INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Phenolic compounds are important plant constituents. For example, lignin represents about 20 to 30% of the biomass of higher plants and consists of phenylpropane units with various hydroxyl or methoxyl groups. Phenol is formed from lignin and several other natural or synthetic substrates during microbial degradation. The best-known phenol-generating enzyme is tyrosine phenol lyase, whose activity is used in bacterial taxonomic studies. Because of its toxic effects on cells, phenol was used as an antiseptic in clinical applications for a long time. In the chemical industry, phenol is a basic substance for the production of phenolic compounds from coal. Because of its broad application in industry, phenolic compounds are among the most prominent man-made groundwater contaminants derived from coal treatment processes, such as gasifying coal.

The aerobic metabolism of phenol has been studied extensively; in all known aerobic pathways, mono-oxygenases initiate the degradation of phenol by hydroxylation to catechol (for a recent review on phenol ortho hydroxylases, see reference 60). Among ortho-hydroxylating phenol hydroxylases, one-component flavoproteins or multicomponent enzyme systems are recognized. The following ring cleavage is a key reaction in microbial degradation of aromatic compounds. Catechol is oxygenolytically cleaved by dioxygenases by either ortho or meta cleavage.

Anaerobic growth on phenol has been observed for various bacteria (4, 24, 37, 55, 59, 62, 63, 64, 68). In all cases studied, phenol appeared to be carboxylated to 4-hydroxybenzoate and growth on phenol was dependent on the presence of CO₂ (62). Consortia of fermenting bacteria convert phenol to benzoate (24, 68) and decarboxylate 4-hydroxybenzoate to phenol (24, 68). They also catalyze an isotope exchange between D₂O and the proton at C-4 of the aromatic ring of phenol (23).

Phenol carboxylation to 4-hydroxybenzoate is a paradigm for a new type of biological carboxylation reaction. The process has been studied in the denitrifying bacterium Thauera aromatica (3, 32-34, 63) (Fig. 1). The gram-negative, rod-shaped bacterium belongs to the -group of the proteobacteria and was enriched and isolated under denitrifying conditions with phenol as substrate (1, 62; for similar strains, see references 61 and 64). It has a broad substrate spectrum and is able to grow anaerobically on many aromatic compounds. Cells grown with phenol were simultaneously adapted to growth with 4-hydroxybenzoate, whereas 4-hydroxybenzoate-grown cells did not metabolize phenol. Induction of the capacity to metabolize phenol required several hours.

View larger version (22K): [in this window] [in a new window]   FIG. 1.   Postulated pathway of anaerobic phenol metabolism in the denitrifying bacterium T. aromatica. E1, phenylphosphate synthase; E2, phenylphosphate carboxylase (the mechanism by which the phenolate anion is bound to the enzyme E2 is unknown so far); E3, 4-hydroxybenzoate-CoA ligase; E4, 4-hydroxybenzoyl-CoA reductase (dehydroxylating, ferredoxin dependent); E5, benzoyl-CoA reductase (dearomatizing, ferredoxin dependent). For further metabolism of benzoyl-CoA to three acetyl-CoA, one CO2, and six H molecules, see reference 25. Fd, ferredoxin. X~P, phosphoryl donor, unknown so far.

Phenol carboxylation proceeds in two steps and seems to involve formation of phenylphosphate as the first intermediate (equation 1) (32, 33). An enzyme activity catalyzing an isotope exchange between [¹⁴C]phenol and the phenyl moiety of phenylphosphate was identified in extracts of phenol-grown cells (equation 3) and was lacking in 4-hydroxybenzoate-grown cells. [³²P]Phosphate did not exchange with phenylphosphate. This suggests a phosphorylating enzyme, E₁, with a ping-pong mechanism which becomes phosphorylated in an essentially irreversible step (equations 2 and 3). The phosphorylated enzyme E₁ is postulated to transform phenol to phenylphosphate in a reversible reaction (equation 3). The whole reaction is understood as the sum of equations 2 and 3. Unfortunately, the phosphoryl donor X~P is unknown so far. The enzyme E₁ was termed "phenylphosphate synthase."

(1)

(2)

(3)

Phenylphosphate is postulated to be the substrate of a second enzyme, E₂ (32). It requires Mn²⁺ and catalyzes the carboxylation of phenylphosphate to 4-hydroxybenzoate (equation 4). An enzyme activity catalyzing an isotope exchange between ¹⁴CO₂ and the carboxyl group of 4-hydroxybenzoate (equation 6) was present in phenol-grown cells; [¹⁴C]phenol did not exchange with 4-hydroxybenzoate. It was assumed that the carboxylation reaction (equation 4) and the CO₂ isotope-exchange reaction (equation 6) are catalyzed by the same enzyme, reaction 6 being a partial reaction of reaction 4. The CO₂ isotope-exchange activity again suggests a ping-pong mechanism for enzyme E₂ (equations 5 and 6), involving an enzyme E₂-phenolate intermediate which is formed in a (presumably) exergonic reaction (equation 5) followed by a reversible carboxylation (equation 6).

(4)

(5)

(6)

The actual substrate is CO₂ rather than bicarbonate (as is the case in biotin-dependent carboxylases), and the carboxylating enzyme was not inhibited by avidin, a potent inhibitor of biotin-dependent carboxylases. Both results suggest that biotin is not involved in carboxylation. The enzyme E₂ was termed "phenylphosphate carboxylase." Synthesis of both the phosphorylating and the carboxylating enzymes is strictly regulated. All activities were only present in cells grown anoxically on phenol and were lacking, e.g., in 4-hydroxybenzoate-grown cells (29, 34). The phenol-carboxylating enzyme in T. aromatica does not belong to any group of the studied carboxylases, as it seems to proceed via a phosphorylated free intermediate, it is extremely oxygen sensitive and sensitive to radical-trapping agents (S. Breinig, M. Hügler, and G. Fuchs, unpublished results), and it is not dependent on biotin or thiamine diphosphate. It differs from most known carboxylases by using carbon dioxide as substrate and by the requirement of a metal as cocatalyst.

Further metabolism of 4-hydroxybenzoate proceeds in two steps to the intermediate benzoyl coenzyme A (CoA) (Fig. 1). A specific CoA ligase forms 4-hydroxybenzoyl-CoA (8), which becomes reductively dehydroxylated to benzoyl-CoA by a molybdo-flavo-iron-sulfur protein, 4-hydroxybenzoyl-CoA reductase (11, 14). A 2 [4Fe-4S] ferredoxin serves as electron donor for this reaction (14). The ligase and reductase are both induced in phenol- and in 4-hydroxybenzoate-grown cells, but not in benzoate-grown cells (29). Benzoyl-CoA is a common intermediate in the metabolism of many aromatic compounds. It is reductively dearomatized (9, 10) and further metabolized to three acetyl-CoA molecules and one CO₂ molecule (note that one CO₂ was originally introduced into phenol) (reviewed in reference 28). The anaerobic metabolism of phenol is shown in Fig. 1.

Nothing was known so far about the molecular background of anaerobic phenol metabolism. Based on the N-terminal and internal peptide sequence information of five phenol-induced proteins, it was our aim to find the genes coding for phenol-induced proteins. Analysis of the DNA sequences should provide new insights into the function of the phenol-induced proteins and into the regulation of anaerobic phenol metabolism.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Materials. Chemicals were reagent grade and purchased from Fluka (Neu-Ulm, Germany), Merck (Darmstadt, Germany), Serva (Heidelberg, Germany), or Sigma-Aldrich (Deisenhofen, Germany). Biochemicals were from Boehringer (Mannheim, Germany). Scintillation cocktail and acrylamide stock solution were purchased from Roth (Karlsruhe, Germany). [¹⁴C]Na₂CO₃ (2 GBq mmol¹) was purchased from American Radiolabeled Chemicals Inc./Biotrend Chemikalien GmbH (Cologne, Germany). Nitrogen, helium, and a N₂-H₂ gas mixture (95% nitrogen, 5% hydrogen) were purchased from Linde (Höllriegelskreuth, Germany).

Bacterial strains, growth conditions, cell harvesting, and storage. Strains of T. aromatica, K172 (1, 62), S100 (62), SP (54), LG356 (unpublished results), and T1 (61), and Azoarcus evansii KB740 (12) were cultured anaerobically at 30°C in a mineral salt medium with 0.5 mM phenol, 10 mM bicarbonate, and 2 mM nitrate or with 5 mM 4-hydroxybenzoate and 15 mM NaNO₃ as described elsewhere (11, 62). Growth was measured by following the optical density at 578 nm (OD₅₇₈). An OD₅₇₈ of 1.0 corresponded to a cell concentration of approximately 0.3 g of dry cell mass per liter. The harvested cells were immediately frozen and stored in liquid nitrogen. Growth conditions of Escherichia coli strains (XL1-blue MRF' [(mcrA)183 (mcr-CB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F' proAB lacI^q ZM15 Tn10 (Tet^r)]]; K38 [hfrC phoA4 pit-10 tonA22 ompF627 relA1 spoT ]; P2392 [E14 (McrA) hsdR514 supE44 supF58 lacYl or (lacIZY)6 galK2 galT22 metB1 trpR55 (P2 lysogen)] and XLOLR [(mcrA) 183 (mcrCB-hsdSMR-mrr)173 endA1 thi-1 recA1 gyrA96 relA1 lac [F' proAB lacI^q ZM15 Tn10 (Tet^r)] Su (nonsuppressing) ^r (lambda resistant)]) were as previously described (50).

Preparation of cell extract. All steps were performed under strictly anaerobic conditions. Frozen cells (20 g) were suspended in 20 ml of 20 mM imidazole-HCl (pH 6.5), 10% glycerol, 0.5 mM dithionite, and traces of DNase I, disrupted by a passage through a French press (137 MPa), and ultracentrifuged (1.5 h at 100,000 × g and 4°C). The supernatant containing the soluble protein fraction (55 mg of protein/ml) was used immediately or stored at 20°C for later experiments. The soluble protein fraction (cell extract) contained all 4-hydroxybenzoate: ¹⁴CO₂ exchange and phenylphosphate carboxylase activity.

Enzymatic tests. All tests were conducted at 30°C under strictly anaerobic conditions. The assays used 1 ml of assay mixture in a stoppered vial with a gas phase of approximately 250 µl. The assays for ¹⁴CO₂:4-hydroxybenzoate isotope exchange and carboxylation of phenylphosphate were performed as described elsewhere (32, 43). The amount of radioactivity in acid-stable products (4-hydroxybenzoate) in a sample of 250 µl was analyzed by liquid scintillation counting. The amount of labeled 4-hydroxybenzoate formed was calculated from the amount of fixed radioactivity, taking into account the known specific radioactivity of bicarbonate in the assay (80 Bq/nmol).

Partial purification of three dominant phenol-induced proteins, F1, F2, and F3. All chromatographic steps were performed under anaerobic conditions in a glove box under an N₂-H₂ atmosphere (95%/5% [vol/vol]) at 4°C. All buffers were filtered and degassed and then supplemented with dithionite to a final concentration of 0.5 mM. Generally used buffers were as follows. Buffer A contained 20 mM imidazole-HCl (pH 6.8), 20 mM KCl, 0.5 mM MnCl₂, and 10% glycerol. Buffer B contained buffer A plus 500 mM KCl. The purification was started with extract (approximately 20 ml) from 20 g of frozen cells grown on phenol and nitrate.

Ion-exchange chromatography 1. Cell extract (20 ml) was applied on a DEAE-Sepharose fast-flow column (35 ml; Pharmacia), which was run at a flow rate of 0.5 ml/min. The column was washed with 50 ml of buffer A, followed by a flat linear gradient from 20 mM KCl (100% buffer A) to 200 mM KCl (60% buffer A, 40% buffer B) in 100 ml and a steeper gradient from 200 mM KCl (60% buffer A, 40% buffer B) to 500 mM KCl (100% buffer B) in another 100 ml. Fractions of 2.5 ml were collected, and 6-µl samples of every second fraction were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Compared with extract of 4-hydroxybenzoate-grown cells, three dominant phenol-induced proteins, F1 (60 kDa), F2 (58 kDa), and F3 (67 kDa), were separated. F1 eluted between 60 and 100 mM KCl, F2 eluted between 140 and 190 mM KCl, and F3 eluted between 250 and 350 mM KCl. Fractions containing F1, F2, and F3 were pooled and tested for phenylphosphate carboxylase and CO₂ isotope exchange activities.

Ion-exchange chromatography 2. Two milliliters of the pooled fractions of F1, F2, and F3 after DEAE-Sepharose fast-flow chromatography was applied to a high-performance liquid chromatography (HPLC) system equipped with a MonoQ HR5/5 column (1 ml; Pharmacia), which was run at a flow rate of 0.5 ml/min. Fractions of 1 ml were collected in each run, and aliquots of 10 µl were analyzed by SDS-PAGE. For F1 purification, the column was equilibrated with buffer A containing 60 mM KCl and eluted with this buffer until the UV absorption baseline at 280 nm was stable. Samples of every fraction were tested for both activities and analyzed by SDS-PAGE. F1 eluted after 5 to 10 column volumes. For F2 purification, the column was equilibrated with buffer A containing 150 mM KCl. The column was washed with this buffer until the UV absorption baseline at 280 nm was stable. F2 eluted after 10 to 14 column volumes. For F3 purification, the column was equilibrated with buffer A containing 260 mM KCl and washed until the baseline at 280 nm was stable. Then, a linear gradient of 260 to 400 mM KCl in buffer A (8 column volumes) was applied. F3 eluted early in the gradient between 260 and 330 mM KCl.

Affinity chromatography on blue Sepharose. Ten milliliters of the F2 pool after chromatography on DEAE was loaded on a blue Sepharose column (48 ml; Pharmacia), equilibrated with 20 mM Tris-HCl, pH 7.5, at a flow rate of 2 ml/min. Because of the instability of the color matrix in the presence of reducing agents, no dithionite was added. The column was washed with 1 volume of the same buffer, and then F2 was eluted with 10 mM phenylphosphate in 20 mM Tris-HCl, pH 7.5, in 3 volumes. Fractions of 5 ml were collected, and 100-µl samples of each fraction were analyzed by SDS-PAGE (10% acrylamide).

SDS-PAGE. Polyacrylamide gels (normally 11.5% acrylamide) were prepared as previously described (35). Staining of the proteins was done according to a previously described method (67).

Two-dimensional gel electrophoresis. The first dimension (isoelectric focusing) was done with cell extract (120 µg of protein) according to Görg et al. (25) by using the Immobiline Dry Strip system (linear pH gradient 3 to 10; Pharmacia) according to the manufacturer's protocol. The second dimension (SDS-PAGE) was performed as described above. Comparison of extracts of cells grown on phenol and 4-hydroxybenzoate allowed the identification of phenol-induced proteins.

Protein transfer onto polyvinylidene difluoride membranes. Proteins of cell extract and of fractions after chromatography were electrophoretically separated on SDS-polyacrylamide gels and were then transferred to an Immobilon-P^sq transfer membrane (Millipore, Bedford, Mass.) for N-terminal sequencing of the phenol-induced proteins by using the Nova Blot System (Multiphor II; Pharmacia LKB, Freiburg, Germany) according to the manufacturer's protocol.

Amino acid sequencing and tryptic digest. Protein spots from cell extract of phenol-grown cells obtained after two-dimensional electrophoresis and fractions containing the phenol-induced proteins F1 to F3 after chromatography on MonoQ were transferred to a polyvinylidene difluoride membrane. Induced proteins were excised and sequenced using an Applied Biosystems 473A sequencer or an automated gas phase sequencer. The sequencing was performed according to the Edman method. The separated amino acid derivatives were analyzed by C₈ reversed-phase HPLC. For peptide sequencing, the pooled fractions containing F2 after chromatography on blue Sepharose were digested with modified trypsin (Promega, Mannheim, Germany) as follows: 500 µg of protein in 200 µl of 20 mM Tris-HCl, pH 7.5, was adjusted to pH 8 with 3 µl of triethylamine, and 10 µg of trypsin in 10 µl of H₂O (Promega sequencing grade modified) was added. The digest was carried out at 37°C for 4 h. The reaction was stopped by heating for 5 min to 100°C. After centrifugation, volumes of 5, 70, and 100 µl were sequentially applied to the HPLC. The peptides generated were separated on a reversed-phase C₁₈ Superpac-Sephasil HPLC column (Amersham Pharmacia Biotech, Uppsala, Sweden).

Cloning, DNA sequencing, and nucleic acid manipulations. Plasmids used for transformation of E. coli strains were pBK-CMV phagemid [fl()ori lacZ CMV SV40 poly(A) colE1 ori Neo^r Kan^r], pBluescript II KS/SK(±) [fl(±)ori lacZ colE1 ori Amp^r], and pGP1-2 [Kan^r T7 Gen1]. Oligonucleotides used for amplification of the probes for screening via PCR were as follows (>, forward; <, reverse; all in 5' to 3' direction): fubrei p374 (>GCGGCGCTTTCGGCACA), fubrei 375 (<GCGACTTCGCGCATCTTGTT), F2H (>ATGGAYCTSCGSTACTTCATC), F2t43R (<CATSAGGAAYTCSGCCTGCTG), 15H (>TCGCCGGCGACGACGCCG), and 15R (<CCGCGCGCTGCGCCGCCG). PCR products used as probes were labeled with [-³²P]dCTP (Amersham). Standard protocols were used for DNA cloning, transformation, amplification, and purification (50). Recombinant plasmids were generated in pBluescript vectors and were maintained in E. coli XL1-blue. T. aromatica DNA has a high GC content (67%). This made sequencing difficult because of the compression phenomenon. Three methods were applied. First, sequencing of plasmid DNA by the Sanger method was performed with ³⁵S-dATP. Second, sequencing of a PCR product with internal Cy5-dATP labeling, 0.5 µg of template/kbp, was performed according to the manufacturer's protocol and analyzed with an ALF express (Pharmacia). Third, cycle sequencing of PCR DNA according to the manufacturer's protocol (Pharmacia) was performed. Sequences were analyzed with an ALF express (Pharmacia). Part of the sequencing was performed with an ALF Automated Sequencer (Pharmacia).

Cloning strategy. Based on the N-terminal amino acid sequences of F2 and of two internal fragments, degenerate oligonucleotides were designed according to the codon usage of T. aromatica. A 500-bp PCR product (F2 forward and F2T6 reverse primers) of the N-terminal sequence of F2 was labeled with [³²P]dCTP and used as a probe for screening the  EMBL3 gene library. One phage hybridized with the probe. From the positive  clone, two adjacent BamHI fragments of 2.7 and 4.0 kbp and an EcoRI fragment of 5.25 kbp were subcloned in pBluescript and sequenced (for restriction sites, see Fig. 5). The boundary between the BamHI fragments was verified by amplification and sequencing of an overlapping DNA fragment. A double-stranded contiguous sequence of ca. 9 kbp was obtained from the insert of this  clone. To obtain sequence information of the 5' and 3' flanking regions of the first  clone, gene libraries of T. aromatica were rescreened. A 500-bp probe of the 5' boundary of the known sequence was amplified and used to screen the  EMBL3 library again. Two positive clones were obtained whose inserts were subcloned in pBluescript. Plasmids containing parts of the known sequence were identified by PCR assays and used for DNA sequencing. A total of 6.2 kbp of DNA was sequenced from two overlapping subclones containing either a 3.7-kbp PstI fragment or a 9-kbp BamHI fragment. A 600-bp probe of the 3' boundary of the known sequence was amplified and used to screen a  ZAP library. One positive phage was detected and converted to a phagemid as recommended by the supplier (Stratagene). It contained an insert of 8 kbp which overlapped with the known sequence and was used to sequence a further 400 bp of the 3' flanking region.

Southern hybridization. DNA fragments resolved by agarose gel electrophoresis were partially hydrolyzed by gently rinsing in 0.25 M HCl for about 20 min, followed by denaturing in 0.5 M NaOH-1.5 M NaCl for another 20 min. Finally, the gel was neutralized by excessively rinsing it in 1 M Tris-HCl-3 M NaCl, pH 7, three times for 10 min each. Then, the DNA was vacuum blotted onto a nylon/NC membrane with the help of a vacuum gel dryer system (Slab Gel Dryer 2003; Pharmacia LKB). After the blot procedure, the slots of the gel were marked on the membrane and the membrane was allowed to dry at room temperature. Fixation of the DNA on the membrane was achieved by incubating for 2 h at 80°C. In addition, chromosomal DNA was also blotted by capillary blotting, which guaranteed a better transfer of the large fragments (50).

Screening of gene banks of T. aromatica. A EMBL3 gene bank (Stratagene) and a ZAPExpress gene bank (Stratagene) were prepared and screened according to the manufacturer's protocol.

PCR. PCR conditions were as follows: 100 ng of target DNA, 200 nM concentrations of each primer, 200 µM (each) dATP, dCTP, dTTP, and dGTP, 50 mM KCl, 1.5 mM MgCl₂, 10 mM Tris-HCl (pH 9.0), 1 U of Taq DNA polymerase (Amersham Pharmacia Biotech). The assay was overlaid with 75 µl of paraffin oil. PCR parameters were as follows: 30 s at 95°C, 1 min at 40°C, 2.5 min at 72°C, 30 cycles. For amplification of fragments larger than 3 kbp, Taq DNA polymerase from Qiagen (Hilden, Germany) was used under the following conditions (Taq PCR kit from Qiagen): 100 ng of target DNA, a 200 nM concentration of each primer, 200 µM (each) dATP, dCTP, dTTP, dGTP, (NH₄)₂SO₄, and KCl, 4.5 mM MgCl₂, 10 mM Tris-HCl (pH 8.7), 1× Q solution, and 1 U of Taq DNA polymerase (Qiagen). PCR parameters were as follows: 30 s at 95°C, 1 min at 45°C, 2.5 min at 72°C, 30 cycles.

Expression of the T. aromatica genes. Heterologous expression of the genes was performed as previously described (13) for E. coli K38 containing the pGP1-2 plasmid, which contains the gene for the heat-inducible T7 RNA polymerase. Strain K38 was transformed according to a previously described method (18) with the pBluescript vector containing different parts of the phenol-induced gene cluster of T. aromatica under the control of a T7 promoter.

Computer analysis. The nucleotide and amino acid sequences were analyzed using the PC/gene software package (Genofit) and the Open Reading Frame Finder (ORF Finder; http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Similar sequences were identified using the BLAST search using the TBLASTN algorithm provided by the National Center for Biotechnology Information.

Nucleotide sequence accession number. All sequence data have been deposited in the EMBL nucleotide sequence database under accession no. AJ272115.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Detection of phenol-induced proteins. Growth on phenol and nitrate obviously requires induction of proteins that are required for anaerobic phenol metabolism. This follows from the observation that 4-hydroxybenzoate-grown cells were not able to metabolize phenol immediately, but only after a prolonged adaptation period of several hours. Furthermore, phenol-grown cells contained several protein bands in SDS-PAGE that were missing in 4-hydroxybenzoate-grown cells (not shown). Therefore, the soluble fraction (supernatant obtained after centrifugation at 100,000 × g) and the membrane fraction (pellet obtained after centrifugation at 100,000 × g, not shown) of extracts of cells that were grown anaerobically on phenol and 4-hydroxybenzoate, respectively, were compared in more detail by two-dimensional gel electrophoresis (Fig. 2).

View larger version (60K): [in this window] [in a new window]   FIG. 2.   Two-dimensional gel electrophoresis of soluble proteins (supernatant obtained after centrifugation at 100,000 × g) of T. aromatica anaerobically grown on 4-hydroxybenzoate (A) and phenol and CO2 (B). Triangles indicate phenol-induced proteins. F1 to F5 were isolated and their N-terminal amino acid sequences were determined.

Partial purification of phenol-induced proteins. The high content of phenol-induced proteins encouraged us to purify phenylphosphate carboxylase and CO₂ isotope exchange activity, despite its oxygen sensitivity. A chromatographic separation of cell extract on a DEAE-Sepharose fast-flow column is shown in Fig. 3A. Both activities coeluted in two fractions, and both contained phenol-induced proteins F1 and F2, although at different ratios. Both activities seemed to require the presence of some amount of the protein F1. Neither activity was measured in a third fraction containing the protein F3. The subfractions of the first two fractions were pooled and tested for both activities. In the first fraction, 35% of the residual activity of the CO₂ isotope exchange reaction and 15% of the phenylphosphate carboxylase activity could be detected, and in the second fraction, 20 and 10% of the activities, respectively, were detected. No combination of the three fractions restored full activity.

View larger version (52K): [in this window] [in a new window]   FIG. 3.   Partial purification of phenol-induced proteins. (A) DEAE-Sepharose fast-flow chromatography of 15 ml of the soluble fraction (supernatant obtained after centrifugation at 105 × g) of T. aromatica grown on phenol and nitrate. Fractions containing the F1, F2, and F3 proteins (identified by SDS-PAGE) that were pooled are indicated as black bars (1, 2, and 3, respectively) below the x axis. Only 10 to 20% of both the phenylphosphate carboxylating activity and the isotope exchange were detectable in the F1 and F2 pools. In the F3 pool, none of the activities were measurable. Circle, phenylphosphate carboxylase activity (values in parentheses). Rhombus, isotope-exchange activity. (B) SDS-10% PAGE of the fractions obtained by chromatography of the soluble protein fraction on a DEAE-Sepharose fast-flow column. Lane 1, extract of cells grown with phenol and nitrate; lane 2, pooled fractions containing F1; lane 4, pooled fractions containing F2; lane 6, pooled fractions containing F3; lanes 3, 5, and 7, F1 to F3 were further purified by chromatography on MonoQ. The three proteins eluted with 60, 200, and 330 mM KCl, respectively. (C) SDS-10% PAGE of F2 (fractionated by DEAE-Sepharose fast flow) after chromatography on blue Sepharose. Lane 1, DEAE fraction of F2; lane 2, main fraction of F2 eluting with 10 mM phenylphosphate from blue Sepharose.

N-terminal sequencing of five phenol-induced proteins (F1 to F5), peptide sequencing of F2, and synthesis of degenerate primers. Three phenol-induced proteins, F1 to F3, were enriched by chromatographic techniques in the enzymatically inactive form, and two other phenol-induced proteins, F4 and F5, were obtained from two-dimensional gels. The material was sufficient for N-terminal sequencing and peptide sequencing of F2. Up to 40 amino acids were determined, with only a few ambiguous amino acid residues. Comparison of the experimentally determined sequences with the sequences deduced from the genes (see below) showed very good correspondence, with only very few mismatches, and most uncertain amino acids were confirmed to be correct (Fig. 4). The results of the N-terminal sequencing were used to design degenerate primers, taking into account the known codon usage of T. aromatica. Amino acid sequences that were used as templates are underlined in Fig. 4.

View larger version (39K): [in this window] [in a new window]   FIG. 4.   Determined and deduced N-terminal amino acid sequences of phenol-induced proteins F1 to F5 and internal sequences of protein F2. X, amino acids that could not be sequenced; small letters, amino acids that were uncertain. Underlined amino acids were used as templates for primer design (names of the forward and reverse primers are given in parentheses). F1 corresponds to Orf6, F2, to Orf4, F3 to Orf1, F4 to Orf5, and F5 to Orf8.

Screening of a  EMBL3 and a  ZAP express gene library. Based on the N-terminal amino acid sequences of F2 and of an internal fragment of F2, degenerate oligonucleotides were designed. The primers used for the generation of labeled probes to screen the libraries are listed in Materials and Methods. A labeled 500-bp PCR product corresponding to the N-terminal sequence of F2 (F2H/F2T43R) was used as a probe for screening a  EMBL3 gene library. One phage hybridized with the probe. The insert DNA was prepared and subcloned in pBluescript vectors. About 9 kbp of sequence information of both DNA strands was obtained.

DNA sequencing and identification of the genes coding for putative proteins involved in anaerobic phenol metabolism. Screening of the gene libraries and sequencing of the subcloned DNA resulted in sequence information for 14,272 bp. Eleven open reading frames (ORFs) were detected (Fig. 5). Table 1 summarizes the location and orientation of ORFs 1 to 11 and, the number of amino acids encoded by each ORF, as well as the percent similarity and percent identity of the amino acid sequences of ORFs 1 to 11 with known sequences in the databases.

View larger version (19K): [in this window] [in a new window]   FIG. 5.   Organization of the clusters of genes possibly involved in anaerobic phenol metabolism in T. aromatica. Phenol-induced proteins F1 to F5 and the corresponding number of amino acids (aa) are shown below the ORFs. The reactions catalyzed by PEP synthase and 3-octaprenyl-4-hydroxybenzoate carboxy lyase (isoenzymes UbiD and UbiX) are shown below; these enzymes show similarity to some of the proteins possibly involved in phenol metabolism. Like colors (black and grey) stand for genes and gene products with similarities. Black arrows indicate the direction of transcription. The coding regions (sizes in base pairs) are indicated, as well as the restriction sites of various enzymes.

Expression of F1 to F5 proteins in E. coli. Five of the 11 ORFs were identified as genes coding for F1 to F5. However, there was no proof that the other putative genes were expressed as well. Therefore, several DNA fragments were ligated into pBluescript KS under the control of the heat-inducible T7 polymerase promoter and transformed into E. coli K38, and expression was induced. The following DNA fragments were used (compare with Fig. 5): 3.7-kbp PstI fragment containing orf1 (which codes for the F3 protein) and orf2; a 2.7-kbp BamHI fragment containing orf3 and orf4 (which codes for F2); a 4.0-kbp BamHI fragment containing orf5 (which codes for F4), orf6 (which codes for F1), and orf7; and a 5.25-kbp EcoRI fragment containing the 3' end of orf6, the intergenic region between orf6 and orf7, and the complete sequences of orf7, orf8 (coding for F5), orf9, and orf10. The proteins were separated by SDS-PAGE and localized by autoradiography (Fig. 6).

View larger version (80K): [in this window] [in a new window]   FIG. 6.   Expression of ORFs 1 to 6 in E. coli (T7 polymerase experiment). A volume of 25 µl was loaded onto each lane. Lanes 1, 4, and 7, marker proteins; lane 2, 3.7-kbp PstI fragment containing ORF1 and ORF2; lane 3, 2.7-kbp BamHI fragment containing ORF3 and ORF4; lane 5, 5.25-kbp EcoRI fragment containing ORF7, ORF8, ORF9, and ORF10; lane 6, 4.0-kbp BamHI fragment containing ORF5, ORF6, and ORF7.

Genomic Southern hybridization of chromosomal DNA of T. aromatica and other bacterial strains. Genetic work with T. aromatica is troublesome because of poor growth on agar plates. To obtain data on a possible correlation of the phenol-induced genes and their function in anaerobic phenol metabolism, a ³²P-labeled 750-bp PCR product (F2H/F2t43R) that corresponded to the 5' part of the gene coding for F2 (orf4) was used as a probe for Southern hybridization. The probe should only hybridize with the DNA of those strains that were closely related to T. aromatica and able to metabolize phenol. The 16S rRNA of Thauera sp. strain S100 is 100% identical and that of strain SP is more than 98.9% identical to that of T. aromatica type strain K172 (E. Stackebrandt and G. Fuchs, unpublished results). The phenol-induced genes should not be present in strains that could not have been shown to grow on phenol, like Thauera sp. strain LG356 (which has 100% 16S rRNA sequence identity with strain SP) and Azoarcus evansii type strain KB740.

View larger version (64K): [in this window] [in a new window]   FIG. 7.   Southern blot of genomic DNA of T. aromatica strains (type strain K172, strains S100, SP, and LG356) and A. evansii type strain KB740. The DNA was restricted with BamHI and EcoRI. After separation with agarose gel electrophoresis, DNA fragments were blotted onto a nylon membrane and hybridized with a 32P-labeled probe for the 5'-terminal part of the gene of F2. Arrows indicate the positions of the marker DNA, whose sizes are given in kilobase pairs (kbp).

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Genes and gene organization. Eleven ORFs were cloned and sequenced, and up to 11 phenol-induced proteins were identified by two-dimensional gel electrophoresis. Table 1 summarizes the deduced sizes and isoelectric points of these gene products. Five of the genes coded for the identified phenol-induced proteins F1 to F5. Comparison of the experimentally determined and deduced values showed that the molecular masses agreed reasonably well with the prediction.

Possible functional assignment of the genes. The two essential steps in phenol metabolism are the phosphorylation of phenol to phenylphosphate and the subsequent carboxylation of phenylphosphate to 4-hydroxybenzoate. Two gene products showed similarity to PEP synthase and four gene products showed similarity to 3-octaprenyl-4-hydroxybenzoate carboxy lyase, respectively, both of E. coli. Because of the similar chemistry involved in the respective reactions, we suggest that these genes are coding for phenol-phosphorylating and phenylphosphate-carboxylating enzymes, respectively.

Orf1 and Orf2, homologues of PEP synthase. Two ORFs, orf1 (coding for F3) and orf2, code for proteins of 70.2 and 40.4 kDa with similarity to the central and the N-terminal parts, respectively, of PEP synthase. Thus, the gene products appear to belong to the family of the structurally and functionally related PEP-utilizing enzymes, which comprises three groups of proteins (19, 20): (i) PEP synthase (or pyruvate:water dikinase [EC 2.7.9.2]), (ii) pyruvate:orthophosphate dikinase (EC 2.7.9.1), and (iii) PEP-protein phosphotransferase (EC 2.7.3.9), which is enzyme I of the PEP-dependent phosphotransferase system. Two sequence signatures are shared by all these proteins and by no other proteins in the current protein databases. The first sequence signature (PROSITE, accession no. PS00370) contains an active-site histidine residue that mediates phosphoryl transfer. The second sequence signature (PROSITE, accession no. PS00742) is a conserved region, the exact role of which is unknown. The functional similarity of the enzymes lies in the transfer of a phosphoryl group via a phospho-histidine intermediate and in the utilization of PEP or pyruvate as a substrate; the corresponding active sites are located on independently folded domains. The E. coli PEP synthase (175 kDa) is a dissociable dimer of identical subunits (87.4 kDa), and histidine residue 442 has been identified as the phosphorylation site (6, 42). In the thermophilic archaebacterium Staphylothermus marinus, PEP synthase is a homomultimeric enzyme complex whose subunits have a similar structure as the subunits of the homodimeric E. coli enzyme (20).

Orf4, -6, -7, and -8, homologues of 3-octaprenyl-4-hydroxybenzoate carboxy lyase. The gene products of orf4 (F2), orf6 (F1), and orf7 showed 47 to 63.8% similarity to UbiD (55.2 kDa) (Table 1 and Fig. 8), and the product of orf8 (F5) showed 86.8% similarity to UbiX (20.7 kDa). UbiD catalyzes the third reaction in ubiquinone biosynthesis, namely, the decarboxylation of 3-octaprenyl-4-hydroxybenzoate to 3-octaprenylphenol (Fig. 5). The gene ubiX encodes an isoenzyme of UbiD that catalyzes the same reaction. So far, only a few biochemical data are available on both enzymes. The holoenzyme UbiD of E. coli has a molecular mass of 340 kDa, and its activity is dependent on the presence of Mn²⁺ and an unidentified, heat-stable factor with a mass of <10 kDa (36). Moreover, the activity was increased by adding membrane preparations or phospholipids, indicating that the enzyme normally functions in association with the membrane.

View larger version (21K): [in this window] [in a new window]   FIG. 8.   Alignment of the conserved regions of F1, F2, and Orf7 possibly involved in phenol metabolism showing similarity to 3-octaprenyl-4-hydroxybenzoate carboxy lyase of E. coli and to 4-hydroxybenzoate decarboxylase of C. hydroxybenzoicum (A) and regions of conserved amino acid sequences in several decarboxylases (B). (A) Boxes with like colors (black and grey) represent similar domains. UbiD, 3-octaprenyl-4-hydroxybenzoate carboxy lyase; 4-OHBDC, 4-hydroxybenzoate decarboxylase; F1, F2, and Orf7, phenol-induced proteins of T. aromatica. (B) PDC, p-coumaric acid decarboxylase; PAD, phenylacrylic acid decarboxylase; FDC, ferulate decarboxylase. Bold letters represent amino acids that are identical in more than 50% of the sequences. The numbers refer to the first and last positions of the motif in the corresponding sequence. E.c., E. coli; T.a., T. aromatica; C.h., C. hydroxybenzoicum; S.c., Saccharomyces cerevisiae; L.p., Lactobacillus plantarum; B.s., Bacillus subtilis; B.p., Bacillus pumilus.

Orf10, homologue of a mutator T protein. The gene product of orf10 showed approximately 60% similarity to the mutator protein MutT of M. jannaschii (Table 1 and Fig. 9). Mutator proteins are enzymes involved in DNA metabolism which are widespread in prokaryotes and eukaryotes. The 15 members of the MutT family of proteins are believed to act in nucleoside phosphate metabolic pathways. 8-Oxo-7,8-dGTP (8-oxo-dGTP) is formed in the nucleotide pool of a cell during normal cellular metabolism and causes AT-to-GC transversion mutations when it is incorporated into DNA (7, 22, 53). The MutT protein of E. coli and related mammalian enzymes specifically hydrolyze 8-oxo-dGTP to 8-oxo-dGMP and PP_i, thereby preventing the occurrence of transversion mutation (38, 43). Members of this class of enzymes require two divalent cations per active site for activity, one coordinated by the enzyme and the other by the enzyme-bound nucleoside triphosphate (39). The substrate of proteins of the MutT family varies from 8-oxo-dGTP and diphosphoinositol polyphosphate (49) to adenosine(5')triphospho(5')adenosine, ADP-ribose, and NADH (43). One can only speculate which role Orf10 plays in the anaerobic metabolism of phenol in T. aromatica, e.g., in phenol activation.

View larger version (13K): [in this window] [in a new window]   FIG. 9.   Alignment of highly conserved regions of a protein of T. aromatica encoded by orf10 possibly involved in anaerobic phenol metabolism showing similarity to putative 8-oxo-dGTPase/ADP-ribose pyrophosphatase (MutT) of M. jannaschii. In parentheses are given the amino acid regions of the domains. !, either I or V; %, either F or Y; #, either N, D, Q, or E.

Orf11, a putative regulator protein. One ORF located 5' of the two gene clusters and transcribed in the opposite direction codes for a protein with 72% similarity to the regulator protein DmpR of P. putida CF600, which regulates aerobic (dimethyl)phenol metabolism (Fig. 10). DmpR is a member of the NtrC family of transcriptional activators and activates transcription of the dmp operon, which contains all 15 structural genes needed for the degradation of (dimethyl)phenol, in response to aromatic effector compounds (58). These effectors are phenol, o-cresol, m-cresol, p-cresol, and 3,4-dimethylphenol, and also ethylphenol, catechol, and 3- and 4-methylcatechol. MopR, the regulator of phenol degradation in Acinetobacter calcoaceticus NCIB8250, also belongs to the NtrC family (51). Like all regulators of the NtrC family, Orf11 contains several conserved protein domains (40). The highly conserved central (C) domain probably binds and hydrolyzes ATP and promotes open-complex formation with RNA polymerase. The C-terminal (D) domain is expected to bind to the corresponding target DNA sequence ("enhancer"). The highly variable sensory domain is joined to the C domain by short interdomain linker B. NtrC-like regulators sense their respective signals by direct binding of the effector to the A domain (56). Effector binding to the A domain then leads to release of the C domain (21, 56), thus permitting the binding of ATP followed by an ATP-driven cycle of multimerization and demultimerization of the regulator at the enhancer sites (45). This supports open-complex formation of ⁵⁴-containing RNA polymerase with the promoter (65). We propose that Orf11 controls the expression of the first or both gene clusters by a similar mechanism and acts as a transcriptional activator, when phenol or a similar compound plus ATP is present.

View larger version (47K): [in this window] [in a new window]   FIG. 10.   Orf11 of T. aromatica showing similarity to a regulator protein in aerobic (dimethyl)phenol metabolism (DmpR) of P. putida: comparison of the domain structures of DmpR of P. putida CF600 and Orf11 of T. aromatica (A) and alignment of the conserved amino acid regions (B). Structures were adapted from reference 35. The domains A, C, and D and the hinge region B of DmpR are indicated. In parentheses are given the amino acid regions of the conserved regions. !, either I or V; $, either L or M; %, either F or Y; #, either N, D, Q, or E.

Promoter region. Transcriptional activators of the NtrC-like family usually regulate transcription from ⁵⁴-dependent promoters, as was shown in P. putida for the positive regulator DmpR (57). The structural dmp genes of the aerobic phenol degradation pathway are clustered in a single operon that lies downstream of a nif/ntr-like promoter sequence. Upon inspection of the first gene cluster in T. aromatica, a similar nif/ntr-like promoter sequence was indeed found 5' of orf1 (Fig. 11). Primer extension analysis has to be performed to show whether transcription really starts at the expected site. So far, nothing is known about promoter sequences in T. aromatica, so the 24 and 12 consensus sequences are speculative. Upstream of the second gene cluster, no nif/ntr-like promoter sequences were found. All ⁵⁴-dependent promoters analyzed so far are regulated by positive transcriptional activators that usually bind to specific DNA sequences ("enhancer sequences," mostly inverted repeats) located relatively far upstream of the promoter (100 to 200 bp) (31).

View larger version (30K): [in this window] [in a new window]   FIG. 11.   (A) Putative nif/ntr-like promoter sequences upstream of the first gene cluster in T. aromatica. The putative 24 and 12 promoter elements (open boxes) and ribosome binding site (RBS; underlined) are indicated. The ATG initiation codon is in bold. The vertical arrow indicates the putative start site of transcription. The numbers at the beginning and at the end give the positions in the whole sequence of 14,272 bp. (B) Nucleotide sequences of nif- and ntr-like promoters. a, The transcriptional start sites of these three promoters has not yet been reported, and the promoter location is assumed on the basis of sequence similarity only. y, C or T; w, A or T.

Regulation of transcription. We suggest that phenol acts as an effector of a transcriptional activator protein, as there is an ntr-like regulator gene present upstream of the two gene clusters and a nif/ntr-like promoter sequence upstream of the first cluster of genes. In addition to the regulation by phenol, there may be additional catabolite repression, but no experimental data are available. As T. aromatica could not be shown to metabolize phenol in the presence of oxygen, it has to be shown whether O₂ represses the induction of transcription of the genes involved in phenol metabolism.

Presence of genes possibly involved in anaerobic phenol metabolism in different strains of T. aromatica and various Azoarcus species. So far, it has not been possible to unequivocally correlate genes coding for phenol-induced proteins and their function. Southern hybridization of a labeled probe of orf4 (coding for F2) with chromosomal DNA of different strains seemed to indicate that all tested Thauera and Azoarcus strains have a gene similar to orf4, whether or not they have been shown to metabolize phenol. One plausible assumption is that all strains are able to utilize phenol, but so far the appropriate growth conditions have not been applied. Alternatively, rearrangement and deletion may be the reason why some Thauera and Azoarcus strains are able to metabolize phenol and some are not.

Related carboxylases acting on aromatic compounds. Carboxylation of the aromatic ring is widespread among anaerobic microorganisms, but the respective enzymes have not been studied yet. The initial reaction in anaerobic o-cresol (2-methylphenol) metabolism in denitrifying Azoarcus sp. strain U 120 (formerly a Paracoccus strain) (48) is carboxylation in para-position to 3-methyl-4-hydroxybenzoate. Sulfate-reducing and methanogenic bacteria have been reported to carboxylate m-cresol (3-methylphenol) in para-position to the phenolic hydroxy group to 2-methyl-4-hydroxybenzoate (46, 47). A Desulfococcus sp. carboxylated hydroquinone (1,4-dihydroxybenzene) to gentisate (2,5-dihydroxybenzoate) (27). Some sulfate-reducing bacteria carboxylate catechol (1,2-dihydroxybenzene) to protocatechuate (3,4-dihydroxybenzoate), whereas phenol is not metabolized (26). Aniline is carboxylated to 4-aminobenzoate in Desulfobacterium anilini (52). An aerobic ortho-carboxylation of aniline to 2-aminobenzoic acid was reported for Rhodococcus erythropolis (2). In sulfate-reducing consortia, the initial reaction in the anaerobic metabolism of naphthalene is carboxylation specifically at C2 to form 2-naphthalene carboxylic acid; phenanthrene carboxylation leads to phenanthrene carboxylic acid, and the carboxylation site is unknown (69). Growth on all of these substrates is likely to be CO₂ dependent.