INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

During the 1960s and 1970s, researchers isolated a number of temperature-sensitive Escherichia coli and Bacillus subtilis mutants that formed filaments at the nonpermissive temperature. In this way, several cell division genes were identified and given the designation fts for filamenting temperature sensitive (6). Some B. subtilis genes were also isolated on the grounds of similarity to E. coli cell division genes or by their chromosomal position (2, 9, 14).

In B. subtilis, at least six gene products, FtsZ, FtsA, FtsL, DivIC, DivIB, and PBP 2B, are required for septation, which involves the invagination of the cytoplasmic membrane accompanied by septum-specific peptidoglycan synthesis (3, 4, 5, 8, 9, 23). During vegetative growth, these proteins catalyze the formation of a central septum, which gives rise to two equal-sized daughter cells. In the process of spore formation, asymmetric cell division produces a prespore and a larger mother cell compartment.

Early in the cell cycle, the tubulin-like FtsZ is assembled into a ring structure at the future division site (36). FtsZ recruits other components of the division machinery to mid-cell and is probably directly involved in septal constriction (26). FtsA, which has homology to the ATPase domain found in actin, DnaK, and hexokinases (33), is known to directly interact with FtsZ, but its precise role in septation is still unclear (39). In addition to these two cytoplasmic proteins, there are four bitopic division proteins with their major domains located outside the cytoplasmic membrane, FtsL, DivIC, DivIB, and PBP 2B. PBP 2B belongs to the family of high-molecular-weight penicillin-binding proteins which catalyze the late stages of peptidoglycan biosynthesis. It assembles late at the future division site and is required for the formation of septal peptidoglycan (8, 10). Localization studies of the smaller transmembrane proteins FtsL, DivIC, and DivIB have shown that they are also part of the septator (7, 16, 20, 35). While FtsL and DivIC are essential for division, cells can divide in the absence of DivIB at low temperatures (30°C). Thus, DivIB may be involved in stabilizing or promoting the formation of the division complex at higher temperatures (15). Recently, Katis and Wake (21) have shown that only the external C termini of DivIC and DivIB are essential, indicating that these proteins may have a role in septal peptidoglycan synthesis. This group of proteins could therefore form a direct or indirect link between cytokinesis mediated by the Z ring and peptidoglycan synthesis carried out outside the cytoplasmic membrane. Accordingly, these genes appear to be collectively absent from the genomes of bacteria that lack peptidoglycan (e.g., Mycoplasma genitalium and Methanococcus jannaschii), consistent with the idea that they have a role in septal peptidoglycan synthesis or its regulation.

FtsL is a small protein (117 amino acids) with a potential membrane-spanning domain near the N terminus and an external C terminus, which resembles an -helical leucine zipper. Although FtsL homologues from other organisms have similar structural features, the sequence conservation is relatively weak. Thus, B. subtilis ftsL (yllD) was identified as the homologue of E. coli ftsL (16% identical residues) (9) because of its position upstream of pbpB, homologous to E. coli ftsI. We have shown recently that FtsL interacts with the FtsL-like DivIC protein (35). This probably stabilizes DivIC, which is rapidly degraded when FtsL is depleted (9). In this study, we used a combination of random mutagenesis, site-directed mutagenesis, and substitutions with heterologous genes to probe the sequence of FtsL for amino acid residues that are important for its function.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Strains, phages, and plasmids. The strains, phages, and plasmids used in this work are listed in Table 1. All Bacillus strains were isogenic with strain 168. 

General methods. B. subtilis strains were transformed by the method described by Anagnostopoulos and Spizizen (1), as modified by Jenkinson (18), or by the method described by Kunst and Rapoport (22), except that 20 min after addition of DNA the transformed cultures were supplemented with 0.66% Casamino Acids solution. Transformants were selected on Oxoid nutrient agar containing, as necessary, kanamycin (5 µg ml¹), spectinomycin (50 µg ml¹), or chloramphenicol (5 µg ml¹).

Construction of a strain containing two inducible ftsL genes. The xylose-dependent strain 2001 is lysogenic for the recombinant bacteriophage 105J506, which contains a copy of ftsL under the control of the xylose-inducible P_xyl promoter. The natural copy of ftsL has been disrupted by a neo resistance cassette, which provides sufficient transcription for the essential pbpB gene downstream. A second copy of ftsL under the control of the IPTG (isopropyl--D-thiogalactopyranoside)-inducible P_spac promoter was inserted into the amyE locus of strain 2001, giving strain 2003. Full details of the complicated constructions of strains and plasmids are available on request. Strain 2003 grew normally in the presence of IPTG or xylose but failed to divide and formed elongated filaments in unsupplemented medium.

ftsL expression experiments. The effects of the expression of different ftsL alleles were studied in strain 2007 and its derivatives. The strains were grown on plates containing xylose (0.5%), IPTG (1 mM), or no inducer. To examine vegetatively growing cells, an overnight culture grown in Difco antibiotic medium 3 (PAB) containing 1 mM IPTG was diluted 50-fold and incubated at 37°C until it reached an optical density at 600 nm (OD₆₀₀) of 0.8. The cells were centrifuged for 1 min, washed once with prewarmed, unsupplemented PAB, and then resuspended in this medium. The culture was split into two or three aliquots and supplemented with xylose (0.5%), IPTG (1 mM), and no inducer, respectively. These aliquots were incubated for another 1.5 h at 37°C (or at 30 or 45°C to test for temperature dependence) and then fixed with ethanol for microscopic analysis (see below).

Light microscopy. Cell morphology was analyzed by phase-contrast light microscopy after fixation with ethanol as described previously (17). The images obtained were processed with IPlab Spectrum 3.1a software (Signal Analyticals, Vienna, Va.), and final images were assembled with Adobe Photoshop version 3.0.5.

Hydroxylamine mutagenesis of ftsL and isolation of mutants. 105J506 phage DNA was mutagenized in a 100 mM potassium phosphate buffer (pH 4.0) containing 1 mM EDTA. A 1 M hydroxylamine solution (pH 6.0) was added to a final concentration of 0.4 M. Samples were incubated for 1 h at 75°C and then diluted 10-fold with water to stop the reaction. The DNA was recovered by ethanol precipitation. The mutagenesis was repeated once as described above. The phage DNA was transformed into strain 2007 with selection for chloramphenicol in the presence of IPTG (1 mM). Transformants were then transferred to plates containing 0.5% xylose but no IPTG. To sequence mutations in ftsL, primers xyl(promoter)-f (5'-GGGCAACAAACTAATGTGCAAC-3') and 3860 (5'-TTTTGGATCCTTTGAATCATTCCTGTATG-3') were used to amplify P_xyl-ftsL by PCR. Following purification of the PCR product, using a QIAquick PCR purification kit (Qiagen), the same primers were used for sequencing.

DNA sequence analysis. Plasmids and PCR products were sequenced on both strands using the ABI PRISM BigDye terminator cycle sequencing kit (Perkin-Elmer). Custom-synthesized oligonucleotides were used as primers, and gels were run on an ABI PRISM 377 DNA sequencer.

Site-directed mutagenesis of ftsL and isolation of mutants. Most of the ftsL mutations were generated by PCR-based mutagenesis using Pfu DNA polymerase (Stratagene), as recommended by the manufacturer. Each 100-µl PCR mixture in 1× Pfu buffer consisted of 35 ng of pRD99 DNA as the template, primers (one primer carrying the desired base changes; primer sequences are available on request) at a final concentration of 0.5 µM, deoxynucleotide triphosphates (dNTPs; final concentration of 200 µM for each dNTP) and 5 U of Pfu DNA polymerase. Each reaction cycle, repeated 25 times, included the following: 96°C for 45 s, 50°C for 45 s, and 72°C for 11 min. The PCR product was separated on an 0.8% agarose gel and purified using the QIAquick gel extraction kit (Qiagen). The purified PCR product was treated with T4 polynucleotide kinase and ligated in a simultaneous reaction (30 µl) carried out in 1× ligation buffer (Roche Molecular), containing ATP (3.3 mM), 1 U of T4 DNA ligase, and 1 U of T4 polynucleotide kinase. This mixture was incubated for 24 h at room temperature, and 15 µl of this reaction mixture was transformed into E. coli DH5.

Isolation of ftsL genes from Bacillus licheniformis, Bacillus badius, and Bacillus circulans. Two peptide sequences in YllC and in PBP 2B and PBP 2X, respectively, conserved in B. subtilis and Streptococcus pneumoniae, were chosen for use in the design of degenerate primers. The peptide TFHSLED (residues 241 to 247 in B. subtilis YllC) was used to design the forward primer pool yllC.degen.fw [5'-GGAATTC AC(A/C/G/T) TT(C/T) CA(C/T) TC(A/C/G/T) CT(A/C/G/T) GA(A/G) G-3']. The reverse primer pool pbpB.degen.rv2 [5'-(C/T)TT CAT IGT I(C/G)(A/T) ICC IGG (C/T)TC-3'] is based on EPGSTMK (residues 309 to 315 in B. subtilis PBP 2B), which includes the common motif of PBPs, SXXK. The 3' primer also contained deoxyinosine (I) to reduce the degeneracy. The ftsL gene was amplified by PCR from strains B. licheniformis 6346, B. badius S33, and B. circulans DSMII using the degenerate primer pools and Taq DNA polymerase. The corresponding gene products of 1.5 kb were directly sequenced and (nondegenerate) primers were constructed to allow gene amplification using the more accurate Pfu DNA polymerase (Stratagene). B. licheniformis ftsL was amplified using primers Bl.fw1 (5'-CCTCACGGACTGCCCGTGATCCCC-3') and Bl.rv1 (5'-TTTCCCGTCGCTTGAATAAACGC-3'). Primers for B. badius ftsL were Bb.fw1 (5'-CCTCCGGGGCTGCCGGTCATTCC-3') and Bb.rv1 (5'-CCAGTTATTTGTATCATCAAAAAACGG-3'), and primers for B. circulans ftsL were Bc.fw1 (5'-CCGCCAGGGCTACCATTTATTCC-3') and Bc.rv1 (5'-CCTGTCGCCTGAATATAGACAACCCG-3'). To reduce any sequencing errors resulting from PCR amplification artefacts, at least three independent PCR products were sequenced.

Complementation studies. ftsL genes were PCR-amplified from chromosomal DNA of the appropriate strains using the following primers: ftsLSa.fw (5'-TGCTCTAGAAAGGAGGTCATCAGCCTATGGCTGTAGAAAAAGTGTACCAACC-3') and ftsLSa.rv (5'-TTTAAGCTTAATTTTTTGCTTCGCCATTAC-3') for S. aureus ftsL, ftsLBl.fw (5'-GGAAAAAGCTCTAGAGTGAGCTGTACG-3') and ftsLBl.rv (5'-TTTAAGCTTTTTGCATCATTCCTGTATGTC-3') for B. licheniformis ftsL, ftsLBb.fw (5'-AATCTAGAAAAGGAGGTCATCAGCCTATGAGCAATCTAGCCAGAAAACAAC-3') and ftsLBb.rv (5'-CATAAGCTTTTCATTCATTGCGGCTGC-3') for B. badius ftsL, and ftsLBc.fw (5'-AATC TAGAAAAGGAGGTCATCAGCCTATGAGCAACTTAGCAAGAAAAAT GC-3') and ftsLBc.rv (5'-CGGATCAAAGCTTAATGCACAACC-3') for B. circulans ftsL, introducing XbaI and HindIII sites, in order respective to the listed primers for each gene. The DNA regions upstream of Staphylococcus aureus ftsL, B. badius ftsL, and B. circulans ftsL were replaced by the sequence upstream of B. subtilis ftsL, including its ribosome-binding site (RBS). The XbaI-HindIII fragments were inserted between these sites in pRD96. Plasmids and 105J125 phage DNA were digested with SstI and HindIII, ligated, and directly transformed into strain 2007 with selection for chloramphenicol resistance in the presence of IPTG. Transformants were patched out on plates containing IPTG or xylose. To make derivatives in which the P_spac-ftsL construct located in the amyE gene was eliminated, each strain was transformed with a plasmid containing a tet cassette flanked by segments from the amyE locus (J. Sievers, unpublished data), with selection for resistance to tetracycline.

Nucleotide sequence accession numbers. The EMBL accession numbers of the nucleotide sequences of B. licheniformis, B. badius, and B. circulans ftsL determined in this work are AJ271356, AJ271357, and AJ271358, respectively.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Construction of a strain with two inducible alleles of ftsL. We constructed a conditional B. subtilis mutant with two copies of ftsL, each under the control of a different inducible promoter. This allowed us to mutagenize one copy of ftsL, study the effects of mutations on division, and maintain strains by expression of the other (wild-type) allele. In strain 2007, one allele of ftsL under the control of the IPTG-inducible P_spac promoter was inserted at the amyE locus (Fig. 1A). The natural ftsL gene has been disrupted with a kanamycin resistance cassette (neo), which maintains transcription of the likewise essential pbpB gene downstream of ftsL (Fig. 1A). This strain formed elongated aseptate filaments when grown in the absence of IPTG, but growth was indistinguishable from that of strain 168 in IPTG-supplemented PAB as judged by phase-contrast microscopy (Fig. 1B and C). Strain 2007 was also lysogenized with the 105J125 phage. Hence, a second allele of ftsL under the control of the xylose-inducible P_xyl promoter, placed in the recombinant 105J506 phage (9), could be integrated into the chromosome of 2007 by a double-crossover event (indicated by dashed lines in Fig. 1A). We previously showed that the P_xyl promoter can be used to control ftsL expression and that division is normal in the presence of xylose and completely blocked in the absence of xylose (9).

View larger version (78K): [in this window] [in a new window]   FIG. 1.   Strain 2007 constructed for mutagenesis of ftsL. (A) Schematic representation of the genetic organization of strain 2007. The chromosomal pbpB operon contains four genes, yllB, yllC, ftsL, and pbpB. The chromosomal copy of ftsL is disrupted by a neo cassette, whose promoter also provides transcription of the downstream pbpB gene. An IPTG-inducible wild-type copy of ftsL is placed in the amyE locus. The 105J125 prophage, integrated elsewhere in the chromosome, allows transformation with 105J506 phage DNA and the insertion by a double-crossover event (dashed lines) of a second copy of ftsL (ftsL*) under the control of the xylose-inducible Pxyl promoter. (B and C) Phase-contrast images of 2007 grown in the presence of the inducer IPTG (B) and after ca. three generations in its absence (C). Bar, 5 µm.

Random mutagenesis of the ftsL gene. 105J506 phage DNA was mutagenized with hydroxylamine (HA) in vitro. As a hydroxyl donor, HA deaminates cytosine to uracil, or a stable intermediate in the deamination of cytosine, hydroxyaminocytosine, is formed. Both mechanisms give rise to C-G to T-A transition mutations (38). The mutagenized DNA was transformed into strain 2007 with selection for chloramphenicol resistance in the presence of IPTG (therefore maintaining expression only of the nonmutagenized copy of ftsL). Transformants were then streaked on plates containing xylose but no IPTG to screen for mutations affecting the ftsL allele under the control of the P_xyl promoter. Out of some 2,500 transformants in several separate experiments, 22 independently isolated mutants were obtained that showed impaired growth (cell filamentation) in the presence of xylose (Table 2). None of these mutations turned out to be dominant to the wild type, as tested by growth in the presence of both IPTG and xylose (not shown). DNA sequence analysis revealed that we had obtained 12 distinct point mutations in the ftsL gene, which fell into two clear classes. The major class comprised nonsense mutations. Given the effect of HA, nine possible stop codons could be generated by single base changes; in each case a glutamine codon, CAA or CAG, would become a stop codon, TAA or TAG, respectively. Substitutions of six of these codons, yielding Q7, Q11, Q12, Q72, Q79, and Q94 of the FtsL protein, were obtained. A nonsense mutation in a seventh codon, encoding Q116, which is only one residue from the C terminus, would have no phenotypic effect because an FtsL protein truncated of the last five residues is functional (see below; Table 2). Thus, only two potential stop codons were missed. An additional TAG mutation (ftsL4) resulted from an unusual transversion in TCG, which encodes S54. In only one of 117 residues did we obtain a missense mutation, L37F in the ftsL11 product, but this allele also carried a TAG mutation (Q11amber). Four of the seven nonsense mutations were isolated independently more than once.

The repeating leucine heptad motif in B. subtilis FtsL is dispensable. To probe more directly for mutations affecting FtsL function, we utilized site-directed mutagenesis to make defined missense mutations in ftsL. As for the random mutagenesis, the mutated ftsL alleles were placed in the 105J125 phage under the control of the P_xyl promoter and introduced into the chromosome of strain 2007.

View larger version (44K): [in this window] [in a new window]   FIG. 2.   Comparison of the FtsL proteins of B. subtilis (FtsLBs), B. licheniformis (FtsLBl), B. badius (FtsLBb), B. circulans (FtsLBc), and S. aureus (FtsLSa). The alignment was performed using the CLUSTAL W method, with residues identical to the B. subtilis sequence shown in gray boxes. The membrane-spanning domain and the a and d positions of the heptad repeat of the putative coiled-coil domain are shown above the alignment.

Cloning and sequencing of ftsL homologues from B. licheniformis, B. circulans, and B. badius. As an alternative means of identifying regions of FtsL important for its function, we attempted to isolate ftsL genes from other Bacillus species. We assumed that the genetic organization would be similar to the pbpB operons of B. subtilis and other bacteria (10, 31). Consequently, we designed degenerate primers that bound to sequences in yllC and pbpB, upstream and downstream of ftsL, respectively (see Materials and Methods). We succeeded in PCR amplifying and sequencing the ftsL genes of three species, B. licheniformis, B. circulans, and B. badius. As expected, translation of partial DNA sequences upstream and downstream of the ftsL genes revealed the presence of yllC and pbpB homologues, respectively (data not shown).

Complementation of a B. subtilis ftsL null mutation. According to the notion that the FtsL primary sequence is highly flexible, it was possible that the highly divergent genes from other Bacillus spp. might nevertheless be able to substitute functionally for FtsL in B. subtilis. To test this, we introduced the heterologous genes into the chromosome of a B. subtilis strain with a conditional native ftsL gene. All three of the new strains, 2045, 2046, and 2047, producing FtsL of B. licheniformis, B. badius, and B. circulans, respectively, were able to grow and divide in the absence of native ftsL expression (Fig. 3). All of the heterologous FtsL proteins also allowed these strains to grow at high temperature (45°C) and to sporulate at levels similar to the wild type (data not shown). It was possible that septation in the three new strains was dependent on residual expression of the native ftsL gene (in the absence of inducer). To exclude this possibility, the conditional B. subtilis ftsL gene was eliminated by replacing it with a tetracycline resistance casette. All three derivative strains still grew and divided normally, as judged by phase-contrast microscopy (data not shown). The absence of the repeating leucine heptad motif in FtsLBb confirms that this motif is not necessary for FtsL function in B. subtilis. The results also showed that many other residues can be replaced without loss of function, because, for example, FtsLBb and FtsLBc, with identities as low as 37% and 34%, respectively, could restore septation in a null mutant.

View larger version (91K): [in this window] [in a new window]   FIG. 3.   Complementation of a B. subtilis ftsL null mutation by ftsL alleles of S. aureus, B. licheniformis, B. circulans, and B. badius. Shown are phase-contrast images of strains 2044, 2045, 2046, and 2047 grown at 37°C in PAB supplemented with either IPTG (left panel) or xylose (central panel) or not supplemented with any inducer (right panel). IPTG induces the expression of the wild-type gene, whereas the foreign ftsL alleles are transcribed in the presence of xylose. As expected, all four strains were filamented in unsupplemented medium (i.e., when FtsL is depleted). Bar, 5 µm.

Consequences for FtsL structure and function. It has previously been suggested that the repeating leucine motifs in E. coli FtsL (13) and B. subtilis DivIC (23) might constitute key residues in a protein dimerization domain. Such motifs, leucine zippers, have been described for many eukaryotic and also prokaryotic transcription factors (27, 34). Pairs of leucine zippers cooperate to form a DNA-binding domain through a helical coiled-coil structure (29). Accordingly, both E. coli FtsL (12) and FtsL and DivIC of B. subtilis (35) have subsequently been shown to undergo protein-protein interactions. However, our data show convincingly that the leucine residues themselves are not essential for FtsL function in B. subtilis. Several were removed from the B. subtilis protein by mutagenesis without a detectable phenotype, and the B. badius homologue is functional even though it retains only one of the leucines. However, it seems likely that FtsL does have an -helical structure and that hydrophobic residues, although not necessarily leucines, are needed at appropriate positions in the structure, presumably to participate in hydrophobic interactions at the protein-protein interface. Certainly, introduction of a helix-breaking proline residue in place of one of the leucines abolished FtsL function.