Previous Article | Next Article 
Journal of Bacteriology, January 2000, p. 278-285, Vol. 182, No. 2
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Membrane Topology of the Bacillus
subtilis Pro-
K Processing Complex
David H.
Green and
Simon M.
Cutting*
School of Biological Sciences, Royal Holloway
University of London, Egham, Surrey TW20 0EX, United Kingdom
Received 15 September 1999/Accepted 26 October 1999
 |
ABSTRACT |
Activation of the final sporulation-specific transcription factor,
K, is regulated by a signal emanating from the forespore
which interacts with the pro-K processing complex,
comprising SpoIVFA, BofA, and the pro-K processing
protease, SpoIVFB. Mature K then directs late gene
expression in the parental compartment of the developing sporangial
cell. The nature of this complex and how it is activated to process
pro-K are not understood. All three proteins are
predicted to be integral membrane proteins. Here, we have analyzed the
membrane topology of SpoIVFA and SpoIVFB by constructing chimeric forms
of spoIVFA and spoIVFB with the complementary
reporters phoA and lacZ and analyzing activity
in Escherichia coli. SpoIVFA was found to have a single
transmembrane-spanning domain, while SpoIVFB was shown to have six
transmembrane-spanning domains (6-transmembrane configuration). Further, SpoIVFA is required to stabilize SpoIVFB in the membrane. SpoIVFB was shown to have a 4-transmembrane configuration when expressed on its own but was found to have a 6-transmembrane
configuration when coexpressed with SpoIVFA, while BofA had a positive
effect on the assembly of both SpoIVFA and SpoIVFB. The single
transmembrane domain of SpoIVFA (approximately residues 73 to 90) was
shown to be the principle determinant in stabilizing the
6-transmembrane configuration of SpoIVFB. Although the
bofB8 allele, which uncouples the K
checkpoint, did not appear to promote a conformational change from a 6- to 4-transmembrane configuration of SpoIVFB (apparently ruling out a
profound conformational change as the mechanism of activating SpoIVFB
proteolytic activity), instability of SpoIVFB may be an important
factor in SpoIVFB-mediated processing of pro-K.
| |
INTRODUCTION |
In Bacillus subtilis,
checkpoints regulate differential gene expression during spore
formation, ensuring developmental fidelity and enforcing a dependence
to a sequence of events (4, 8, 9, 11, 24). In the
K checkpoint, activation of the transcription factor,
K, in the mother cell chamber of the sporangial cell is
coupled to events under the control of G-dependent gene
expression in the opposed (forespore) compartment (4). The
inactive form of K, termed pro-K, is
synthesized in the mother cell and must be proteolytically cleaved at
its N terminus to be rendered active (13).
Pro-K has itself been shown to target and associate with
the outer forespore membrane (OFM) of the developing forespore
(28), and this event presumably allows pro-K
to interact with the processing complex embedded in the OFM. Genetic
experiments have identified three components of this complex, SpoIVFB,
SpoIVFA, and BofA. SpoIVFB has been proposed to be the putative
protease (5) which cleaves pro-K; this
protein contains some homology with Zn2+ metalloproteases
(10), although activity in vitro has not been shown to date
(12, 21). SpoIVFA and BofA, however, have been shown to
regulate the proposed proteolytic activity of SpoIVFB both positively,
by preserving the stability of SpoIVFB and, negatively, by rendering
the SpoIVFB molecule inactive until an appropriate signal is received
(4, 5, 19, 21, 22). SpoIVFA and SpoIVFB have also been
localized to the OFM by immunofluorescence microscopy (20),
while BofA has been shown to assemble into a phospholipid membrane in
Escherichia coli and its topology has been determined by
using the analysis of complementary bofA-phoA or bofA-lacZ
gene fusions (26). So far, genetic experimentation has shown
that SpoIVFA and SpoIVFB are likely to interact, and BofA may also
interact directly to form a hetero-oligomeric complex (4,
5).
Pro-K proteolysis is coupled to a signal emanating from
the opposed forespore chamber. This signal is comprised of one
G-transcribed gene, spoIVB, whose 46-kDa
product is proposed to be secreted through the inner forespore membrane
(IFM), where it can subsequently interact with the pro-K
processing complex (3). This interaction ultimately relieves SpoIVFA- and BofA-mediated inhibition of SpoIVFB, leading to
pro-K proteolysis, activation of
K-directed gene expression, and completion of the
terminal stages of spore formation.
In this work, we have investigated the topology of the SpoIVFA and
SpoIVFB polypeptides in a phospholipid bilayer. Using the analysis of
alkaline phosphatase (AP) in different spoIVFA-phoA and
spoIVFB-phoA gene fusions in E. coli, together
with complementary analysis of lacZ gene fusions, we show
that SpoIVFB is an intrinsically unstable molecule which can assume two
membrane configurations, dependent on the presence or absence of
SpoIVFA and, to a lesser degree, BofA.
| |
MATERIALS AND METHODS |
Bacterial strains.
E. coli XL1-Blue recA1 endA1
gyrA96 thi-1 hsdR17 supE44 relA1 lac [F' proAB
lacIqZ
M15 Tn10
(Tetr)] (Stratagene) was used for all routine plasmid
constructions. E. coli CC118 araD139
(ara,leu)7697 lacX74 phoA20
galE galK thi rpsE argE(Am) recA1 (16)
was used for analysis of AP. E. coli TG1
(23) was used for analysis of 
-galactosidase activity. SC1256 (spoIVFA181), SC1257 (spoIVFB587),
VO138 (spoIVFA91), SC1358 (spoIVFA91
spoIVFBVI235), SC1363 (spoIVFA91 spoIVFBVM207), SC1365 (spoIVFA91 spoIVFBLV221), and SC1366
(spoIVFA91 spoIVFBAV273) have been described previously
(5). DG675 (spoIVFA91 bofA::erm) was
constructed by transforming cells of VO138 with chromosomal DNA from
ER76 (bofA::erm spoIIIG1) with selection for
erythromycin resistance (erm). All strains used in this
study are congenic with the prototrophic wild-type (Spo+)
strain PY79 (27).
Plasmids.
pMV100, containing the intact phoA
gene, has been described elsewhere (6). pJBZ280 contains a
full-length but promoterless lacZ gene (gift of D. Alley).
pK184 (ATCC 37766) carries the p15A replicon
(kanr) and can be used in conjunction with ColE1
replicons. pMUTIN2 (25) is a vector containing the
bla gene (selectable in E. coli), the
erm gene (erythromycin resistance in B. subtilis), and the isopropyl--D-thiogalactopyranoside (IPTG)-inducible
promoter Pspac. pSL13 (Pspac spoIVFB), pSL14
(Pspac spoIVFABbofB8), and pSL31 (Pspac spoIVFAB)
have been described previously (12) and contain segments of
the wild-type spoIVF or mutant spoIVF(bofB8) operon cloned downstream of the IPTG-inducible Pspac
promoter of the B. subtilis vector pDG148, modified to
remove the origin for autonomous replication in B. subtilis.
pDG5981 contains the bofA cistron under the control of the
IPTG-inducible Pspac promoter. 5'
(GCCGGATCCATTAAGAAGAGAGTTTG) and 3'
(TATGCTCGAGCCTATTTTTTATTATTG) oligonucleotide primers were used
to PCR amplify the bofA operon, which was then cloned into
pMUTIN2 by using restriction endonuclease sites contained within the
PCR primers. Using the resulting clone, a second PCR was performed to
amplify upstream of Pspac the termination codon of
bofA. This PCR product was cloned in pK184 (see above), and
the construct (pDG5981) was verified by nucleotide sequencing.
General methods.
General Bacillus methods
(transformations, induction of sporulation, etc.) are described
elsewhere (7).
Plasmid constructions. (i) spoIVF-phoA and
spoIVF-lacZ chimeric plasmids.
Plasmids pSL13, pSL31,
and pSL14 were used as the basis for the construction of the chimeric
spoIVF-phoA or -lacZ genes in a two-step
procedure. Each contains the spoIVFAB(bofB8) (pSL14), spoIVFB (pSL13), or spoIVFAB (pSL31) cistrons
fused downstream of the IPTG-inducible Pspac promoter
(12). First, a sense primer, specific for a region upstream
of Pspac, and specific antisense primers to various regions
of the spoIVF coding region were used to generate PCR
products of appropriate segments of spoIVFA,
spoIVFB, or spoIVFA and spoIVFB. Next,
each PCR product was digested with XbaI and BamHI
or XbaI and EcoRI for phoA or
lacZ constructs, respectively (restriction sites were
contained within the sense and antisense primers), and ligated with
pMV100 (phoA) or pJBZ280 (lacZ) to create an
in-frame fusion between the spoIVF coding sequence and
phoA or lacZ. We found that it was not possible
to construct spoIVFA and spoIVFB fusions to
lacZ at every position. Attempting this produced extremely
unstable clones which underwent a frameshift mutation, preventing
expression of LacZ in E. coli. We attribute this to the
inappropriate expression and translocation of a chimeric SpoIVFA- or
SpoIVFB-LacZ chimera, which is toxic to cell growth. Fusion junctions
were confirmed by DNA sequencing.
(ii) spoIVFA164-spoIVFB-phoA chimeric
plasmids.
pMV100-derived plasmids, created as described above with
phoA fused to the entire spoIVF operon at
positions immediately following codons 32 (A32), 112 (Q112), and 180 (L180) within the spoIVFB cistron, were used as templates
for an inverse PCR to delete codons 100 to 264 of spoIVFA.
The in-frame deletion was verified by DNA sequencing.
(iii) spoIVFA91-spoIVFB-phoA chimeric
plasmids.
The same procedure for
spoIVFA164-spoIVFB-phoA as that described above was used,
and an inverse PCR was used to delete codons 2 to 92 of
spoIVFA.
(iv) spoIVFA67-spoIVFB-phoA chimeric
plasmids.
The same procedure for
spoIVFA164-spoIVFB-phoA as that described above was used,
and an inverse PCR was used to delete codons 3 to 70 of
spoIVFA while retaining the putative transmembrane domain.
Analysis of AP activity.
Activity was monitored on solid
medium by using the AP substrate BCIP
(5-bromo-4-chloro-3-indolylphosphate sodium salt; Sigma) at 40 µg/ml.
For liquid assays, CC118 derivative strains containing chimeric
phoA genes were grown overnight at 30 or 37°C in
Luria-Bertani (LB) broth (containing 50 µg of ampicillin per ml and
0.2% glucose), diluted 1:100 in 20 ml of fresh LB broth, and incubated
at either 30 or 37°C with orbital shaking (200 rpm) until an
approximate density of 0.3 A600 was reached.
IPTG was then added to a final concentration of 1 mM, and incubation
was continued for a further 2 h (37°C) or 3 h (30°C), at
which point 1-ml volumes were removed and the
A595 and AP activity determined. AP activity was
assayed from 1 ml of culture by resuspending the cell pellet in 800 µl of distilled water. Cells were permeabilized by adding 20 µl of 0.1% sodium dodecyl sulfate and 20 µl of chloroform and vortexed for
1 min. A 100-µl volume of 10 mg of
para-nitrophenolphosphate (in 1 M Tris-HCl, pH 9.0) per ml
was added, and incubation was commenced at 37°C until either a
straw-yellow color had developed or 1 h had elapsed, and the
reaction was stopped by adding 100 µl of 10 M NaOH. Specific activity
was calculated according to the following formula: 1,000 × {A420/[reaction time (min) × volume of cells
(ml) × A595]} (2).
Coexpression experiments.
To coexpress BofA with SpoIVF-AP
fusions, E. coli XL1-Blue carrying pDG5981
(Pspac-bofA; see above) was used as a host. pMV100 derivatives carrying Pspac-spoIVF-phoA chimeras were
introduced into competent cells by selection for Apr
(carried by the pMV100 vector) on LB plates containing ampicillin and
kanamycin. Kanr was encoded by pDG5981. AP activity was
determined by growth of these XL1-Blue strains in the presence of
ampicillin and kanamycin and was found to be identical to that obtained
in CC118. Background levels of AP activity were provided by an XL1-Blue
strain containing both pK184 and pMV100.
To coexpress SpoIVFA and/or SpoIVFAB with BofA-AP fusions, we first
constructed plasmids that expressed SpoIVFA or both SpoIVFA and
SpoIVFB. The spoIVFA or complete spoIVF operon,
including the upstream Pspac promoter from plasmid pSL13
(Pspac-spoIVFB), was cloned into pK184, which contains the
p15A replicon. These plasmids were then transformed into XL1-Blue cells
containing the four bofA-AP fusions described by Varcamonti
et al. (26) (these are pMV100 derivatives and contain the
ColE1 replicon), and AP activity was measured following expression in
the presence of IPTG.
Western analysis.
The entire open reading frame
(ORF)-encoding pro-K was cloned in a pET28b expression
vector (Novagen) such that the encoded pro-K protein was
fused to a polyhistidine tag at its C terminus. Pro-K
was expressed in E. coli [strain BL21-(DE3)], and
polyclonal antisera was raised in rabbits. For Western blotting,
(NH4)2SO4-precipitated sera were
preadsorbed with E. coli lysates prepared from BL21 (DE3)
pLysS and then used at a 1:5,000 dilution. Anti-rabbit horseradish peroxidase antibody conjugate was used at a dilution of 1:2,000. Reactive antibodies were visualized by using the ECL Western blotting system (Amersham).
| |
RESULTS |
Topology of the SpoIVFA and SpoIVFB polypeptides.
To define
the topology of both SpoIVFA and SpoIVFB, we used the analysis of
chimeric SpoIVF proteins fused to the E. coli AP protein
(encoded by phoA) or -galactosidase (encoded by
lacZ). This strategy for determining protein topology in
membranes has been validated for a large number of membrane proteins
and is based on the observation that AP is rendered active when
exported across a phospholipid bilayer, while it remains inactive if
retained in the cytoplasm. Conversely, LacZ is active when retained in the cytoplasm and is inactivated if transported across the membrane (15, 17).
To construct chimeric genes that express SpoIVFA or SpoIVFB fused to AP
or LacZ, we first cloned defined segments of
spoIVFA or
spoIVFB in an
E. coli plasmid. Our constructions
provided an
IPTG-inducible promoter (
Pspac) to drive
expression of the
B. subtilis gene in
E. coli.
Next, we subcloned these constructs
into the
E. coli plasmid
pMV100 (
6), which contains the
phoA gene, or
pJBZ280, which contains
lacZ, such that an in-frame fusion
between
spoIVFA-spoIVFB and
phoA or
lacZ was
created.
Expression of chimeric gene-AP was confirmed by Western blotting of
E. coli cells with an anti-PhoA monoclonal serum. In total,
we constructed four SpoIVFA-AP fusions and eight SpoIVFB-AP fusions;
their positions are shown in Fig.
1 and
2, respectively.
Since activity of the SpoIVFA-SpoIVFB processing complex has been
proposed to be temperature sensitive (
5), we analyzed
AP
activity at both 30 and 37°C and in solid and liquid media.
For
SpoIVFA at either 30 or 37°C, we found that the three AP fusions
lying downstream of the single, putative transmembrane sequence
of
SpoIVFA (residues 73 to 90) were blue on agar plates containing
the AP
substrate BCIP, indicating that AP was active (Table
1).
This was confirmed by growth in LB
medium, where the level of
AP-specific activity was 100 times greater
than that in cells
containing no fusion. In contrast, the one
SpoIVFA-AP fusion (S72)
which was white on a BCIP agar plate produced
essentially no activity
in liquid. The
spoIVFA-lacZ at S72
fusion was positive for
-galactosidase
(see Table
3), complementing
the negative
spoIVFA-AP S72 fusion.
This demonstrated that
the N terminus of SpoIVFA is in the cytoplasm
and the C terminus of
SpoIVFA transverses a phospholipid bilayer
with at least 164 residues
(residues 100 to 264) of SpoIVFA being
exported to the outer face.
Presumably, the hydrophobic sequence
of amino acids (residues 73 to 90)
anchors SpoIVFA in the phospholipid
bilayer.
For SpoIVFB, our analysis showed that at either 30 or 37°C (Table
2) only two SpoIVFB-AP fusions were
active, those with
AP fused at A32 and L180. The available SpoIVFB-LacZ
data (Table
3) complemented the
SpoIVFB-AP data. The additional fusion of
SpoIVFB-LacZ A273 was also
positive, clearly positioning the C
terminus of SpoIVFB in the
cytoplasm. The membrane configuration
predicted from this data is that
of four transmembrane-spanning
domains (4-transmembrane configuration),
consisting of four transmembrane
anchors, as shown in Fig.
3. In
B. subtilis, this
four-transmembrane
conformation would dictate that both the N and C
termini of SpoIVFB
are positioned in the mother cell chamber of the
sporulating cell,
as shown in Fig.
3.
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 3.
Membrane topology of processing complex. (A) Shows the
6-transmembrane configuration of SpoIVFB found in the absence of
SpoIVFA. (B) Shows the 6-transmembrane configuration assumed by SpoIVFB
in the presence of SpoIVFA. (C) Shows the conformation of the
pro-K processing complex comprising SpoIVFA, BofA, and
the putative protease, SpoIVFB, deduced from this work and that of
Varcamonti et al. for BofA topology (26). Hydrophobic
membrane-spanning segments (H1 to H6) are numbered where appropriate,
and the putative Zn2+-binding domain of the SpoIVFB
Zn2+ metalloprotease is shown.
|
|
Membrane topology of the putative K protease is
stabilized by SpoIVFA and BofA.
Since the putative
pro-K processing enzyme, SpoIVFB, is thought to form a
hetero-oligomeric complex together with SpoIVFA and BofA proteins
(5), we coexpressed SpoIVFB-AP fusions with SpoIVFA and BofA.
To accomplish this, we constructed a further series of
E. coli expression vectors where the complete
spoIVF
operon was cloned
adjacent to an
E. coli-recognized and
IPTG-inducible promoter,
Pspac, and with
phoA
fused at eight positions to the
spoIVFB ORF.
Apart from the
C-terminal
phoA fusion and the
Pspac promoter,
the
spoIVFA and
spoIVFB cistrons were identical
in structure to
that of the native operon. This is important since the
spoIVFA and
spoIVFB ORFs overlap and it has been
proposed that these cistrons
are translationally coupled to ensure the
correct stoichiometric
balance of the SpoIVFA and SpoIVFB polypeptides
during sporulation
(
5). Analysis of SpoIVFB-AP activity in
the presence of SpoIVFA
revealed that at either 30 or 37°C the Q112
SpoIVFB-AP fusion
produced active AP in both liquid and solid media
(Table
2).
Since the Q112 SpoIVFB-AP was inactive in the absence of
SpoIVFA,
we suggest that SpoIVFB, in the presence of SpoIVFA, can
assume
a 6-transmembrane configuration (Fig.
3), requiring six
transmembrane
anchors in the phospholipid bilayer. Interestingly, the
E106 and
I125 AP insertions, constructed to map the boundaries of the
transmembrane-spanning
regions surrounding Q112, did not show AP
activity. This suggests
that the transmembrane domains H3 and H4 are
clustered closer
together than previously predicted (
5), and
hence, the AP moiety
was not being efficiently translocated. Our data
show that SpoIVFB
assumes a 6-transmembrane configuration, which agrees
with the
computer-generated topological model of SpoIVFB proposed
previously
(
5). Importantly, our results show that this
conformation is
dependent upon the presence of
SpoIVFA.
Next, we coexpressed these eight SpoIVFA-SpoIVFB-AP fusions together
with the third member of the pro-
K processing complex,
BofA. To achieve simultaneous expression
of BofA, we used a second
autonomously replicating plasmid (with
a p15A replicon) containing the
bofA gene under the control of
the
Pspac promoter
(see Materials and Methods). As shown in Table
2, coexpression of BofA
at 30 or 37°C resulted in the 6-transmembrane
configuration of
SpoIVFB. In each case, we observed that the relative
levels of AP
activity were greater (>2-fold) in the presence of
BofA than in its
absence. Since different plasmid replicons were
used to express
bofA and the
spoIVFA-spoIVFB-phoA genes, we can
not state that the stoichiometric levels of BofA, SpoIVFA, and
SpoIVFB
were balanced or equivalent to that which might be expected
in
B. subtilis. However, our results do suggest that BofA promotes
the
6-transmembrane configuration of
SpoIVFB.
We also coexpressed BofA in
E. coli together with the eight
SpoIVFB-AP fusions but in the absence of SpoIVFA. Although, as
mentioned above, we cannot assume equivalent stoichiometric levels
of
BofA and SpoIVFA as in
B. subtilis, coexpression of BofA did
appear to promote the 6-transmembrane configuration of SpoIVFB
at 30 but not at 37°C (Table
2).
Coexpression of BofA with SpoIVFA-AP fusions resulted in enhanced
levels of AP activity of the AP-positive fusions. This result,
as with
the coexpression of BofA with SpoIVFB, shows that BofA
has a positive
effect on the assembly of SpoIVFA and SpoIVFB.
Anti-PhoA Western
blotting demonstrated that coexpression of BofA
with SpoIVFA-PhoA did
not show an enhanced accumulation of the
SpoIVFA-PhoA chimeras,
compared to the expression of SpoIVFA-PhoA
chimeras alone (data not
shown). This may suggest that BofA enhances
the PhoA activity by aiding
the translocation and assembly of
SpoIVFA into the membrane, not the
accumulation of total chimeric
protein. Resnekov (
19) has
shown in vegetative
B. subtilis cells
that BofA enhances the
accumulation of SpoIVFA by preventing its
degradation. The disparity
between these two results may be because
the PhoA moiety artificially
protects SpoIVFA from degradation
when BofA is not
present.
The membrane topology of BofA has been established in
E. coli and predicts that in
B. subtilis two transmembrane
segments
project the hydrophobic C terminus of BofA into the space
between
the IFM and OFM (Fig.
3). Although no temperature-sensitive
alleles
have been identified in
bofA, it is possible that
BofA is also
unstable. Such instability might, for example, prevent the
C terminus
of BofA from transversing the membrane. We asked whether the
SpoIVFA
and/or SpoIVFB polypeptides affect the topology of BofA. By
coexpressing
either SpoIVFB or SpoIVFA and SpoIVFB with each of four
BofA-AP
fusions used in the study of Varcamonti et al. (
26),
we were
unable to detect any change in the topology of BofA in
E. coli membranes (data not shown). We conclude that BofA topology is
intrinsically stable and is independent of the products of the
spoIVF operon.
Functional domains of SpoIVFA.
Previous genetic
experimentation has suggested that SpoIVFA has two functions
(5): positively, to stabilize SpoIVFB in the membrane and,
negatively, to inhibit the proteolytic activity of SpoIVFB until the
appropriate signal (SpoIVB) is received from the forespore chamber.
Data, as presented in this paper, show that SpoIVFA is required to
stabilize the 6-transmembrane configuration of SpoIVFB.
To examine the positive function of SpoIVFA, we constructed plasmid
vectors where a modified
spoIVF operon was fused to AP
in
three positions. AP was fused to
spoIVFB at positions A32,
Q112, and L180. In each case, the
spoIVFA cistron contained
an
in-frame deletion of codons 100 to 264 (
spoIVFA164).
This construct
was expressed by using the
Pspac promoter and
would encode a polypeptide
of 100 residues, including the hydrophobic
transmembrane sequence
(residues 73 to 90). Analysis of these
SpoIVFA
164-SpoIVFB-AP
fusions in the presence of BofA in
E. coli (Table
2) revealed
that SpoIVFB assumed a 6-transmembrane
configuration. This shows
that to stabilize SpoIVFB in a
6-transmembrane configuration,
only the first 100 amino acids of
SpoIVFA are required. Since
these residues are exposed to the inner
face of the membrane,
this stabilization may require interaction
between the N-terminal
SpoIVFA domain in the cytoplasm and the
hydrophobic transmembrane
region.
To further limit the region of SpoIVFA required for stabilization of
SpoIVFB, we created two more deletions of
spoIVFA,
spoIVFA91 and
spoIVFA67. To achieve this,
we used the three
spoIVFA-spoIVFB-AP fusions at positions
A32, Q112, and L180 and constructed an in-frame
deletion of
spoIVFA between residues 1 and 92 (
spoIVFA91),
deleting
the transmembrane region, and an in-frame deletion of
spoIVFA between residues 3 and 70 (
spoIVFA67),
which retains the transmembrane
region and the C terminus of
spoIVFA. The truncated SpoIVFA
91
product produced was
unable to transverse or translocate the membrane.
AP activity in the
three strains (Table
2) showed that SpoIVFB
assumed a 4-transmembrane
configuration at either 30 or 37°C.
Conversely, the SpoIVFA
67
product was able to translocate the
membrane, and all three of the
SpoIVFB-AP fusions were positive
at 30 and 37°C (Table
2). This
indicates that SpoIVFB assumes
a 6-transmembrane configuration. These
results show, first, that
the insertion of SpoIVFA through the membrane
is required for
the 6-transmembrane configuration of SpoIVFB and,
second, that
the transmembrane domain of SpoIVFA (residues 72 to 90) is
primarily
responsible for the stabilization of the 6-transmembrane
configuration
of
SpoIVFB.
The proposed negative function of SpoIVFA stems from the observation
that
bofB alleles in the extreme C terminus of SpoIVFA
allow
constitutive activity of SpoIVFB (
5). This disruption
of the
SpoIVFA C terminus may allow premature access of the signalling
molecule to the SpoIVFB protease, allowing SpoIVFB to be responsive
to
the forespore-derived signal or simply promote a conformational
change in SpoIVFB, rendering it active. Since our work has shown
that SpoIVFB can assume at least two quite distinct conformations
in
the membrane, we asked what topological conformation SpoIVFB
would
assume in the presence of SpoIVFA carrying a
bofB8 allele
(a
nonpolar, nonsense mutation at codon 259 of
spoIVFA). In
other
words, is the change of SpoIVFB from a 6-transmembrane
configuration
to a 4-transmembrane configuration the mechanism
responsible for
activating pro-
K processing? We used
three pMV100-derived plasmids containing
the
spoIVF operon
carrying the
bofB8 allele fused to
Pspac and
with
phoA fused after codons 106, 112, and 125 of SpoIVFB.
Analysis
of these fusions in
E. coli revealed that SpoIVFB
assumes a 6-transmembrane
configuration at both 30 and 37°C, since
the Q112-AP fusion was
active and must therefore be exported to the
outer face of the
phospholipid bilayer (Table
2). These results imply,
but do not
prove, that disruption of the C terminus of SpoIVFA while
producing
a Bof phenotype (constitutive processing of
pro-
K) does not lead to a detectable conformational
change in
SpoIVFB.
Temperature sensitivity.
Two spoIVFA mutations
exist which are temperature sensitive (4):
spoIVFA181, which is a nonsense allele at codon 100 and truncates the C terminus of SpoIVFA, and spoIVFA91, which
encodes SpoIVFA with an in-frame deletion of residues 2 to 92. Both
alleles are Spo+ at 30°C but render cells
Spo
at 37°C. SpoIVFA181 would contain the hydrophobic
transmembrane sequence at positions 73 to 90 and so, like the Q100
SpoIVFA-AP fusion polypeptide (see above), should target and insert
into a membrane. In contrast, SpoIVFA91 lacks the membrane-targeting sequence, and the C-terminal fragment of SpoIVFA encoded by this truncated gene and which would normally be translocated across the
membrane should remain in the cytoplasm. We have described above that
SpoIVFB assumes a 6-transmembrane configuration in the presence of the
spoIVFA164 deletion (Table 2), this truncation being
similar to the spoIVFA181 nonsense allele. In contrast, the
spoIVFA91 deletion mutant, by encoding a form of SpoIVFA unable to associate with the membrane, prevents the formation of the
6-transmembrane configuration in SpoIVFB (Table 2). Since both
the spoIVFA181 and spoIVFA91 mutants
support sporulation at a permissive temperature, it must follow that
both membrane configurations (four and six) are able to facilitate
pro-K processing.
To address this, we examined processing of the transcription factor
pro-
K in sporulating cells of
spo+,
spoIVFA181, and
spoIVFA91 strains at 30 and 37°C. We found
that at both
the permissive and restrictive temperatures, very
little levels of
pro-
K processing occurred as determined from Western
blotting in the
spoIVFA mutants (Fig.
4). In contrast, spore formation was
reduced
only 10-fold at the permissive temperature (Table
4). Since spores
are produced in
significant numbers at 30°C, we inferred that
some
K
must be produced by proteolysis of pro-
K, but this is
not or is just detectable by immunoblotting (Fig.
4). We also examined
pro-
K processing in a double mutant,
spoIVFA91
bofA::erm (Fig.
4).
Here again, pro-
K
processing cannot be detected, but at 30°C the strain is
Spo
+.
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
Pro-K processing in temperature-sensitive
spoIVF strains. Sporulation was induced by resuspension at
30 and 37°C in strains PY79 (spo+), VO138
(spoIVFA91), SC1256 (spoIVFA181), SC1257
(spoIVFB587), DG675 (spoIVFA91
bofA::erm), SC1363 (spoIVFA91
spoIVFBVM207), SC1365 (spoIVFA91
spoIVFBLV221), SC1358 (spoIVFA91
spoIVFBVI235), and SC1366 (spoIVFA91 spoIVFBAV273).
Samples were collected at hourly intervals (0 to 6) after the
initiation of sporulation. Whole-cell extracts were prepared and
analyzed with a polyclonal anti-pro-K serum. The
unprocessed (p) and processed (m) forms of K are
indicated by the bars. Occasionally, three bands were seen, the upper
band being a nonspecific species caused by inadequate blocking.
|
|
It has been reported that some
K-controlled genes are
susceptible to very low threshold levels of
K
(
14). In turn, it must also follow that the
pro-
K processing complex is active in the absence of the
C terminus
of SpoIVFA (in
spoIVFA181 cells) as well as in
the complete absence
of the SpoIVFA protein in the membrane (in
spoIVFA91 cells) and
SpoIVFA and BofA (in
spoIVFA91 bofA::erm cells). From our
E. coli topological analysis, we predict that in
spoIVFA181 cells
SpoIVFB assumes a 6-transmembrane
configuration, while in
spoIVFA91 and
spoIVFA91
bofA::erm cells, it assumes only a 4-transmembrane
configuration. Interestingly, the complete absence of SpoIVFA
in the
membrane (i.e., in a
spoIVFA91 mutant) can be relieved
by
compensatory mutations in SpoIVFB. Four intragenic suppressor
alleles
have been identified which mutate residues 207, 221, 235,
and 273, bypass the temperature sensitivity of a
spoIVFA91 mutant,
and have been reported briefly in an earlier work (
5). Here
we show that pro-
K processing of these mutants at 37°C
is clearly restored, albeit
at perhaps a slower rate than the wild type
(Fig.
4). These missense
alleles all lie within the C-terminal segment
of SpoIVFB, which
would be exposed to the mother cell chamber of the
sporangial
cell and may define a domain (between residues 207 and 273)
that
is required to interact with SpoIVFA. Supporting this, one
temperature-sensitive
allele,
spoIVFB587, has been
identified in this region (at position
226, producing a Pro to Leu
change [
5]). We found here that
sporulation in
spoIVFB587 cells was reduced 10-fold, and
pro-
K processing was reduced at the nonpermissive
temperature (Table
4 and Fig.
4).
| |
DISCUSSION |
We have investigated the topology of the SpoIVFA and SpoIVFB
polypeptides in a phospholipid membrane with the aim of defining the
location and functional domains of the pro-K processing
complex in B. subtilis. Our analysis has used an established method for topological analysis by using expression of
gene-phoA and, to a lesser extent, gene-lacZ
fusions in E. coli and analysis of AP and -galactosidase
activity encoded by the chimeric gene. At the outset, we must stress
that any conclusions we draw are subject to the possibility, however
remote, that the protein topology may be different in the outer
forespore membranes of B. subtilis.
The most important finding from this work is that SpoIVFA is required
to stabilize SpoIVFB, as is BofA, but to a lesser degree. This work
shows that SpoIVFB, the putative zinc metalloprotease which cleaves
pro-K, can assume two distinct conformations in a
phospholipid membrane which we have referred to as the 4- or
6-transmembrane configurations. This may imply that SpoIVFB is
intrinsically unstable, and in turn, this may be important for the
signalling process. In the presence of SpoIVFA, SpoIVFB can integrate
with six transmembrane segments, while in the absence of SpoIVFA,
SpoIVFB is anchored by four transmembrane segments (Fig. 3). As a
6-transmembrane configuration, the topology of SpoIVFB and SpoIVFA is
consistent with the topology predicted from a computer-based analysis
of SpoIVFA-SpoIVFB (4).
A previous work, using a similar approach as that described here, has
also defined the topology of the third member of the pro-K processing complex, BofA (26). This
topology (shown in Fig. 3) shows that the small BofA protein anchors to
the membrane with two transmembrane anchors, with its C and N termini
exposed to the outer face of the membrane. With the obvious caveat
mentioned above, we can propose a topological model (shown in Fig. 3)
for the pro-K processing complex in the OFM of the
developing spore (or forespore) comprising the three protein components
of the complex (note that in this model the space between the IFM and
OFM is equivalent to the periplasmic space of E. coli).
Characterization of the spoIVF-AP fusions has allowed us
to further refine the domain functions of SpoIVFA and SpoIVFB.
Analysis of SpoIVFB-AP gene products in the presence of three
different truncated forms of SpoIVFA (spoIVFA164,
spoIVFA91, and spoIVFA67) has revealed that
the transmembrane region of SpoIVFA (residues 73 to 90) is the primary
determinant for stabilizing SpoIVFB in the 6-transmembrane
configuration. A deletion of either the C-terminal (SpoIVFA164) or
N-terminal (SpoIVFA67) domain of SpoIVFA did not disrupt the
6-transmembrane configuration of SpoIVFB. A deletion of the N-terminal
and transmembrane-spanning region did result in a loss of stability of
SpoIVFB, producing a 4-transmembrane configuration. Because
SpoIVFBQ112-AP was the only fusion profoundly affected by the presence
or absence of SpoIVFA, it is possible that the transmembrane domain of
SpoIVFA interacts with the third transmembrane domain (H3) of SpoIVFB.
The observation that SpoIVFB had two distinct membrane conformations
lead us to believe initially that a conformational change from a 6- to
4-transmembrane configuration might be involved in the activation of
SpoIVFB proteolytic activity. To this end, we asked whether the
bofB8 allele, which uncouples the K
checkpoint by allowing constitutive processing of pro-K,
might cause a change to the membrane topology of SpoIVFB. Analysis of
the three AP fusions positioned between H3 and H4 showed no change in
activity when the C-terminal tip of SpoIVFA was deleted (BofB8). This
indicated, but does not rule out the possibility, that in vivo
activation of SpoIVFB does not involve a change in its membrane
topology from six- to four-transmembrane domains.
What then is the significance of this apparent instability of SpoIVFB
and its reliance on the presence of SpoIVFA to stabilize it? Does this
simply imply that in vivo SpoIVFB requires an additional protein
(SpoIVFA) to stabilize it, or does the instability of SpoIVFB implicate
that this fluid or flexible region is important in transducing the
forespore signal?
In terms of the biological significance of the two SpoIVFB topologies,
spores can be produced when SpoIVFB is in its 4-transmembrane configuration. We have found that at 30°C in spoIVFA181
(6-transmembrane configuration), spoIVFA91, and
spoIVFA91 bofA::erm (4-transmembrane configuration) temperature-sensitive mutants, spores are produced, but
very low levels of pro-K processing were observed. If
our topological model is correct, then we predict that in both the
configurations SpoIVFB is proteolytically active, albeit at very low
levels. We cannot exclude the possibility, however, that in
spoIVFA91 and spoIVFA91 bofA::erm
cells at the nonpermissive temperature a low number of SpoIVFB
molecules are able to assume the 6-transmembrane configuration
sufficient to process pro-K.
In B. subtilis development, pro-K is
synthesized in the outer (mother cell) chamber of the sporulating cell.
The proteolytic processing complex is activated by receipt of the
forespore signalling (the SpoIVB protein), which is synthesized in the
opposed forespore chamber and is thought to be secreted through the
IFM, where it then initiates processing of pro-K.
Substantial evidence now exists that SpoIVFB is the processing enzyme,
and a zinc-binding site has been identified (12) along with
the putative third active residue, aspartate-137 (D137), by
ourselves and others (L. Kroos, personal communication; D. Rudner and
R. Losick, personal communication). Site-directed mutagenesis has also
shown that E44 and D137 are both critical to
processing of pro-K in vivo (L. Kroos, personal
communication; D. Rudner and R. Losick, personal communication). Our
topological analysis identifies both active residues to be located in
transmembrane domains H2 and H4, respectively. The significance of the
positioning of these residues, and the location of the catalytic site,
may make sense since pro-K localizes to the membrane
(28), where the cleavage site could be positioned in close
proximity to the putative catalytic site of SpoIVFB. SpoIVFB has
recently been assigned to a new and novel group of zinc
metalloproteases that characteristically cleave their substrate at the
cytosolic membrane face (10). From these studies, H2 and H4
would form a membrane pocket which could initiate cleavage of
pro-K.
How is SpoIVFB rendered active? The intrinsic instability of this
molecule and its apparent membrane fluidity suggest that it could alter
its conformation in the presence of pro-K and also in
response to the forespore signalling molecule, SpoIVB. Perhaps we can
not measure such a minute change experimentally, but we have evidence
that this is at least a possibility.
| |
ACKNOWLEDGMENTS |
We thank Lee Kroos for the gift of plasmids pSL13, pSL14, and
pSL31 and helpful comments prior to publication, Margerita Sacco for
the gift of plasmids containing the bofA-phoA constructs, Dickon Alley for the lacZ-containing plasmid pJBZ280, and
Phil Wakeley for making the K antibody.
This work was supported by grants from the MRC and BBSRC to S.M.C.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: School of
Biological Sciences, Royal Holloway University of London, Egham, Surrey
TW20 0EX, United Kingdom. Phone: 44-1784-443760. Fax: 44-1784-434326. E-mail: s.cutting{at}rhbnc.ac.uk.
| |
REFERENCES |
| 1.
|
Alexeyev, M. F., and H. H. Winkler.
1999.
Membrane topology of the Rickettsia prowazekii ATP/ADP translocase revealed by novel dual pho-lac reporters.
J. Mol. Biol.
285:1503-1513[CrossRef][Medline].
|
| 2.
|
Brockman, R. W., and L. A. Heppel.
1968.
On the localisation of alkaline phosphatase and cyclic phosphodiesterase in Escherichia coli.
Biochemistry
7:2554-2562[CrossRef][Medline].
|
| 3.
|
Cutting, S.,
A. Driks,
R. Schmidt,
B. Kunkel, and R. Losick.
1991.
Forespore-specific transcription of a gene in the signal transduction pathway that governs pro-K processing in Bacillus subtilis.
Genes Dev.
5:456-466[Abstract/Free Full Text].
|
| 4.
|
Cutting, S.,
V. Oke,
A. Driks,
R. Losick,
S. Lu, and L. Kroos.
1990.
A forespore checkpoint for mother cell gene expression during development in B. subtilis.
Cell
62:239-250[CrossRef][Medline].
|
| 5.
|
Cutting, S.,
S. Roels, and R. Losick.
1991.
Sporulation operon spoIVF and the characterization of mutations that uncouple mother-cell from forespore gene expression in Bacillus subtilis.
J. Mol. Biol.
221:1237-1256[Medline].
|
| 6.
|
Gutierrez, C., and J. C. Devedjian.
1989.
A plasmid facilitating in vitro construction of phoA gene fusions in Escherichia coli.
Nucleic Acids Res.
17:3999[Free Full Text].
|
| 7.
|
Harwood, C. R., and S. M. Cutting.
1990.
Molecular biological methods for Bacillus.
John Wiley & Sons Ltd., Chichester, United Kingdom.
|
| 8.
|
Ireton, K., and A. D. Grossman.
1994.
A developmental checkpoint couples the initiation of sporulation to DNA replication in Bacillus subtilis.
EMBO J.
13:1566-1573[Medline].
|
| 9.
|
Kroos, L.,
B. Zhang,
H. Ichikawa, and Y.-T. Nicco Yu.
1999.
Control of factor activity during Bacillus subtilis.
Mol. Microbiol.
31:1285-1294[CrossRef][Medline].
|
| 10.
|
Lewis, A. P., and P. J. Thomas.
1999.
A novel clan of zinc-metalloproteases with possible intramembrane cleavage properties.
Protein Sci.
8:439-442[Medline].
|
| 11.
|
Losick, R., and P. Stragier.
1992.
Crisscross regulation of cell-type-specific gene expression during development in B. subtilis.
Nature
355:601-604[CrossRef][Medline].
|
| 12.
|
Lu, S.,
S. Cutting, and L. Kroos.
1995.
Sporulation protein SpoIVFB from Bacillus subtilis enhances processing of the sigma factor precursor pro-K in the absence of other sporulation gene products.
J. Bacteriol.
177:1082-1085[Abstract/Free Full Text].
|
| 13.
|
Lu, S.,
R. Halberg, and L. Kroos.
1990.
Processing of the mother-cell factor, K, may depend on events occurring in the forespore during Bacillus subtilis development.
Proc. Natl. Acad. Sci. USA
87:9722-9726[Abstract/Free Full Text].
|
| 14.
|
Lu, S., and L. Kroos.
1994.
Overproducing the Bacillus subtilis mother cell sigma factor precursor, pro-K, uncouples K-dependent gene expression from dependence on intercompartmental communication.
J. Bacteriol.
176:3936-3943[Abstract/Free Full Text].
|
| 15.
|
Manoil, C.
1990.
Analysis of protein localization by use of gene fusions with complementary properties.
J. Bacteriol.
172:1035-1042[Abstract/Free Full Text].
|
| 16.
|
Manoil, C., and J. Beckwith.
1985.
TnphoA: a transposon probe for protein export signals.
Proc. Natl. Acad. Sci. USA
82:8129-8133[Abstract/Free Full Text].
|
| 17.
|
Manoil, C., and J. Beckwith.
1986.
A genetic approach to analyzing membrane protein topology.
Science
233:1403-1408[Abstract/Free Full Text].
|
| 18.
|
Nicholson, W. L., and P. Setlow.
1990.
Sporulation, germination and outgrowth, p. 391-450.
In
C. R. Harwood, and S. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley & Sons Ltd., Chichester, United Kingdom.
|
| 19.
|
Resnekov, O.
1999.
Role of the sporulation protein BofA in regulating activation of the Bacillus subtilis developmental transcription factor K.
J. Bacteriol.
181:5384-5388[Abstract/Free Full Text].
|
| 20.
|
Resnekov, O.,
S. Alper, and R. Losick.
1996.
Subcellular localization of proteins governing the proteolytic activation of a developmental transcription factor in Bacillus subtilis.
Genes Cells
1:529-542[Abstract].
|
| 21.
|
Resnekov, O., and R. Losick.
1998.
Negative regulation of the proteolytic activation of a transcription factor in Bacillus subtilis.
Proc. Natl. Acad. Sci. USA
95:3162-3167[Abstract/Free Full Text].
|
| 22.
|
Ricca, E.,
S. Cutting, and R. Losick.
1992.
Characterization of bofA, a gene involved in intercompartmental regulation of pro-K processing during sporulation in Bacillus subtilis.
J. Bacteriol.
174:3177-3184[Abstract/Free Full Text].
|
| 23.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 24.
|
Stragier, P.,
C. Bonamy, and C. Karmazyn-Campbelli.
1988.
Processing of a sporulation sigma factor in Bacillus subtilis: how morphological structure could control gene expression.
Cell
52:697-704[CrossRef][Medline].
|
| 25.
|
Vagner, V.,
E. Dervyn, and S. D. Ehrlich.
1998.
A vector for systematic gene inactivation in Bacillus subtilis.
Microbiology
144:3097-3104[Abstract/Free Full Text].
|
| 26.
|
Varcamonti, M.,
R. Marasco,
M. De Felice, and M. Sacco.
1997.
Membrane topology analysis of the Bacillus subtilis BofA protein involved in pro-K processing.
Microbiology
143:1053-1058[Abstract/Free Full Text].
|
| 27.
|
Youngman, P.,
J. Perkins, and R. Losick.
1984.
Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene.
Plasmid
12:1-9[CrossRef][Medline].
|
| 28.
|
Zhang, B.,
A. Hofmeister, and L. Kroos.
1998.
The prosequence of pro-K promotes membrane association and inhibits RNA polymerase core binding.
J. Bacteriol.
180:2434-2441[Abstract/Free Full Text].
|
Journal of Bacteriology, January 2000, p. 278-285, Vol. 182, No. 2
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Serrano, M., Vieira, F., Moran, C. P. Jr., Henriques, A. O.
(2008). Processing of a Membrane Protein Required for Cell-to-Cell Signaling during Endospore Formation in Bacillus subtilis. J. Bacteriol.
190: 7786-7796
[Abstract]
[Full Text]
-
Patterson, H. M., Brannigan, J. A., Cutting, S. M., Wilson, K. S., Wilkinson, A. J., AB, E., Diercks, T., de Jong, R. N., Truffault, V., Folkers, G. E., Kaptein, R.
(2005). The Structure of Bypass of Forespore C, an Intercompartmental Signaling Factor during Sporulation in Bacillus. J. Biol. Chem.
280: 36214-36220
[Abstract]
[Full Text]
-
Prince, H., Zhou, R., Kroos, L.
(2005). Substrate Requirements for Regulated Intramembrane Proteolysis of Bacillus subtilis Pro-{sigma}K. J. Bacteriol.
187: 961-971
[Abstract]
[Full Text]
-
Friedmann, E., Lemberg, M. K., Weihofen, A., Dev, K. K., Dengler, U., Rovelli, G., Martoglio, B.
(2004). Consensus Analysis of Signal Peptide Peptidase and Homologous Human Aspartic Proteases Reveals Opposite Topology of Catalytic Domains Compared with Presenilins. J. Biol. Chem.
279: 50790-50798
[Abstract]
[Full Text]
-
Hilbert, D. W., Piggot, P. J.
(2004). Compartmentalization of Gene Expression during Bacillus subtilis Spore Formation. Microbiol. Mol. Biol. Rev.
68: 234-262
[Abstract]
[Full Text]
-
Zhou, R., Kroos, L.
(2004). BofA protein inhibits intramembrane proteolysis of pro-{sigma}K in an intercompartmental signaling pathway during Bacillus subtilis sporulation. Proc. Natl. Acad. Sci. USA
101: 6385-6390
[Abstract]
[Full Text]
-
Pan, Q., Losick, R., Rudner, D. Z.
(2003). A Second PDZ-Containing Serine Protease Contributes to Activation of the Sporulation Transcription Factor {sigma}K in Bacillus subtilis. J. Bacteriol.
185: 6051-6056
[Abstract]
[Full Text]
-
Diaz, A. R., Mansilla, M. C., Vila, A. J., de Mendoza, D.
(2002). Membrane Topology of the Acyl-Lipid Desaturase from Bacillus subtilis. J. Biol. Chem.
277: 48099-48106
[Abstract]
[Full Text]
-
Kroos, L., Yu, Y.-T. N., Mills, D., Ferguson-Miller, S.
(2002). Forespore Signaling Is Necessary for Pro-{sigma}K Processing during Bacillus subtilis Sporulation Despite the Loss of SpoIVFA upon Translational Arrest. J. Bacteriol.
184: 5393-5401
[Abstract]
[Full Text]
-
Rudner, D. Z., Pan, Q., Losick, R. M.
(2002). Evidence that subcellular localization of a bacterial membrane protein is achieved by diffusion and capture. Proc. Natl. Acad. Sci. USA
99: 8701-8706
[Abstract]
[Full Text]
-
Rudner, D. Z., Losick, R.
(2002). A sporulation membrane protein tethers the pro-sigma K processing enzyme to its inhibitor and dictates its subcellular localization. Genes Dev.
16: 1007-1018
[Abstract]
[Full Text]
-
Drew, D., Sjostrand, D., Nilsson, J., Urbig, T., Chin, C.-n., de Gier, J.-W., von Heijne, G.
(2002). Rapid topology mapping of Escherichia coli inner-membrane proteins by prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci. USA
10.1073/pnas.052018199v1
[Abstract]
[Full Text]
-
Hoa, N. T., Brannigan, J. A., Cutting, S. M.
(2002). The Bacillus subtilis Signaling Protein SpoIVB Defines a New Family of Serine Peptidases. J. Bacteriol.
184: 191-199
[Abstract]
[Full Text]
-
Hoa, N. T., Brannigan, J. A., Cutting, S. M.
(2001). The PDZ Domain of the SpoIVB Serine Peptidase Facilitates Multiple Functions. J. Bacteriol.
183: 4364-4373
[Abstract]
[Full Text]
-
Yu, Y.-T. N., Kroos, L.
(2000). Evidence that SpoIVFB Is a Novel Type of Membrane Metalloprotease Governing Intercompartmental Communication during Bacillus subtilis Sporulation. J. Bacteriol.
182: 3305-3309
[Abstract]
[Full Text]
-
Drew, D., Sjostrand, D., Nilsson, J., Urbig, T., Chin, C.-n., de Gier, J.-W., von Heijne, G.
(2002). Rapid topology mapping of Escherichia coli inner-membrane proteins by prediction and PhoA/GFP fusion analysis. Proc. Natl. Acad. Sci. USA
99: 2690-2695
[Abstract]
[Full Text]
Top
Abstract
Introduction
