of a buffer containing 20 mM Tris-HCl (pH 8.0), 20 mM MgCl2, 400 mM KCl, 0.4 mM puromycin, 10 pmol of E. coli ribosomes, and 1 pmol (65,000 cpm) of [35S]formyl-methionyl tRNA. Linezolid or carbomycin was added to 1.25 or 0.4 mM, respectively, and the reaction was initiated by adding 25 µl of cold methanol. Tubes were incubated for 30 min on ice, and the reaction was stopped by adding 10 µl of 10 M NaOH. After incubation for 20 min at 37°C, 200 µl of 1 M KH2PO4 was added and the product of the peptidyl transferase reaction, [35S]formyl methionyl puromycin, was extracted with 1 ml of ethyl acetate. A 0.7-ml volume of the ethyl acetate phase was mixed with 8 ml of scintillation cocktail and counted.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Isolation of Linr mutants.
Wild-type E. coli is intrinsically tolerant to oxazolidinone antibiotics due to
efflux of the drug (J. M. Buysse, W. F. Demyan, D. S. Dunyak, D. Stapert, J. C. Hamel, and C. W. Ford, Abstr. 36th
Intersci. Conf. Antimicrob. Agents Chemother., abstr. C-42, 1996).
However, we found that, at high concentrations (2 mM), linezolid
suppresses growth of the E. coli laboratory strain JM109. Therefore, this strain was used in the initial experiments on the
selection of Linr mutations. Because of the presence in
E. coli of seven rRNA (rrn) operon copies
(26), spontaneous mutations arising in one operon copy
usually remain undetected, as they are masked by the excess of
wild-type rRNA. Therefore, in order to identify rRNA mutations conferring resistance to linezolid, mutant rRNA genes were introduced into cells on a multicopy plasmid (31). The pKK3535 plasmid containing the entire rrnB operon of E. coli
(4) was randomly mutagenized by being passed through an
E. coli mutator strain, and the resulting library of mutant
plasmids was then transferred to a nonmutator strain, JM109.
Linr clones were selected on agar plates containing 4 mM
linezolid. Several colonies appeared on the plate after 24 h of
incubation. However, only 2 out of 12 clones tested maintained a
Linr phenotype after restreaking. The Linr
phenotype of these two clones was cotransferable with the plasmid, indicating that the resistance determinant resided in the plasmid. Sequencing of a portion of the plasmid-borne 23S rRNA gene revealed the
presence of the G2032A mutation in the 23S rRNA of both
Linr clones (Fig. 1B).
|
Testing the effect of the G2032A mutation engineered in the 23S
rRNA gene on linezolid resistance.
Finding the G2032A mutation in
plasmids isolated from all the Linr clones did not exclude
the potential presence of other mutations in these plasmids which
theoretically could contribute to resistance. Therefore, in order to
test whether the single G2032A mutation was sufficient to confer
linezolid resistance, this mutation was engineered in the wild-type
pKK3535 plasmid by site-directed mutagenesis (11). The
resulting plasmid, pKK2032A, was introduced into the Lins
strain HN818, and the level of linezolid tolerance was compared with
that of cells harboring either the wild-type pKK3535 plasmid or the
plasmid from one of the previously selected Linr clones
(Fig. 2). The plasmids isolated by
selection and by engineering of the G2032A mutation both conferred the
same level of linezolid resistance. Thus, the G2032A point mutation is
sufficient to render E. coli cells resistant to linezolid.
|
|
Testing other substitutions at position 2032 for
Linr.
In order to compare the effects of different
mutations at position G2032 on cell sensitivity to linezolid, each of
the three possible nucleotide substitutions was engineered at this
position in the 23S rRNA gene of the pNK plasmid. Like plasmid pKK3535, plasmid pNK contains the entire wild-type rrnB operon, but
pNK is altered in the vector portion to give a more favorable
restriction site configuration that facilitates cloning (see Materials
and Methods). The level of expression of mutant rRNA from the
pNK-derived plasmids is the same as that from pKK3535 (data not shown).
The wild-type plasmid (pNK) and its three mutant versions (pNK2032A, pNK2032U, and pNK2032C) were introduced into HN818 cells, and the level
of expression of mutant 23S rRNA was verified using the primer
extension technique (31). Mutant 23S rRNA accounted for 73, 61, and 74% of the total cellular 23S rRNA in the A2032, U2032, and
C2032 mutants, respectively. There was no significant difference in the
ratio of wild-type to mutant 23S rRNA in the fractions of individual
subunits, 70S ribosomes, or polysomes (data not shown), showing that
the mutations at position G2032 did not interfere significantly with
the ribosome function. The linezolid resistance of transformants was
tested on agar plates (Fig. 3B) and in liquid cultures. Linezolid
resistance increased in the order G2032 (wild
type)
U2032C2032A2032. This result was consistent
with MICs determined in liquid cultures: 20 µM (for the wild type),
40 µM (for the U mutant), 60 µM (for the C mutant), and 80 µM
(for the A mutant). Since mutant rRNAs are expressed at comparable
levels in all the mutants, the observed difference in linezolid
resistance caused by A, U, or C substitutions at position G2032 is most
probably explained by differential effects of the mutations on drug
binding and/or action.
Effect of linezolid on peptidyl transferase reaction catalyzed by the large ribosomal subunit. Position G2032 is located in the immediate vicinity of the central loop of domain V of 23S rRNA. This region is known to constitute an essential component of the ribosomal peptidyl transferase center. Therefore, we examined the effect of linezolid on the activity of ribosomal peptidyl transferase. The peptidyl transferase assay was performed under "fragment reaction" conditions (in the presence of 33% methanol) (23), using formyl-methionyl-tRNA as a donor substrate and puromycin as an acceptor (34). Even at a very high concentration (1.25 mM), linezolid did not affect the reaction, suggesting that peptidyl transferase activity is not the primary target of this drug (data not shown).
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
In this paper we present evidence that mutations in E. coli 23S rRNA confer resistance to an oxazolidinone antibiotic, linezolid. Our findings provide new evidence that rRNA plays an important role in the binding and/or action of oxazolidinones, and they reinforce our previous conclusion that oxazolidinones interact with the large ribosomal subunit in the vicinity of its peptidyl transferase center.
All five Linr mutants isolated in two independent experiments contained the same G2032A mutation. Though this result suggests that G2032A is the "best" Linr mutation, it does not exclude a possibility that other mutations can also confer linezolid resistance; indeed, two other substitutions engineered at position 2032, as well as the G2447U mutation, rendered cells resistant to low concentrations of the drug. All of the previously characterized Linr mutations found in the rRNA genes of S. aureus, Enterococcus faecalis, and H. halobium were localized within or in close proximity to the central loop of domain V of 23S rRNA, indicating that this rRNA region is important for drug binding (19; Swaney et al. 38th ICAAC). Cross-linking of G2032 to A2054 and C2055 (10) shows that in the ribosome tertiary structure the 2032 loop is in an immediate proximity to the central loop. Thus, the RNA structure encompassing this hairpin, the central loop of domain V, and several adjacent RNA elements emerge as the primary binding site of oxazolidinone antibiotics. Although we cannot completely exclude the possibility that mutations in the central region of domain V induce an allosteric conformation change that affects drug binding to a distant rRNA site, this scenario seems unlikely, given a broad spectrum of known Linr mutations clustered in or near the central loop of domain V (see Fig. 1B). In addition, oxazolidinones can compete for binding to the ribosome with chloramphenicol and lincomycin, which are known to interact with the central loop of domain V (20). The mutations at position 2032, which were shown in this paper to confer linezolid resistance, render ribosomes resistant to lincosamides and chloramphenicol as well (6, 11). Thus, our mutational data provide a structural basis for the previous suggestion that the binding sites of chloramphenicol and lincomycin overlap with the binding site of linezolid (20).
Analysis of oxazolidinone resistance mutations in E. coli (this paper) and other organisms (19; Swaney et al., 38th ICAAC) clearly points to the central loop of domain V and several adjacent hairpins as the primary binding site of interaction of oxazolidinones with the ribosome. This conclusion, however, seems to contradict the results of in vitro experiments in which oxazolidinones were footprinted and cross-linked to the E. coli 23S rRNA segment 2110 to 2155 (21), since in the ribosome tertiary structure, the 2110-to-2155 region appears to be too far from the central region of domain V to allow simultaneous interaction of an oxazolidinone molecule with these two rRNA regions (2, 24). The incongruity between the mutational and cross-linking data may potentially be explained by structural differences between linezolid and the compounds used by Matassova et al. (the latter lacked the fluorine atom, while the morpholine moiety was replaced by pyridyl or azido-benzyl groups). Alternatively, the discrepancy between genetic and biochemical data may result from the intrinsic difference between the in vivo and in vitro approaches. This consideration is aggravated by the fact that oxazolidinones are notorious for their high nonspecific binding to the ribosome in vitro (20). Indeed, we found that under artificial in vitro conditions, an azido derivative of linezolid cross-links nonspecifically to rRNA and ribosomal proteins, while performance of cross-linking under more natural conditions limits drug cross-linking exclusively to the central loop of domain V (unpublished data). Therefore, we favor the view that the primary site of oxazolidinone action is located in the vicinity of the central loop of domain V of 23S rRNA.
The central region of domain V of 23S rRNA represents one of the most conserved rRNA segments (13). Therefore, it is not surprising that the oxazolidinone-binding site is apparently conserved between the evolutionarily distant domains of Archaea and Bacteria. This is illustrated by the clustering of oxazolidinone resistance mutations in the vicinity of the central loop of domain V both in bacteria (S. aureus, E. faecalis, E. coli) and in an archaeon (H. halobium) (19; Swaney et al., 38th ICAAC). Nevertheless, the spectrum of resistance mutations is clearly organism specific. One conceivable reason for this specificity is that nucleotide changes that are permissible in one organism may be deleterious in others. It is also possible, however, that the precise orientation of the drug on the ribosomes of different species may vary to some extent.
The mode of action of oxazolidinones remains largely unknown. The central loop of domain V and the neighboring rRNA segments constitute an integral part of the ribosomal peptidyl transferase center. A number of drugs which interact with the central region of 23S rRNA inhibit catalysis of peptide bond formation (7). Among them are chloramphenicol and lincomycin, whose binding sites overlap with that of oxazolidinones (20). In spite of that, neither linezolid nor several of the other tested oxazolidinone derivatives inhibited the peptidyl transferase activity of the E. coli ribosome. Similarly, no inhibition of peptidyl transferase activity by oxazolidinones was observed in several other systems (15, 19, 30). Therefore, activity of the tested oxazolidinones appears to be targeted against a ribosomal function other than catalysis of peptide bond formation but probably indirectly related to the activity of ribosomal peptidyl transferase.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by research grants from the National Institutes of Health (GM53762) and Pharmacia Corporation to A.S.M. and by grants from the Danish Natural Sciences Research Council and Danish Medical Research Council to S.D.
We thank H. Nikaido for making strain HN818 available to us.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Center for Pharmaceutical Biotechnology-m/c 870, University of Illinois, 900 S. Ashland Ave., Chicago, IL 60607-7173. Phone: (312) 413-1406. Fax: (312) 413-9303. E-mail: shura{at}uic.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Aagaard, C., G. Rosendahl, M. Dam, T. Powers, and S. Douthwaite. 1991. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli. Biochimie 73:1439-1444[Medline]. |
| 2. | Ban, N., P. Nissen, J. Hansen, M. Capel, P. B. Moore, and T. A. Steitz. 1999. Placement of protein and RNA structures into a 5 Å-resolution map of the 50S ribosomal subunit. Nature 400:841-847[CrossRef][Medline]. |
| 3. | Brickner, S. J., D. K. Hutchinson, M. R. Barbachyn, P. R. Manninen, D. A. Ulanowicz, S. A. Garmon, K. C. Grega, S. K. Hendges, D. S. Toops, C. W. Ford, and G. E. Zurenko. 1996. Synthesis and antibacterial activity of U-100592 and U-100766, two oxazolidinone antibacterial agents for the potential treatment of multidrug-resistant gram-positive bacterial infections. J. Med. Chem. 39:673-679[CrossRef][Medline]. |
| 4. | Brosius, J., T. J. Dull, D. D. Sleeter, and H. F. Noller. 1981. Gene organization and primary structure of a ribosomal RNA operon from Escherichia coli. J. Mol. Biol. 148:107-127[CrossRef][Medline]. |
| 5. | Burghardt, H., K. L. Schimz, and M. Müller. 1998. On the target of a novel class of antibiotics, oxazolidinones, active against multidrug-resistant Gram-positive bacteria. FEBS Lett. 425:40-44[CrossRef][Medline]. |
| 6. | Cseplö, A., T. Etzold, J. Schell, and P. H. Schreier. 1988. Point mutations in the 23S rRNA genes of four lincomycin resistant Nicotiana plumbaginifolia mutants could provide new selectable markers for chloroplast transformation. Mol. Gen. Genet. 214:295-299[CrossRef][Medline]. |
| 7. | Cundliffe, E. 1981. Antibiotic inhibitors of ribosome function, p. 402-545. In E. F. Gale, E. Cundliffe, P. E. Reynolds, M. H. Richmond, and M. J. Waring (ed.), The molecular basis of antibiotic action. John Wiley & Sons, London, United Kingdom. |
| 8. | Cundliffe, E. 1990. Recognition sites for antibiotics within rRNA, p. 479-490. In W. E. Hill, A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger, and J. R. Warner (ed.), The ribosome: structure, function, and evolution. American Society for Microbiology, Washington, D.C. |
| 9. |
Daly, J. S.,
G. M. Eliopoulos,
E. Reiszner, and R. C. Moellering, Jr.
1988.
Activity and mechanism of action of DuP 105 and DuP 721, new oxazolidinone compounds.
J. Antimicrob. Chemother.
21:721-730 |
| 10. |
Doring, T.,
B. Greuer, and R. Brimacombe.
1991.
The three-dimensional folding of ribosomal RNA; localization of a series of intra-RNA cross-links in 23S RNA induced by treatment of Escherichia coli 50S ribosomal subunits with bis-(2-chloroethyl)-methylamine.
Nucleic Acids Res.
19:3517-3524 |
| 11. |
Douthwaite, S.
1992.
Functional interactions within 23S rRNA involving the peptidyl transferase center.
J. Bacteriol.
174:1333-1338 |
| 12. | Douthwaite, S., T. Powers, J. Y. Lee, and H. F. Noller. 1989. Defining the structural requirements for a helix in 23S ribosomal RNA that confers erythromycin resistance. J. Mol. Biol. 209:655-665[Medline]. |
| 13. | Egebjerg, J., N. Larsen, and R. A. Garrett. 1990. Structural map of 23S rRNA, p. 168-179. In W. E. Hill, A. Dahlberg, R. A. Garrett, P. B. Moore, D. Schlessinger, and J. R. Warner (ed.), The ribosome: structure, function, and evolution. American Society for Microbiology, Washington, D.C. |
| 14. | Eustice, D. C., P. A. Feldman, and A. M. Slee. 1988. The mechanism of action of DuP 721, a new antibacterial agent: effects on macromolecular synthesis. Biochem. Biophys. Res. Commun. 150:965-971[CrossRef][Medline]. |
| 15. |
Eustice, D. C.,
P. A. Feldman,
I. Zajac, and A. M. Slee.
1988.
Mechanism of action of DuP 721: inhibition of an early event during initiation of protein synthesis.
Antimicrob. Agents Chemother.
32:1218-1222 |
| 16. | Ford, C. W., J. C. Hamel, D. M. Wilson, J. K. Moerman, D. Stapert, R. J. Yancey, Jr., D. K. Hutchinson, M. R. Barbachyn, and S. J. Brickner. 1996. In vivo activities of U-100592 and U-100766, novel oxazolidinone antimicrobial agents, against experimental bacterial infections. Antimicrob. Agents Chemother. 40:1508-1513[Abstract]. |
| 17. |
Gutell, R. R.,
N. Larsen, and C. R. Woese.
1994.
Lessons from an evolving rRNA: 16S and 23S rRNA structures from a comparative perspective.
Microbiol. Rev.
58:10-26 |
| 18. | Jones, R. N., and M. S. Barrett. 1995. Antimicrobial activity of SCH 27899, oligosaccharide member of the everninomicin class with a wide gram-positive spectrum. J. Clin. Microb. Infect. 1:35-43. |
| 19. | Kloss, P., L. Xiong, D. L. Shinabarger, and A. S. Mankin. 1999. Resistance mutations in 23S rRNA identify the site of action of the protein synthesis inhibitor linezolid in the ribosomal peptidyl transferase center. J. Mol. Biol. 294:93-101[CrossRef][Medline]. |
| 20. | Lin, A. H., R. W. Murray, T. J. Vidmar, and K. R. Marotti. 1997. The oxazolidinone eperezolid binds to the 50S ribosomal subunit and competes with binding of chloramphenicol and lincomycin. Antimicrob. Agents Chemother. 41:2127-2131[Abstract]. |
| 21. | Matassova, N. B., M. V. Rodnina, R. Endermann, H. P. Kroll, U. Pleiss, H. Wild, and W. Wintermeyer. 1999. Ribosomal RNA is the target for oxazolidinones, a novel class of translational inhibitors. RNA 5:939-946[Abstract]. |
| 22. |
Moazed, D., and H. F. Noller.
1991.
Sites of interaction of the CCA end of peptidyl-tRNA with 23S rRNA.
Proc. Natl. Acad. Sci. USA
88:3725-3728 |
| 23. | Monro, R. E., and K. A. Marcker. 1967. Ribosome-catalysed reaction of puromycin with a formylmethionine-containing oligonucleotide. J. Mol. Biol. 25:347-350[CrossRef][Medline]. |
| 24. | Mueller, F., I. Sommer, P. Baranov, R. Matadeen, M. Stoldt, J. Wohnert, M. Gorlach, M. Van Heel, and R. Brimacombe. 2000. The 3D arrangement of the 23S and 5S rRNA in the Escherichia coli 50S ribosomal subunit based on a cryo-electron microscopic reconstruction at 7.5 Å resolution. J. Mol. Biol. 298:35-59[CrossRef][Medline]. |
| 25. |
Noller, H. F.,
J. Kop,
V. Wheaton,
J. Brosius,
R. R. Gutell,
A. M. Kopylov,
F. Dohme,
W. Herr,
D. A. Stahl,
R. Gupta, and C. R. Woese.
1981.
Secondary structure model for 23S ribosomal RNA.
Nucleic Acids Res.
9:6167-6189 |
| 26. | Nomura, M., and L. E. Post. 1980. Organization of ribosomal genes and regulation of their expression in Escherichia coli, p. 671-691. In G. Chambliss, G. R. Craven, J. Davies, K. Davis, L. Kahan, and M. Nomura (ed.), Ribosomes: structure, function, and genetics. University Park Press, Baltimore, Md. |
| 27. |
Powers, T., and H. F. Noller.
1990.
Dominant lethal mutations in a conserved loop in 16S rRNA.
Proc. Natl. Acad. Sci. USA
87:1042-1046 |
| 28. | Rosendahl, G., L. H. Hansen, and S. Douthwaite. 1995. Pseudoknot in domain II of 23S rRNA is essential for ribosome function. J. Mol. Biol. 249:59-68[CrossRef][Medline]. |
| 29. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. | Shinabarger, D. L., K. R. Marotti, R. W. Murray, A. H. Lin, E. P. Melchior, S. M. Swaney, D. S. Dunyak, W. F. Demyan, and J. M. Buysse. 1997. Mechanism of action of oxazolidinones: effects of linezolid and eperezolid on translation reactions. Antimicrob. Agents Chemother. 41:2132-2136[Abstract]. |
| 31. | Sigmund, C. D., M. Ettayebi, A. Borden, and E. A. Morgan. 1988. Antibiotic resistance mutations in ribosomal RNA genes of Escherichia coli. Methods Enzymol. 164:673-690[Medline]. |
| 32. |
Slee, A. M.,
M. A. Wuonola,
R. J. McRipley,
I. Zajac,
M. J. Zawada,
P. T. Bartholomew,
W. A. Gregory, and M. Forbes.
1987.
Oxazolidinones, a new class of synthetic antibacterial agents: in vitro and in vivo activities of DuP 105 and DuP 721.
Antimicrob. Agents Chemother.
31:1791-1797 |
| 33. |
Swaney, S. M.,
H. Aoki,
M. C. Ganoza, and D. L. Shinabarger.
1998.
The oxazolidinone linezolid inhibits initiation of protein synthesis in bacteria.
Antimicrob. Agents Chemother.
42:3251-3255 |
| 34. | Tan, G. T., A. DeBlasio, and A. S. Mankin. 1996. Mutations in the peptidyl transferase center of 23S rRNA reveal the site of action of sparsomycin, a universal inhibitor of translation. J. Mol. Biol. 261:222-230[CrossRef][Medline]. |
| 35. | Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[CrossRef][Medline]. |
| 36. | Zurenko, G. E., B. H. Yagi, R. D. Schaadt, J. W. Allison, J. O. Kilburn, S. E. Glickman, D. K. Hutchinson, M. R. Barbachyn, and S. J. Brickner. 1996. In vitro activities of U-100592 and U-100766, novel oxazolidinone antibacterial agents. Antimicrob. Agents Chemother. 40:839-845[Abstract]. |
Journal of Bacteriology, October 2000, p. 5325-5331, Vol. 182, No. 19
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Feng, J., Lupien, A., Gingras, H., Wasserscheid, J., Dewar, K., Legare, D., Ouellette, M.
(2009). Genome sequencing of linezolid-resistant Streptococcus pneumoniae mutants reveals novel mechanisms of resistance. Genome Res
19: 1214-1223
[Abstract] [Full Text] -
Davidovich, C., Bashan, A., Yonath, A.
(2008). Structural basis for cross-resistance to ribosomal PTC antibiotics. Proc. Natl. Acad. Sci. USA
105: 20665-20670
[Abstract] [Full Text] -
Skripkin, E., McConnell, T. S., DeVito, J., Lawrence, L., Ippolito, J. A., Duffy, E. M., Sutcliffe, J., Franceschi, F.
(2008). R{chi}-01, a New Family of Oxazolidinones That Overcome Ribosome-Based Linezolid Resistance. Antimicrob. Agents Chemother.
52: 3550-3557
[Abstract] [Full Text] -
Wilson, D. N., Schluenzen, F., Harms, J. M., Starosta, A. L., Connell, S. R., Fucini, P.
(2008). The oxazolidinone antibiotics perturb the ribosomal peptidyl-transferase center and effect tRNA positioning. Proc. Natl. Acad. Sci. USA
105: 13339-13344
[Abstract] [Full Text] -
Kelly, S., Collins, J., Maguire, M., Gowing, C., Flanagan, M., Donnelly, M., Murphy, P. G.
(2008). An outbreak of colonization with linezolid-resistant Staphylococcus epidermidis in an intensive therapy unit. J Antimicrob Chemother
61: 901-907
[Abstract] [Full Text] -
Hillemann, D., Rusch-Gerdes, S., Richter, E.
(2008). In Vitro-Selected Linezolid-Resistant Mycobacterium tuberculosis Mutants. Antimicrob. Agents Chemother.
52: 800-801
[Full Text] -
Toh, S.-M., Xiong, L., Bae, T., Mankin, A. S.
(2008). The methyltransferase YfgB/RlmN is responsible for modification of adenosine 2503 in 23S rRNA. RNA
14: 98-106
[Abstract] [Full Text] -
Hong, T., Li, X., Wang, J., Sloan, C., Cicogna, C.
(2007). Sequential Linezolid-Resistant Staphylococcus epidermidis Isolates with G2576T Mutation. J. Clin. Microbiol.
45: 3277-3280
[Abstract] [Full Text] -
Richter, E., Rusch-Gerdes, S., Hillemann, D.
(2007). First Linezolid-Resistant Clinical Isolates of Mycobacterium tuberculosis. Antimicrob. Agents Chemother.
51: 1534-1536
[Abstract] [Full Text] -
Bogdanovich, T., Ednie, L. M., Shapiro, S., Appelbaum, P. C.
(2005). Antistaphylococcal Activity of Ceftobiprole, a New Broad-Spectrum Cephalosporin. Antimicrob. Agents Chemother.
49: 4210-4219
[Abstract] [Full Text] -
Carsenti-Dellamonica, H., Galimand, M., Vandenbos, F., Pradier, C., Roger, P. M., Dunais, B., Sabah, M., Mancini, G., Dellamonica, P.
(2005). In vitro selection of mutants of Streptococcus pneumoniae resistant to macrolides and linezolid: relationship with susceptibility to penicillin G or macrolides. J Antimicrob Chemother
56: 633-642
[Abstract] [Full Text] -
Nagiec, E. E., Wu, L., Swaney, S. M., Chosay, J. G., Ross, D. E., Brieland, J. K., Leach, K. L.
(2005). Oxazolidinones Inhibit Cellular Proliferation via Inhibition of Mitochondrial Protein Synthesis. Antimicrob. Agents Chemother.
49: 3896-3902
[Abstract] [Full Text] -
Wolter, N., Smith, A. M., Farrell, D. J., Schaffner, W., Moore, M., Whitney, C. G., Jorgensen, J. H., Klugman, K. P.
(2005). Novel Mechanism of Resistance to Oxazolidinones, Macrolides, and Chloramphenicol in Ribosomal Protein L4 of the Pneumococcus. Antimicrob. Agents Chemother.
49: 3554-3557
[Abstract] [Full Text] -
Gregory, S. T., Carr, J. F., Rodriguez-Correa, D., Dahlberg, A. E.
(2005). Mutational Analysis of 16S and 23S rRNA Genes of Thermus thermophilus. J. Bacteriol.
187: 4804-4812
[Abstract] [Full Text] -
Thompson, J., Pratt, C. A., Dahlberg, A. E.
(2004). Effects of a Number of Classes of 50S Inhibitors on Stop Codon Readthrough during Protein Synthesis. Antimicrob. Agents Chemother.
48: 4889-4891
[Abstract] [Full Text] -
LIU, M., NOVOTNY, G. W., DOUTHWAITE, S.
(2004). Methylation of 23S rRNA nucleotide G745 is a secondary function of the RlmAI methyltransferase. RNA
10: 1713-1720
[Abstract] [Full Text] -
Werner, G., Strommenger, B., Klare, I., Witte, W.
(2004). Molecular Detection of Linezolid Resistance in Enterococcus faecium and Enterococcus faecalis by Use of 5' Nuclease Real-Time PCR Compared to a Modified Classical Approach. J. Clin. Microbiol.
42: 5327-5331
[Abstract] [Full Text] -
Novotny, G. W., Jakobsen, L., Andersen, N. M., Poehlsgaard, J., Douthwaite, S.
(2004). Ketolide Antimicrobial Activity Persists after Disruption of Interactions with Domain II of 23S rRNA. Antimicrob. Agents Chemother.
48: 3677-3683
[Abstract] [Full Text] -
Meka, V. G., Gold, H. S., Cooke, A., Venkataraman, L., Eliopoulos, G. M., Moellering, R. C. Jr, Jenkins, S. G.
(2004). Reversion to susceptibility in a linezolid-resistant clinical isolate of Staphylococcus aureus. J Antimicrob Chemother
54: 818-820
[Abstract] [Full Text] -
Murakami, A., Nakatogawa, H., Ito, K.
(2004). Translation arrest of SecM is essential for the basal and regulated expression of SecA. Proc. Natl. Acad. Sci. USA
101: 12330-12335
[Abstract] [Full Text] -
Limburg, E., Gahlmann, R., Kroll, H.-P., Beyer, D.
(2004). Ribosomal Alterations Contribute to Bacterial Resistance against the Dipeptide Antibiotic TAN 1057. Antimicrob. Agents Chemother.
48: 619-622
[Abstract] [Full Text] -
Howe, R. A., Wootton, M., Noel, A. R., Bowker, K. E., Walsh, T. R., MacGowan, A. P.
(2003). Activity of AZD2563, a Novel Oxazolidinone, against Staphylococcus aureus Strains with Reduced Susceptibility to Vancomycin or Linezolid. Antimicrob. Agents Chemother.
47: 3651-3652
[Abstract] [Full Text] -
Lobritz, M., Hutton-Thomas, R., Marshall, S., Rice, L. B.
(2003). Recombination Proficiency Influences Frequency and Locus of Mutational Resistance to Linezolid in Enterococcus faecalis. Antimicrob. Agents Chemother.
47: 3318-3320
[Abstract] [Full Text] -
Berisio, R., Harms, J., Schluenzen, F., Zarivach, R., Hansen, H. A. S., Fucini, P., Yonath, A.
(2003). Structural Insight into the Antibiotic Action of Telithromycin against Resistant Mutants. J. Bacteriol.
185: 4276-4279
[Abstract] [Full Text] -
Colca, J. R., McDonald, W. G., Waldon, D. J., Thomasco, L. M., Gadwood, R. C., Lund, E. T., Cavey, G. S., Mathews, W. R., Adams, L. D., Cecil, E. T., Pearson, J. D., Bock, J. H., Mott, J. E., Shinabarger, D. L., Xiong, L., Mankin, A. S.
(2003). Cross-linking in the Living Cell Locates the Site of Action of Oxazolidinone Antibiotics. J. Biol. Chem.
278: 21972-21979
[Abstract] [Full Text] -
Bobkova, E. V., Yan, Y. P., Jordan, D. B., Kurilla, M. G., Pompliano, D. L.
(2003). Catalytic Properties of Mutant 23 S Ribosomes Resistant to Oxazolidinones. J. Biol. Chem.
278: 9802-9807
[Abstract] [Full Text] -
Moellering, R. C. Jr.
(2003). Linezolid: The First Oxazolidinone Antimicrobial. ANN INTERN MED
138: 135-142
[Abstract] [Full Text] -
O'Neill, A. J., Bostock, J. M., Morais Moita, A., Chopra, I.
(2002). Antimicrobial activity and mechanisms of resistance to cephalosporin P1, an antibiotic related to fusidic acid. J Antimicrob Chemother
50: 839-848
[Abstract] [Full Text] -
Lovering, A. M., Zhang, J., Bannister, G. C., Lankester, B. J. A., Brown, J. H. M., Narendra, G., MacGowan, A. P.
(2002). Penetration of linezolid into bone, fat, muscle and haematoma of patients undergoing routine hip replacement. J Antimicrob Chemother
50: 73-77
[Abstract] [Full Text] -
Karlowsky, J. A., Kelly, L. J., Critchley, I. A., Jones, M. E., Thornsberry, C., Sahm, D. F.
(2002). Determining Linezolid's Baseline In Vitro Activity in Canada Using Gram-Positive Clinical Isolates Collected prior to Its National Release. Antimicrob. Agents Chemother.
46: 1989-1992
[Abstract] [Full Text] -
Aoki, H., Ke, L., Poppe, S. M., Poel, T. J., Weaver, E. A., Gadwood, R. C., Thomas, R. C., Shinabarger, D. L., Ganoza, M. C.
(2002). Oxazolidinone Antibiotics Target the P Site on Escherichiacoli Ribosomes. Antimicrob. Agents Chemother.
46: 1080-1085
[Abstract] [Full Text] -
Zhou, C. C., Swaney, S. M., Shinabarger, D. L., Stockman, B. J.
(2002). 1H Nuclear Magnetic Resonance Study of Oxazolidinone Binding to Bacterial Ribosomes. Antimicrob. Agents Chemother.
46: 625-629
[Abstract] [Full Text] -
Garza-Ramos, G., Xiong, L., Zhong, P., Mankin, A.
(2001). Binding Site of Macrolide Antibiotics on the Ribosome: New Resistance Mutation Identifies a Specific Interaction of Ketolides with rRNA. J. Bacteriol.
183: 6898-6907
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»