Previous Article | Next Article 
Journal of Bacteriology, October 2000, p. 5615-5619, Vol. 182, No. 19
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Synechococcus Strain PCC 7942 glnN Product (Glutamine Synthetase III) Helps Recovery from
Prolonged Nitrogen Chlorosis
Jörg
Sauer,1
Ulrike
Dirmeier,2 and
Karl
Forchhammer1,*
Institut für Mikrobiologie und
Molekularbiologie der Justus-Liebig-Universität Giessen, D-35392
Giessen,1 and Lehrstuhl für
Mikrobiologie der Ludwig-Maximilians-Universität München,
D-80638 Munich,2 Germany
Received 14 April 2000/Accepted 6 July 2000
 |
ABSTRACT |
We report the cloning and sequencing of the glnN gene
encoding a class III glutamine synthetase from the cyanobacterium
Synechococcus strain PCC 7942. Mapping of the
transcriptional start site revealed a DNA sequence in the promoter
region that resembles an imperfect NtcA binding motif. Expression of
glnN is impaired in NtcA- and PII-deficient
mutants. The only parameter which was negatively affected in the
glnN mutant compared to the wild type was the recovery rate
of prolonged nitrogen-starved cells with low concentrations of combined nitrogen.
 |
TEXT |
When nondiazotrophic cyanobacteria
are deprived of combined nitrogen sources, the intense blue-green
cultures turn yellow, by a process which is known as chlorosis
(1). Recently, it was shown that the complete depigmentation
of cells of the obligate photoautotroph Synechococcus strain
PCC 7942 is not a consequence of loss of cell viability but a specific
acclimation process which enables the cells to survive for prolonged
periods of nitrogen starvation (12). This acclimation
process proceeds in three phases. The rapid trimming and degradation of
the phycobilisomes (phase 1) (2, 12) is followed by a
gradual loss of chlorophyll a (Chl a) and
intracellular proteins (phase 2). Finally, the cells lose all visible
pigmentation and enter a form of dormancy (phase 3), from which they
are able to reinitiate growth within 3 to 4 days following the addition
of a combined nitrogen source (12).
A previous study investigated factors involved in the initiation of
nitrogen chlorosis. It was shown that the signaling protein PII (the glnB gene product), which senses the
cellular nitrogen and carbon status (7, 8, 13), was not
involved in the process (18). However,
PII-deficient cells display an impaired capacity to rapidly
reinitiate growth after nitrogen starvation (18). In
contrast, NtcA, a global activator of ammonium-repressed genes
(14), was required for sequential pigment degradation and
cell survival (18). In addition, nbl genes
mediate phycobiliprotein degradation during starvation for either
sulfur or nitrogen (3, 5, 19). Mutants with mutations in
these genes display a nonbleaching phenotype and an impaired capacity
to recover from starvation. The nblB gene seems to be
constitutively expressed, but its product is not active in
phycobiliprotein degradation until nblA is expressed (5). The expression of nblA is under the control
of the NblR regulator (19). In the ntcA-deficient
mutant, induction of the nblA gene was not impaired
(18), but nevertheless, the cells were unable to rapidly
degrade the phycobiliproteins. This indicates that the response to
nitrogen depletion involves the concerted action of the NblR-controlled
global starvation program and an NtcA-controlled nitrogen-specific response.
A candidate for an NtcA-controlled factor that is required for nitrogen
chlorosis is the key enzyme of ammonium assimilation, glutamine
synthetase (GS). It was shown that inhibiting GS activity during
chlorosis by the addition of L-methionine sulfoximine
almost immediately stops phycobiliprotein degradation (18),
suggesting that GS activity might be required to support
nblA-mediated phycobiliprotein degradation. Interestingly,
besides the primary GS (GSI), which is under the control of NtcA
(14), a second GS isoenzyme (termed GlnN), belonging to the
GSIII class, has been identified in nondiazotrophic cyanobacteria
(9, 15). Although the subunit structures and the amino acid
sequences of the GSI and GSIII classes differ markedly, similar
enzymatic properties, such as Km and
Vmax values, have been reported (9).
In Synechocystis strain PCC 6803, the expression of
glnN is strongly induced under conditions of nitrogen
deprivation (9, 16). Together with the fact that
glnN has so far only been observed in nondiazotrophic
cyanobacteria (9, 15), this suggested a role for GlnN in
nitrogen chlorosis. However, in nitrogen-depleted cells, despite being
strongly induced, the GSIII class was reported to account for no more
than 20% of the total GS activity (15). Since no phenotype
has been reported for the glnN-deficient
Synechocystis strain, it was unclear whether this relatively
moderate contribution of the GSIII class to the total GS activity was
sufficient to play any physiological role in the process of nitrogen
chlorosis. The present study aimed to clarify the role of
glnN in the cyanobacterium Synechococcus strain
PCC 7942.
Characterization of the glnN gene from
Synechococcus strain PCC 7942.
To identify the
glnN gene from Synechococcus strain PCC 7942, we
performed Southern blot hybridizations of digested
Synechococcus strain PCC 7942 DNA using a PCR-generated
Synechocystis strain PCC 6803 glnN probe. This,
as well as other standard DNA manipulation and cloning techniques, was
performed according to the method of Sambrook et al. (17).
Genomic DNA was digested with HindIII, and DNA fragments
in the size range of 9 kbp hybridizing with the glnN probe
were isolated and redigested with EcoRI. Finally, DNA
fragments in the size range of 4 to 4.5 kbp were isolated and cloned
into pBluescript II KS(+). From 80 clones which were analyzed by dot
blot hybridization of the isolated plasmid DNA, one plasmid (pUD3)
contained the glnN hybridizing fragment. Sequencing of the
4,270-bp DNA insert revealed a 2,172-bp open reading frame corresponding to a protein of 723 amino acids with a calculated relative molecular weight of 78,941 and an isoelectric point at pH
5.02. Its deduced amino acid sequence is highly similar to those for
GlnN from Synechocystis strain PCC 6803 and
Pseudoanabaena strain PCC 6903 (4) (88 and 75%
identity, respectively) and less similar to those for the glutamine
synthetases from Bacteroides fragilis and Butyrivibrio
fibrisolvens (42 and 38% identity, respectively).
The transcriptional start point (TSP) of the Synechococcus
glnN gene was determined by primer extension analysis (Fig.
1A). For this purpose, the
oligonucleotide 5'GGCGGATCCCGATTGGTGATCTGG3' (from
nucleotide +59 to nucleotide +36, with the first nucleotide of the
translation start codon considered +1) was end labeled with
[
-32P]ATP using T4 polynucleotide kinase, as described
elsewhere (17). The primer (0.2 pmol; approximately 5 × 105 cpm) was added to 12 µg of total RNA, and the
mixture was heated in hybridization buffer (100 mM KCl, 50 mM Tris-HCl
[pH 8.3]) for 30 s at 95°C and then for 20 min at 55°C. The
extension reaction was performed for 1 h at 41°C with 10 U of
avian myeloblastosis virus reverse transcriptase (Promega) in the
presence of 5 U of RNase inhibitor (Roche). The extension
product was run on a sequencing gel (8% polyacrylamide) adjacent to
the DNA sequence obtained by using the same oligonucleotide as the
primer.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Primer extension analysis of the glnN
promoter region from RNA isolated from nitrogen-deprived cells ( N).
Lanes C, T, A, and G contain a dideoxy sequencing ladder obtained with
the primer used for the extension reaction. The transcription start
nucleotide is indicated by an arrow. (B) Alignment of the
Synechococcus strain PCC 7942 glnN promoter
region (glnN 7942) with the corresponding region for
Synechocystis strain PCC 6803 (glnN 6803). A
putative imperfect NtcA binding site is indicated in boldface, the TSPs
are indicated by arrows, and the 10 sequence is boxed.
|
|
A single extension product was obtained when RNA from nitrogen-starved
cells was used as a template for reverse transcription.
A product of
the same size could be derived from RNA of nitrate-replete
cells,
although it was less abundant (data not shown). The TSP,
as deduced
from this experiment, is located 22 bp upstream of
the putative ATG
translational start codon. A sequence with similarities
to the
canonical NtcA binding motif can be found upstream of the
TSP, with a
distance that corresponds well to that reported for
NtcA binding motifs
(
14) (Fig.
1B).
Expression of glnN in mutants deficient in the nitrogen
control genes ntcA or glnB.
As a first
step to analyze the expression of glnN, Northern blot
experiments were performed. Total RNA was prepared from
Synechococcus strain PCC 7942 and Synechocystis
strain PCC 6803 cells grown in modified BG11N medium
(12) and from cells of the same strains harvested 7 h
after nitrogen deprivation, as previously described (18). Total RNA (15 µg) was separated on a 1% formaldehyde-agarose gel and
transferred to a nylon membrane (Nytran NY 12 N; Schleicher & Schuell).
As a Synechococcus strain PCC 7942-specific glnN
probe, a 988-bp BglI DNA fragment from plasmid pUD3 (Fig.
2A) was used. Although the
glnN probe revealed no distinct bands using RNA from Synechococcus strain PCC 7942 wild-type cells, a smear with
hybridization signals of a maximal size of 2.3-kb was detected, which
corresponded in size to a monocistronic glnN transcript.
This signal was specifically increased in nitrogen-starved cells (Fig.
2B). As a positive control, RNA from nitrogen-depleted
Synechocystis strain PCC 6803 cells gave a strong signal at
2.3 kb with a Synechocystis strain PCC 6803 glnN
probe (Fig. 2B). We argue that the glnN transcript in Synechococcus strain PCC 7942 cells is even more unstable
than that in Synechocystis strain PCC 6803 cells, for which
a short half-life was reported previously (16). To get
additional proof that glnN is transcribed monocistronically
in Synechococcus strain PCC 7942 cells, Northern blot
experiments were performed with a GlnN-deficient mutant (MGlnN), in
which the Tn5 Kanr
Bleor cassette was inserted into the
glnN gene in the same transcriptional orientation (Fig. 2A).
Two transcripts with sizes of 2.5 and 1.65 kb could be detected that
hybridized with a 3' glnN probe but not with a
glnN probe upstream of the inserted Tn5
Kanr Bleor cartridge (Fig. 2). Control
hybridization with a Tn5 Kanr probe revealed
that the longer transcript corresponds to an mRNA that encompasses the
Tn5 Kanr Bleor genes, as well as the
3' half of glnN. The shorter transcript corresponds in size
to a product of the Tn5 Bleor gene and the
3' half of the glnN gene. No signals of longer transcripts could be observed, strongly indicating that the glnN
transcript terminates at the 3' end of this gene. To further analyze
glnN expression, we examined GlnN synthesis by Western blot
experiments using antibodies raised against Synechocystis
strain PCC 6803 GlnN (9) (Fig.
3). As shown previously, in wild-type
Synechococcus strain PCC 7942 cells the synthesis of GlnN is
strongly induced under conditions of nitrogen starvation
(9). In contrast, in cells of the PII-deficient
strain MP2 (7), GlnN abundance increased only slightly after
2 days of nitrogen starvation. Cells of the NtcA-deficient mutant MNtcA
(18) were completely unable to increase the synthesis of
GlnN beyond its very low basal level. This result indicates that the
activated glnN expression following nitrogen deprivation
depends on NtcA and at least partially on PII. Recently, evidence was presented which suggests that glnN is under
NtcA control in Synechocystis strain PCC 6803 (10). Together, these accumulated evidences suggest that
NtcA recognizes the region upstream of glnN, which
resembles the NtcA motif. The difference between the canonical NtcA
binding motif (14) and the motif reported here is a change
from GTAN8TACN22TANNNT to GTAN7TAGCN22TANGAT. A similar sequence (GTAN7TGTCN22TANGAT) can be found
in the promoter region of glnN from Synechocystis
strain PCC 6803 (16) (Fig. 1B). Despite the fact that no
binding of the NtcA protein to this latter sequence could be observed
by gel retardation experiments (16), because of the NtcA
dependence of GlnN synthesis, we suggest that the DNA sequence upstream
of glnN represents a weak NtcA binding motif. It is possible
that strong binding of NtcA to this sequence requires additional
factors. In this respect it is interesting that a
PII-deficient mutant is also impaired in glnN
expression. Whether PII regulates a factor that is involved
in the expression of glnN remains to be elucidated.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Structure of the glnN region in
Synechococcus strain PCC 7942 wild-type cells and in a
mutant in which a kanamycin-bleomycin resistance cassette was inserted
into the glnN gene. To create the mutant MGlnN, plasmid pUD3
was restricted with BclI, which cleaved 948 bp downstream
from the putative start codon of the glnN coding region, and
the 1.6-kb BamHI-BamHI Tn5
Kanr Belor cassette from
plasmid pUC-KIXX (Pharmacia) was inserted into the BclI
site, yielding plasmid pGLNN-KAN. Cells of Synechococcus
strain PCC 7942 were transformed with plasmid pGLNN-KAN as described by
Golden et al. (11) and tested by PCR and Southern blot
analysis for complete segregation. The arrows indicate the
transcriptional orientation. (B) Northern blot of total RNA isolated
from Synechococcus strain PCC 7942 wild-type (7942) and
GlnN-deficient cells (MGlnN) and from Synechocystis strain
PCC 6803 wild-type cells (6803) grown in nitrate-containing medium (+)
and incubated for 7 h in nitrogen-free medium ( ). A 988-bp
BglI DNA fragment from plasmid pUD3 was used as a
Synechococcus strain PCC 7942-specific glnN
probe, a 1,070-bp PCR-amplified internal glnN fragment was
used as a Synechocystis strain PCC 6803-specific
glnN probe, a 0.73-kb HindIII-XbaI
fragment from plasmid pRN16A (R. Figge, unpublished data) containing a
part of the 16S rRNA encoding gene from Synechocystis strain
PCC 6803 was used as a 16S rRNA probe. Transcript size was estimated by
comparison with 23S and 16S rRNAs. N, nitrogen.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 3.
Immunoblot analysis of the GlnN (GSIII) and GlnA (GSI)
proteins. Cells of Synechococcus strain PCC 7942 (wt), of
the PII-deficient mutant (MP2), and of the NtcA-deficient
mutant (MNtcA) grown in the presence of ammonium (+N) were transferred
to nitrogen-free ( N) medium. Extracts were prepared (18)
from cells harvested during exponential growth (+N) and from cells
harvested 1 and 2 days after nitrogen step-down. Twenty micrograms of
total protein from the cell extracts was separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis. GlnN was revealed by using
antibodies raised against the GlnN protein of Synechocystis
strain PCC 6803 (9) and GlnA was visualized by using
antibodies raised against GlnA from Nostoc sp. strain UCD
7801.
|
|
Functional analysis of the glnN gene in
Synechococcus strain PCC 7942.
The expression pattern
of glnN, together with the fact that glnN has not
yet been found in nitrogen-fixing strains, implies that this GS may be
specifically designed for conditions of nitrogen deficiency. To
determine the physiological function of GlnN, the GlnN-deficient mutant
MGlnN was analyzed with respect to its growth rate, response to various
stress conditions, and the capacity to survive nitrogen starvation. In
the exponential growth phase, it exhibited the same growth rates as the
wild type when supplemented with nitrate or ammonium at different
concentrations (0.5 to 20 mM) (data not shown). To investigate the
possibility that GlnN is a chlorosis-specific GS, MGlnN was deprived of
nitrogen and its phenotype was analyzed. The level of total GS activity
during starvation was determined by the GS transferase assay
(7). The mutant displayed the same increase in GS activity
as the wild type following nitrogen downshift (data not shown),
implying that in Synechococcus strain PCC 7942, most GS is
derived from glnA even under nitrogen-deprived conditions.
With prolonged nitrogen starvation, the GS activity in both strains
decreased progressively to a level below the limit of detection after
about 18 days. The process of chlorosis was recorded by analyzing the
levels of phycocyanin (PC), Chl a, and glycogen and
measuring the optical density at 750 nm (OD750) of the
cultures following a transfer of cells from ammonium-replete
to nitrogen-depleted conditions (Table
1). The experimental procedures were
performed as previously described (12). A deficiency in GlnN
caused no significant impairment in the chlorosis process. Up to the
completion of the pigment degradation process (about 15 days into
chlorosis), the glnN mutants recovered, following the
addition of a combined nitrogen source, as fast as wild-type cells.
This is in accord with the similar GS activities detected in the
strains. Therefore, GlnN is not required to support the chlorosis
process. However, upon prolonged incubation under nitrogen-deficient
conditions (periods up to 16 weeks were investigated), the capacity of
MGlnN to reinitiate growth was retarded compared to wild-type cells,
and the mutant was not able to accumulate wild-type levels of
phycobiliproteins. Figure 4 shows the
amount of newly synthesized phycobiliproteins over a period of 3 days
in Synechococcus strain PCC 7942 glnN mutants and
wild-type cells that had been incubated for 5 weeks under
nitrogen-deprived conditions and supplemented at the onset of the
regeneration experiment with either 0.5 mM NaNO3 or 0.5 mM
NH4Cl. One day after the addition of nitrogen to the
chlorotic cultures no phycobiliproteins could be measured, but after 2 days the beginning of a transient repigmentation was observed.
Maximal phycobiliprotein levels were obtained after 2 or 3 days,
depending on the nitrogen source. After consumption of the added
nitrogen source, phycobiliproteins were degraded again. Compared to the wild type, MGlnN accumulated significantly less phycobiliprotein and
degraded it earlier. When cells recovery was induced with either 1 or
0.1 mM NaNO3 or NH4Cl, the transient
pigmentation period was increased or decreased, respectively, but
the difference between the wild type and MGlnN was consistent.
Similar results were also obtained at different light intensities (data
not shown). However, when chlorotic cultures were supplemented with
excess nitrogen (20 mM), GlnN deficiency caused no phenotype. This
shows that GlnN helps chlorotic cells to acquire combined nitrogen at low ambient concentrations, which are typical for natural environments (6). Therefore, wild-type cells are able to accumulate
maximal levels of phycobiliproteins under these conditions which serve as a nitrogen reservoir for subsequent periods of nitrogen deprivation. Other physiological stresses, such as high light stress and sulfur or
carbon starvation, had no effect on the phenotype of the
glnN mutation. Moreover, the reinitiation of growth from
lightlimited stationary-phase cultures was also unaffected. We conclude
from this investigation that GlnN is specifically designed for nitrogen assimilation under conditions of severe nitrogen limitation. The fact
that various nondiazotrophic cyanobacteria are equipped with the
glnN gene emphasizes the selective advantage under natural conditions that results from the capacity to cope with prolonged periods of nitrogen starvation.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Change in the levels of several chlorosis indicators and
in OD750 per culture volume (12) in cultures of
Synechococcus strain PCC 7942 wild-type and MGlnN cells
following a transfer of cells from ammonium-replete conditions to
nitrogen-depleted conditions
|
|

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 4.
Newly synthesized phycobiliproteins 2, 3, and 4 days
(2d, 3d, and 4d) after addition of either 0.5 mM NaNO3
(NO3 ) or 0.5 mM NH4Cl
(NH4+) to chlorotic cultures of
Synechococcus strain PCC 7942 (wt) and MGlnN that were
incubated previously under nitrogen-deprived conditions for 36 days.
The cultures were adjusted to the same OD750 prior to the
addition of nitrate. The amount of phycobiliproteins was estimated as
described previously (12) and shown as the relative
phycocyanin content per OD750 (rel.
PC-content/OD750). nd, not detectable.
|
|
Nucleotide sequence accession number.
The nucleotide
sequence of the glnN gene from Synechococcus
strain PCC 7942 has been deposited in GenBank under accession number
AF251806.
 |
ACKNOWLEDGMENTS |
We are indebted to F. J. Florencio for providing the
GlnN-specific antibodies and to J. C. Meeks for the GlnA-specific
antibodies used in this investigation. We thank G. Sawers for critical
reading of the manuscript.
This work was supported by a grant from the Deutsche
Forschungsgemeinschaft (Fo 195/2-3).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Mikrobiologie und Molekularbiologie der
Justus-Liebig-Universität Giessen, Heinrich-Buff-Ring 26-32, D-35392 Giessen, Germany. Phone: (49) 641-9935545. Fax: (49)
641-9935549. E-mail:
Karl.Forchhammer{at}mikro.bio.uni-giessen.de.
 |
REFERENCES |
| 1.
|
Allen, M. M., and A. J. Smith.
1969.
Nitrogen chlorosis in blue-green algae.
Arch. Microbiol.
69:114-120.
|
| 2.
|
Collier, J. L., and A. R. Grossman.
1992.
Chlorosis induced by nutrient deprivation in Synechococcus sp. strain PCC 7942: not all bleaching is the same.
J. Bacteriol.
174:4718-4726[Abstract/Free Full Text].
|
| 3.
|
Collier, J. L., and A. R. Grossman.
1994.
A small polypeptide triggers complete degradation of light-harvesting phycobiliproteins in nutrient-deprived cyanobacteria.
EMBO J.
13:1039-1047[Medline].
|
| 4.
|
Crespo, J. L.,
M. García-Domínguez, and F. J. Florencio.
1998.
Nitrogen control of the glnN gene that codes for GS type III, the only glutamine synthetase in the cyanobacterium Pseudoanabaena sp. PCC 6903.
Mol. Microbiol.
30:1101-1112[CrossRef][Medline].
|
| 5.
|
Dolganov, N., and A. R. Grossman.
1999.
A polypeptide with similarity to phycocyanin -subunit phycobiliprotein lyase involved in degradation of phycobilisomes.
J. Bacteriol.
181:610-617[Abstract/Free Full Text].
|
| 6.
|
Flores, E., and A. Herrero.
1994.
Assimilatory nitrogen metabolism and its regulation, p. 487-571.
In
D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 7.
|
Forchhammer, K., and N. Tandeau de Marsac.
1995.
Functional analysis of the phosphoprotein PII (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942.
J. Bacteriol.
177:2033-2040[Abstract/Free Full Text].
|
| 8.
|
Forchhammer, K.
1999.
The PII protein in Synechococcus strain PCC 7942 senses and signals 2-oxoglutarate under ATP-replete conditions, p. 549-553.
In
G. A. Perscheck, W. Löffelhardt, and G. Schmetterer (ed.), The phototrophic prokaryotes. Kluwer Academic and Plenum Publishers, New York, N.Y.
|
| 9.
|
García-Domínguez, M.,
J. C. Reyes, and F. J. Florencio.
1997.
Purification and characterization of a new type of glutamine synthetase form cyanobacteria.
Eur. J. Biochem.
244:258-264[Medline].
|
| 10.
|
García-Domínguez, M.,
J. C. Reyes, and F. J. Florencio.
2000.
NtcA represses transcription of gifA and gifB, genes that encode inhibitors of glutamine synthetase type 1 from Synechocystis sp. strain PCC 6803.
Mol. Microbiol.
35:1192-1201[CrossRef][Medline].
|
| 11.
|
Golden, S. S.,
J. Brusslan, and R. Haselkorn.
1987.
Genetic engineering of the cyanobacterial chromosome.
Methods Enzymol.
153:215-231[Medline].
|
| 12.
|
Görl, M.,
J. Sauer,
T. Baier, and K. Forchhammer.
1998.
Nitrogen-starvation-induced chlorosis in Synechococcus strain PCC 7942: adaptation to long-term survival.
Microbiology
144:2449-2458[Abstract/Free Full Text].
|
| 13.
|
Irmler, A.,
S. Sanner,
H. Dierks, and K. Forchhammer.
1997.
Dephosphorylation of the phosphoprotein PII in Synechococcus strain PCC 7942: identification of an ATP and 2-oxoglutarate-regulated phosphatase activity.
Mol. Microbiol.
26:81-90[CrossRef][Medline].
|
| 14.
|
Luque, I.,
E. Flores, and A. Herrero.
1994.
Molecular mechanism for the operation of nitrogen control in cyanobacteria.
EMBO J.
13:2862-2869[Medline].
|
| 15.
|
Reyes, J. C., and F. J. Florencio.
1994.
A new type of glutamine synthetase in cyanobacteria: the protein encoded by the glnN gene supports nitrogen assimilation in Synechocystis sp. strain PCC 6803.
J. Bacteriol.
176:1260-1267[Abstract/Free Full Text].
|
| 16.
|
Reyes, J. C.,
M. I. Muro-Pastor, and F. J. Florencio.
1997.
Transcription of glutamine synthetase genes (glnA and glnN) from the cyanobacterium Synechocystis strain PCC 6803 is differently regulated in response to nitrogen availability.
J. Bacteriol.
179:2678-2689[Abstract/Free Full Text].
|
| 17.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 18.
|
Sauer, J.,
M. Görl, and K. Forchhammer.
1999.
Nitrogen starvation in Synechococcus strain PCC 7942: involvement of glutamine synthetase and NtcA in phycobiliprotein degradation and survival.
Arch. Microbiol.
172:247-255[CrossRef][Medline].
|
| 19.
|
Schwarz, R., and A. R. Grossman.
1998.
A response regulator of cyanobacteria integrates diverse environmental signals and is critical for survival under extreme conditions.
Proc. Natl. Acad. Sci. USA
95:11008-11013[Abstract/Free Full Text].
|
Journal of Bacteriology, October 2000, p. 5615-5619, Vol. 182, No. 19
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Espinosa, J., Castells, M. A., Laichoubi, K. B., Contreras, A.
(2009). Mutations at pipX Suppress Lethality of PII-Deficient Mutants of Synechococcus elongatus PCC 7942. J. Bacteriol.
191: 4863-4869
[Abstract]
[Full Text]
-
Espinosa, J., Forchhammer, K., Contreras, A.
(2007). Role of the Synechococcus PCC 7942 nitrogen regulator protein PipX in NtcA-controlled processes. Microbiology
153: 711-718
[Abstract]
[Full Text]
-
Lahmi, R., Sendersky, E., Perelman, A., Hagemann, M., Forchhammer, K., Schwarz, R.
(2006). Alanine Dehydrogenase Activity Is Required for Adequate Progression of Phycobilisome Degradation during Nitrogen Starvation in Synechococcus elongatus PCC 7942.. J. Bacteriol.
188: 5258-5265
[Abstract]
[Full Text]
-
Schwarz, R., Forchhammer, K.
(2005). Acclimation of unicellular cyanobacteria to macronutrient deficiency: emergence of a complex network of cellular responses. Microbiology
151: 2503-2514
[Abstract]
[Full Text]
-
Gillor, O., Harush, A., Hadas, O., Post, A. F., Belkin, S.
(2003). A Synechococcus PglnA::luxAB Fusion for Estimation of Nitrogen Bioavailability to Freshwater Cyanobacteria. Appl. Environ. Microbiol.
69: 1465-1474
[Abstract]
[Full Text]
-
Sauer, J., Schreiber, U., Schmid, R., Völker, U., Forchhammer, K.
(2001). Nitrogen Starvation-Induced Chlorosis in Synechococcus PCC 7942. Low-Level Photosynthesis As a Mechanism of Long-Term Survival. Plant Physiol.
126: 233-243
[Abstract]
[Full Text]
-
Muro-Pastor, A. M., Herrero, A., Flores, E.
(2001). Nitrogen-Regulated Group 2 Sigma Factor from Synechocystis sp. Strain PCC 6803 Involved in Survival under Nitrogen Stress. J. Bacteriol.
183: 1090-1095
[Abstract]
[Full Text]
-
Herrero, A., Muro-Pastor, A. M., Flores, E.
(2001). Nitrogen Control in Cyanobacteria. J. Bacteriol.
183: 411-425
[Full Text]