Previous Article | Next Article ![]()
Journal of Bacteriology, January 2000, p. 522-525, Vol. 182, No. 2
Department of Parasitology, Tulane Regional
Primate Research Center, Tulane University Medical Center,
Covington, Louisiana
Received 16 July 1999/Accepted 27 October 1999
Previously, we have shown that the transcription of
p35, a lipoprotein gene of Borrelia
burgdorferi, is upregulated or initiated during the
post-logarithmic bacterial growth phase in vitro. To identify potential
regulatory factors, we examined the formation of DNA-protein complexes
by electromobility shift assay, using a 157-bp DNA fragment that spans
the p35 promoter region and cell-free extracts of
spirochetes harvested from both logarithmic and stationary growth
phases. The binding properties of the extracts with the promoter region
of the flaB gene, a constitutively expressed, growth-phase-independent gene, were also compared. The results from
these experiments demonstrate that B. burgdorferi
stationary-phase cell-free extracts have a growth-phase-dependent DNA
binding protein that interacts specifically with the p35
promoter region. We show, in addition, that a segment from the 157-bp
p35 promoter region which contains both a T-rich stretch
and an inverted repeat is able to compete off the
stationary-phase-specific complex when the segment is present in molar excess.
Borrelia burgdorferi, the
spirochete that causes Lyme disease, is able to survive in two very
dissimilar host environments: ixodid ticks, which act as its
transmission vector, and vertebrates such as rodents, which serve as
its most common reservoir host. It has been postulated that B. burgdorferi's adaptation to the tick and mammalian environments
likely involves the expression of different surface components
(12). In support of this hypothesis, several lipoproteins
have been identified whose expression varies depending on the
spirochete's milieu (3, 13, 18). Mechanisms of modulation
of lipoprotein expression are unknown in B. burgdorferi. An
inspection of the B. burgdorferi genome sequence revealed
few homologs of other bacterial regulatory proteins, including only two
response-regulator two-component systems (4). Only one DNA
binding activity which is specific for a region upstream of the
ospAB operon has been reported for B. burgdorferi
(10). The development of an in vitro model in which
regulatory mechanisms of differentially expressed proteins could be
easily studied is desirable as a first step toward dissecting B. burgdorferi gene regulation. The observations that B. burgdorferi is able to modulate gene expression in vitro in
response to changes in temperature (16, 17) and cell density
or growth phase (8, 11) could be further explored to develop
such a model. Previously, we demonstrated that the expression of P35,
P7.5, OspC, BmpD, and several unidentified B. burgdorferi
antigenic proteins is upregulated during post-logarithmic (post-log)
spirochetal growth (8, 11). This regulation was shown to
occur at the level of transcription for P35, P7.5, OspC, and BmpD
(8, 11). P35 was chosen to further investigate this phenomenon. It is possible that the alteration in the rate of transcription or transcriptional initiation is positively or negatively controlled by DNA binding proteins. To identify such potential regulatory factors, we investigated the formation of DNA-protein complexes by electromobility shift assays (EMSA) by using a DNA fragment that encompassed the p35 promoter region and
cell-free B. burgdorferi extracts that were harvested from
both log and stationary phases.
Low-passage isolates of B. burgdorferi B31 were routinely
grown in 1-liter bottles of BSK-H medium (Sigma Chemical Co., St. Louis, Mo.) supplemented with 10% heat-inactivated young rabbit serum
(Pel-Freez, Roger, Ark.), 7.5 µg of amphotericin per ml, 48 µg of
rifampin per ml, and 192 µg of phosphomycin per ml. Cultures were
incubated at 34°C in a trigas incubator set at 3% CO2,
5% O2, and the rest of N2. Spirochetes were
counted under a dark-field microscope. Approximately 1010
spirochetes were harvested from log-phase (106 cells/ml)
and stationary-phase cultures (108 cells/ml) and used to
prepare cell-free extracts for EMSA analysis. Cell-free extracts were
prepared as described by Margolis and Samuel (10), and their
protein concentrations were determined by the Bradford method
(1). EMSA were essentially carried out as described by
Chodosh (2). All EMSA presented herein were performed at
least twice with the same results. EMSA substrates containing the
p35 promoter region were generated by PCR with primer
sequences 5' CGCTCTAGAACTAGTGGATC 3' and 5'
GTAATTTATATTAATTAATAATTTTAATTACCC 3' and plasmid DNA from a
p35 clone described previously (8). PCRs were
performed at an annealing temperature of 45°C for 1 min, an extension
temperature of 72°C for 1 min, and a denaturation temperature of
94°C for 1 min for a total of 30 cycles. The DNA fragment that
contained the flaB promoter region was generated by PCR as
described previously (14). EMSA substrates were digested with appropriate restriction enzymes (New England Biolabs Inc., Beverly, Mass.) and labeled with digoxigenin (DIG)-11-ddUTP and terminal transferase (Boehringer Mannheim, Indianapolis, Ind.) according to the manufacturer's instructions. A typical binding reaction mixture consisted of 23 fmol of EMSA substrate, 2 µg of
nonspecific competitor DNA [poly(dI-dC); Sigma], 300 µg of bovine
serum albumin per ml (final concentration), 20 mM HEPES (pH 7.9), 40 mM
KCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and 7 µg of
cell-free extract in a final volume of 15 µl. The reaction mixture
was incubated for 15 min at 30°C, and the DNA-protein complexes were
resolved by electrophoresis through a nondenaturing 6% polyacrylamide
gel by using a high-ionic-strength Tris-glycine buffer (250 mM Tris-Cl,
1.9 M glycine, 10 mM EDTA, [pH 8.0]). During competitive binding
reactions, cell-free extracts were allowed to preincubate for 5 min at
room temperature with the corresponding competitor DNAs added prior to
the addition of labeled probe. Double-stranded competitor
oligonucleotides were generated by heating a mixture of equal molar
amounts of single-stranded complementary oligonucleotides at 95°C in
a Perkin-Elmer Cetus 9600 thermal cycler. Double-stranded competitor
oligonucleotides were then slowly annealed by allowing the thermal
cycler to ramp to 4°C over a 60-min period. Following
electrophoresis, resolved components were transferred from the gels to
positively charged nylon membranes, probed with an anti-DIG-alkaline
phosphatase-labeled antibody, and detected by chemiluminescence as
described by the manufacturer (Boehringer). Western blot analysis of
B. burgdorferi proteins was performed as described
previously (8).
A comparison of the results of the EMSA experiments performed with the
p35 promoter region with those of the EMSA experiments with
the constitutively expressed, growth-phase-independent flaB promoter region indicates that stationary-phase cell-free extracts contain a DNA binding activity that is specific for the p35
gene. In these experiments, a DIG-labeled 157-bp
BamHI-PacI p35 promoter probe (see
Fig. 2A) was used as a substrate for protein binding in the EMSA
reaction. This fragment includes several potential cis
elements which might be involved in DNA-protein interactions, such as a
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
DNA-Binding Proteins Possibly Involved in
Regulation of the Post-Logarithmic-Phase Expression of Lipoprotein P35
in Borrelia burgdorferi
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
10/
35 promoter region, a T-rich segment containing an area of dyad
symmetry, and a 32-bp AT-rich region. As a negative control for
nonspecific binding and growth-phase-independent binding activities, a
DIG-labeled 175-bp flaB promoter probe (14) was used as a substrate for protein binding in the EMSA reaction (Fig. 1A, lane 1). The flaB promoter
probe in the presence of both log-phase (Fig. 1A, lane 2) and
stationary-phase (Fig. 1A, lane 3) cell-free extracts generated a
shifted band pattern that consisted predominantly of an intense,
slow-migrating complex. The p35 promoter probe (Fig. 1A,
lane 4) in the presence of both log-phase (Fig. 1A, lane 5) and
stationary-phase (Fig. 1A, lane 6) cell-free extracts generated a
similar shifted band pattern as the flaB promoter probe,
except for an additional prominent, fast-migrating complex which was
contributed only by the stationary-phase cell-free extract. This
complex, designated CSS for stationary (-phase)-specific complex, appears to be specific for the p35 promoter region.
EMSA extracts were treated with proteinase K to verify that the shifted bands observed were the results of a DNA-protein interaction. In the
presence of 80 µg of proteinase K, the shifted band pattern was
altered such that CSS and the slow-migrating complex were no longer detectable (Fig. 1A, lane 7). The band observed in lane 7 is
believed to be the result of residual binding activity remaining after
incomplete proteinase K digestion. To insure that the alteration in
banding pattern observed in lane 7 was not due to the interference from
the presence of additional protein mass contributed by the proteinase
K, the same amount of heat-treated proteinase K (95°C for 10 min) was
added to a control EMSA reaction. The result shows that in the presence
of heat-treated proteinase K, the stationary-phase complex can be
observed (Fig. 1A, lane 8). Western blot analysis of P35 expression was
performed with the same log- and stationary-phase cell-free lysates
that were used for the EMSA analysis (Fig. 1B, lanes 1 and 2, respectively). The blot was incubated with monoclonal antibodies
specific for P35 (8) and flagellin (monoclonal antibody H9724); the latter was included to control for protein mass. The results confirm that the cultured spirochetes used to generate the
cell-free extracts were harvested at the appropriate growth phase,
i.e., the log-phase cells had not overgrown and begun synthesizing P35.
The data from both the EMSA and Western blot analyses suggest that the
expression of P35 positively correlates with the appearance of
CSS.

View larger version (39K):
[in a new window]
FIG. 1.
(A) EMSA analysis of the B. burgdorferi p35
and flaB promoter regions. Twenty-three femtomoles of the
175-bp DIG-labeled flaB promoter probe was electrophoresed
with no cell-free extract added (lane 1) or with 7 µg of extract from
spirochetes harvested in log phase (lane 2) or in stationary phase
(lane 3). Twenty-three femtomoles of the 157-bp DIG-labeled
BamHI-PacI p35 promoter probe was
electrophoresed with no cell-free extract added (lane 4), with 7 µg
of extract from spirochetes harvested in log phase (lane 5) or in
stationary phase (lane 6), or with 7 µg of stationary-phase extract
pretreated with 80 µg of proteinase K (lane 7) or heat-inactivated
proteinase K (lane 8). (B) Analysis of P35 expression by Western
immunoblotting of extracts from cultured spirochetes harvested at log
phase (lane 1) and stationary phase (lane 2). The same batches of log-
and stationary-phase spirochetes were used to generate cell-free
lysates for EMSA analysis. The blot was reacted with a monoclonal
antibody specific for P35 (8) and with the
flagellin-specific monoclonal antibody H9724. Molecular size markers
are indicated on the left.
Additional evidence that CSS is unique to the
p35 promoter region was demonstrated by EMSA competition
experiments with the flaB promoter sequence as a competitor.
The p35 promoter probe, in the presence of 50 M excess cold
p35 promoter sequence, is unable to generate the shifted
band pattern observed when the competitor is absent from the EMSA
reaction (Fig. 2B, lane 3). The
uncompeted shifted band pattern is shown in Fig. 2B, lane 2. The
p35 promoter probe, in the presence of 50 M excess
flaB promoter sequence, is still able to selectively bind
CSS (Fig. 2B, lane 4), further indicating that
CSS is unique to the p35 promoter region. Lane 1 in Fig. 2B shows the unbound DIG-labeled p35 probe. To
further localize the region of DNA sequence responsible for
CSS binding, small synthetic double-stranded
oligonucleotides reproducing different sections of the p35
promoter region were used as competitors in a series of EMSA
experiments (Fig. 2C). The results of these experiments show that a
43-bp segment that contains both a T-rich sequence and an inverted
repeat (K2; Fig. 2A) is involved in binding. The K2 fragment (5'
CTTGTACCCAAAGAGAGCGCATGCTCTCTTTTTTTTTGAATTC 3') was able to
selectively outcompete CSS from stationary-phase extracts
when the fragment was present in 100 M excess with respect to the
labeled probe (Fig. 2C, lane 5). The level of inhibition of
CSS binding obtained with K2 is comparable to that observed when a similar molar excess of the 157-bp unlabeled
BamHI-PacI p35 promoter probe was used
as competitor (Fig. 2C, lane 3). However, the p35 promoter
probe inhibited, in addition, the binding of the top band. The
inability of K2 to inhibit the top, slower-migrating nonspecific
complex further indicates that the formation of CSS is
the result of a sequence-specific interaction. The
35/
10 region (K3, 5' TGTACAATAACAATTTTGAATTAAAGTTATTAA 3') and the
sequence containing an AT-rich region (K1, 5'
GACACATTATTTAAATTTAATAATAATTAAAAAATAAGACC 3') are not
independently involved in the formation of DNA-protein complexes, as
evidenced by the probes' failure to effect competition when present in
100 M excess (Fig. 2C, lanes 4 [K3] and 6 [K1]).
|
In the present study, a growth-phase-dependent DNA binding protein was
detected by EMSA by using the p35 promoter region as a
binding substrate. Stationary-phase, but not log-phase, B. burgdorferi B31 cell-free extracts contain a DNA binding protein
that interacts specifically with the p35 promoter region.
This binding activity was selectively inhibited by the presence of a
100 M excess of a 43-bp fragment (K2) which contained two segments that
could be incriminated in regulatory activities: a T-rich section and an
inverted repeat (Fig. 2A). The K2 fragment is located between positions
39 and
81 relative to the p35 transcriptional start site. The location of the putative protein binding DNA sequence with
respect to the p35
10/
35 promoter region (6)
and the positive correlation between induction of p35
expression and detection of CSS binding suggest that the
protein(s) interacting with this sequence may activate transcription.
The
35 promoter region of the p35 gene is poorly defined,
and protein binding near this region could facilitate enhanced RNA
polymerase promoter binding. Such a mechanism may require direct
contact of the activator with RNA polymerase and/or may require
additional protein-protein interactions. Transcriptional activation is
a plausible mechanism whereby B. burgdorferi could control
gene expression. Thus far, only one other DNA-binding activity has been
reported for B. burgdorferi (10).
The identity of the protein(s) that binds to the upstream promoter
region of p35 cannot be inferred from our results. However, a T-rich region similar to that described herein was recently identified by Sohaskey et al. as a possible regulatory element in
B. burgdorferi (15). Through promoter deletion
analyses, these authors identified a T-rich region, located upstream of the ospA gene's
35 promoter region, which positively
influenced ospA transcription (15). Presence of
this T-rich region may be necessary but is not sufficient for
growth-phase-dependent regulation, for ospA is not regulated
by growth phase in vitro (11). On the other hand, it is
possible that the inverted repeat that is also present on the K2
fragment is, alone or in concert with the adjacent T-rich segment,
responsible for the observed DNA binding and the correlated
upregulation. Of the three additional genes which are regulated in a
growth-phase-dependent fashion whose DNA sequences are known, namely
p7.5, bmpD, and ospC, the first two
exhibit appropriately located regulatory cis elements, as
the one mentioned herein (Indest and Philipp, unpublished). p7.5 and bmpD both contain T-rich sequences
upstream from their
35 promoter regions, and bmpD, but not
p7.5, also has an inverted repeat in this region. On the
other hand, these elements are not easily identifiable in the promoter
region of the ospC gene. It is possible that other factors
or mechanisms other than the one we suggest here are involved in
growth-phase-dependent gene regulation. It is perhaps significant that
the 157-bp p35 promoter region contains a portion of a
putative integration host factor (IHF) binding site
(AAatATAAGACCTTG; consensus IHF binding site, WATCAA-N4-TTR) (7). The latter is located 79 bp upstream from the
transcription start site of p35. IHF is a multifunctional
DNA binding and bending protein which is found in bacteria and which
can mediate protein-protein and DNA-protein interactions. IHF has been
shown to positively modulate gene expression in the context of multiple
regulatory factors (5, 9). The mechanism by which IHF
modulates gene expression is poorly understood. It is assumed that this
protein acts as a molecular scaffold of sorts, configuring the DNA in a
manner that facilitates the assembly of other protein-DNA complexes (5). AT-rich elements are associated with IHF binding sites and are thought to increase binding of IHF to its target sequence (7). Recently, a gene was isolated from B. burgdorferi which encodes a protein that is homologous to members
of the IHF/histone utilization family of E. coli proteins
(19).
Currently, we are trying to further characterize the DNA binding activity identified herein. Attempts at cloning this DNA binding activity by screening B. burgdorferi genomic DNA expression libraries with appropriate DNA probes have been unsuccessful. The possibility that this protein(s) may bind to DNA upon acquiring a particular quaternary structure has compelled us to employ DNA-affinity chromatography methods for purification. It is our goal to specifically dissect the mechanism by which the p35 gene is regulated and thus hopefully gain an understanding of how B. burgdorferi regulates gene expression as it shuttles through diverse environments.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a National Research Service Award (F32 AI09980-01) to K.J.I. and grant RR00164 (NCRR-NIH).
The photographic skill of Murphy Dowouis is acknowledged with thanks.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: T. R. P. R. C., 18703 Three Rivers Rd., Covington, LA 70433. Phone: (504) 871-6221. Fax: (504) 871-6390. E-mail: philipp{at}tpc.tulane.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bradford, M. M. 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[CrossRef][Medline]. |
| 2. | Chodosh, L. A. 1994. Mobility shift DNA-binding assay using gel electrophoresis, p. 12.2.1-12.2.7. In F. M. Ausubel, et al. (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. |
| 3. | Das, S., S. W. Barthold, S. S. Giles, R. R. Montgomery, S. R. Telford III, and E. Fikrig. 1997. Temporal pattern of Borrelia burgdorferi p21 expression in ticks and the mammalian host. J. Clin. Investig. 99:987-995[Medline]. |
| 4. | Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, et al. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580-586[CrossRef][Medline]. |
| 5. | Freundlich, M., N. Ramani, E. Mathew, A. Sirko, and P. Tsui. 1992. The role of integration host factor in gene expression in Escherichia coli. Mol. Microbiol. 6:2557-2563[CrossRef][Medline]. |
| 6. | Gralla, J. D., and J. Collado-Vides. 1996. Organization and function of transcription regulatory elements, p. 1232-1245. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, D.C. |
| 7. |
Hales, L. M.,
R. I. Gumport, and J. F. Gardner.
1994.
Determining the DNA sequence elements required for binding integration host factor to two different target sites.
J. Bacteriol.
176:2999-3006 |
| 8. |
Indest, K. J.,
R. Ramamoorthy,
M. Sole,
R. D. Gilmore,
B. J. Johnson, and M. T. Philipp.
1997.
Cell-density-dependent expression of Borrelia burgdorferi lipoproteins in vitro.
Infect. Immun.
65:1165-1171 |
| 9. |
Lange, R.,
M. Barth, and R. Hengge-Aronis.
1993.
Complex transcriptional control of the sigma s-dependent stationary-phase-induced and osmotically regulated osmY (csi-5) gene suggests novel roles for Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex, and integration host factor in the stationary-phase response of Escherichia coli.
J. Bacteriol.
175:7910-7917 |
| 10. | Margolis, N., and D. S. Samuel. 1995. Proteins binding to the promoter of the operon encoding the major surface proteins OspA and OspB of Borrelia burgdorferi. Mol. Biol. Rep. 21:159-164[CrossRef][Medline]. |
| 11. |
Ramamoorthy, R., and M. T. Philipp.
1998.
Differential expression of Borrelia burgdorferi proteins during growth in vitro.
Infect. Immun.
66:5119-5124 |
| 12. | Schwan, T. G. 1996. Ticks and Borrelia: model systems for investigating pathogen-arthropod interaction. Infect. Agents Dis. 5:167-181[Medline]. |
| 13. |
Schwan, T. G.,
J. Piesman,
W. T. Golde,
M. C. Dolan, and P. A. Rosa.
1995.
Induction of an outer surface protein on Borrelia burgdorferi during tick feeding.
Proc. Natl. Acad. Sci. USA
92:2909-2913 |
| 14. |
Sohaskey, C. D.,
C. Arnold, and A. G. Barbour.
1997.
Analysis of promoters in Borrelia burgdorferi by use of a transiently expressed reporter gene.
J. Bacteriol.
179:6837-6842 |
| 15. | Sohaskey, C. D., W. R. Zuckert, and A. G. Barbour. 1999. The extended promoters for two outer membrane lipoprotein genes of Borrelia spp. uniquely included a T-rich region. Mol. Microbiol. 33:41-51[CrossRef][Medline]. |
| 16. |
Stevenson, B.,
T. G. Schwan, and P. Rosa.
1995.
Temperature-related differential expression of antigens in the Lyme disease spirochete, Borrelia burgdorferi.
Infect. Immun.
63:4535-4539 |
| 17. |
Stevenson, B.,
J. L. Bono,
T. G. Schwan, and P. Rosa.
1998.
Borrelia burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria.
Infect. Immun.
66:2648-2654 |
| 18. |
Suk, K.,
S. Das,
W. Sun,
B. Jwang,
S. W. Barthold,
R. A. Flavell, and E. Fikrig.
1995.
Borrelia burgdorferi genes selectively expressed in the infected host.
Proc. Natl. Acad. Sci. USA
92:4269-4273 |
| 19. |
Tilly, K.,
J. Fuhrman,
J. Campbell, and D. S. Samuels.
1996.
Isolation of Borrelia burgdorferi genes encoding homologues of DNA-binding protein HU and ribosomal protein S20.
Microbiology
142:2471-2479 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»