Previous Article | Next Article ![]()
Journal of Bacteriology, October 2000, p. 5872-5879, Vol. 182, No. 20
Shemyakin-Ovchinnikov Institute of Bioorganic
Chemistry, Russian Academy of Sciences, 117871 Moscow,
Russia,1 and Laboratoire de
Génétique Moléculaire, Ecole Normale
Supérieure, 75005 Paris, France2
Received 23 December 1999/Accepted 1 August 2000
The ssyF29 mutation, originally selected as an
extragenic suppressor of a protein export defect, has been mapped
within the rpsA gene encoding ribosomal protein S1. Here,
we examine the nature of this mutation and its effect on translation.
Sequencing of the rpsA gene from the ssyF
mutant has revealed that, due to an IS10R insertion, its
product lacks the last 92 residues of the wild-type S1 protein
corresponding to one of the four homologous repeats of the RNA-binding
domain. To investigate how this truncation affects translation, we have
created two series of Escherichia coli strains
(rpsA+ and ssyF) bearing various
translation initiation regions (TIRs) fused to the chromosomal
lacZ gene. Using a Protein translocation in
Escherichia coli is catalyzed by a preprotein translocase
comprising SecA and a SecY-SecE-SecG complex (7, 23).
Mutations in the sec genes cause defects in protein export
and hence accumulation of precursors of periplasmic and outer membrane
proteins within the cell. Studies of extragenic suppressors have
revealed a close functional connection between protein export and other
cell processes, in particular protein synthesis (16, 30, 31, 37,
38). Thus, two of the extragenic suppressors (called
ssy) of the secY24(Ts) mutation impairing preprotein translocation were mapped within genes normally involved in
initiation of translation: i.e., infB encoding initiation
factor 2 (ssyG) and rpsA encoding ribosomal
protein S1 (ssyF) (30, 31). However, the
mechanism whereby protein export might be modulated by essential
components of the translational apparatus remains obscure. Here, we
have characterized the structural and functional changes caused by the
ssyF29 mutation in ribosomal protein S1.
Protein S1 is an essential component of the protein synthesis machinery
of E. coli and other gram-negative bacteria (25, 34,
35). It plays two well documented roles in translation. First, it
is indispensable for efficient recognition and binding of the majority
of bacterial and phage mRNAs by the 30S ribosomal subunit during
the initiation process (25, 35). In some cases, the
S1-mRNA interactions at this stage were shown to involve
preferentially single-stranded AU- or U-rich regions which are
frequently found within 5'-untranslated mRNA leaders (2, 3,
39, 45). Second, protein S1, like several other ribosomal
proteins, down-regulates its own translation (33, 44).
However, the mechanism of this autogenous repression remains a puzzle.
Other ribosomal proteins that act as translational repressors bind to
the ribosome via specific rRNA motifs, and it is believed that they
repress translation by also binding to specific motifs on their
mRNAs; moreover, frequently, their rRNA and mRNA targets are
obviously structurally related (44). In contrast, S1 is
attached to ribosomes by means of protein-protein interactions
(4), and it uses its RNA-binding ability for binding to
various mRNAs without strict sequence specificity (35).
Yet, S1 must somehow recognize its own mRNA among all others to act as an autogenous repressor.
Besides these activities, S1 was shown to play a variety of roles
during phage infections: it is one of the four integral subunits of the
replicases of RNA bacteriophages (reviewed in reference
40), it stimulates the highly specific T4
endoribonuclease RegB (26), and it forms a complex with
phage The nature of the suppressor ssyF29 mutation has not been
characterized. Since this mutation was not revertible and resulted in
synthesis of a protein with a reduced apparent molecular weight (about
52,000) compared with that of the wild-type protein (61,000), Shiba et al. supposed that the ssyF mutation was a
deletion (31). In this work, we have structurally
characterized this mutation and studied how it affects the main
activities of protein S1 in translation. We have found an
IS10R element insertion in the 3' region of the mutant
rpsA gene interrupting translation and causing synthesis of
a truncated S1 lacking 92 C-terminal amino acid residues; hence, the
ssyF mutation can be designated as
rpsA::IS10R. The central and C-terminal
parts of S1 are known to form its RNA-binding domain, which consists of
four highly homologous repeats of the so-called S1 motif (5, 35,
36). We show here that despite the loss of the last S1 motif
(R4), the protein remains active in vivo for promoting initiation of
protein synthesis on natural translation initiation regions (TIRs),
whether or not they bear putative S1-binding sites upstream of their
Shine-Dalgarno (SD) sequence. In contrast, the truncated S1 appears
unable to function as a translational autorepressor within the mutant cell.
Conventions and abbreviations.
Throughout this work, gene
sequences are numbered from the corresponding translation start points,
with the first base of the initiation codon being noted as +1. The
term "translation initiation region" (TIR) was initially used to
designate all mRNA sequence or structure features contributing to
the efficiency of translation initiation, whereas the ribosome
binding site (RBS) is the RNA region extending from ca. Bacterial strains and plasmids.
The strains and plasmids
used in this work are listed in Table 1.
A general technique for replacing a small region of the E. coli chromosome encompassing the lacZ RBS with in-phase
DNA fragments harboring TIRs from other genes has been described
earlier (8, 11, 43) (Fig. 1).
Briefly, strain ENS0 (formerly called HfrG6
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Last RNA-Binding Repeat of the Escherichia coli
Ribosomal Protein S1 Is Specifically Involved in Autogenous
Control
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-galactosidase assay, we show that
none of these TIRs differ in activity between ssyF and
rpsA+ cells, except for the rpsA
TIR: the latter is stimulated threefold in ssyF cells,
provided it retains at least ca. 90 nucleotides upstream of the start
codon. Similarly, the activity of this TIR can be severely
repressed in trans by excess S1, again provided it retains
the same minimal upstream sequence. Thus, the ssyF stimulation requires the presence of the rpsA translational
autogenous operator. As an interpretation, we propose that the
ssyF mutation relieves the residual repression caused by
normal supply of S1 (i.e., that it impairs autogenous control). Thus,
the C-terminal repeat of the S1 RNA-binding domain appears to be
required for autoregulation, but not for overall mRNA recognition.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-protein which is involved in recombination (20,
41). This list is not necessarily exhaustive, and this
multifunctional protein may play still unknown roles not only in
phage-infected cells, but also in uninfected cells. Thus, S1 has been
reported to bind specifically to BoxA, the transcriptional RNA
antiterminator of the E. coli rRNA operons (19);
moreover, according to a recent hypothesis, it might mediate the
function of poly(A) tails in mRNAs (14). Therefore, the mechanism whereby the ssyF29 mutation suppresses the
secY24(Ts) defect may reflect a change in either translation
initiation efficiency or some other function of S1.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
20 to
+15, which is protected from nucleases by the 30S subunit
within the initiation complex (17). Here, we use the
term TIR to designate not only an mRNA region, but also the
corresponding DNA sequence. Exogenous DNA fragments used
in this work for driving lacZ translation generally extend beyond the limits of the RBS, and the 5' extensions contribute much to translation efficiency; hence, these fragments are
operationally called here "TIRs." The SD sequence is a continuous
nucleotide stretch complementary to the 3' end of 16S rRNA
(...ACCUCCUUA3') and located upstream from the start
codon. The 5' untranslated mRNA region (5' UTR) is also
referred to as the mRNA leader.
lac12) carries a short
chromosomal deletion encompassing the lac promoter,
lac operator, and lacZ RBS (nucleotides [nt]
52 to +44), and pEMBL
46 is a pEMBL8+ derivative in which a smaller region (
15 to +23) has been replaced by multiple cloning sites. TIRs
are inserted in phase with the lac sequence of pEMBL
46
and then transferred onto the chromosome of ENS0 by homologous
recombination, selecting for a Lac+ phenotype (Fig. 1).
TABLE 1.
Strains and plasmids used in this work

View larger version (22K):
[in a new window]
FIG. 1.
Construction of E. coli strains in which TIRs
originating from various genes are used to drive translation of the
chromosomal lacZ gene. The DNA fragment carrying the TIR of
interest (solid box) is first cloned in phase with the
-peptide gene
('lacZ') of pEMBL
46, a pEMBL8+ derivative carrying a
small deletion encompassing the lacZ RBS. The TIR is then
transferred onto the chromosome of ENS0 by homologous recombination
between lac sequences (lacI and lacZ)
present on both the plasmid and chromosome. The chromosome of ENS0
(Lac
) carries a slightly larger lac deletion
than the plasmid, encompassing the lac promoter
(Plac) and operator (op).
Preparation of fragments bearing TIRs from individual genes. (i)
rplL.
A PCR-generated fragment encompassing the TIR (nt
84
to +87) of the rplL gene coding for the ribosomal protein
L7/12 was originally cloned into the pSP73 vector (Promega Biotec) for
in vitro studies (2). Here the same fragment was in phase
cloned into the HincII site of pEMBL
46 to create pEL784.
To generate 5' truncations of this TIR, pEL784 was treated with
BamHI, then Bal31 exonuclease, and finally
HindIII. The resulting fragments differing in their 5'
ends were then recloned in pEMBL
46/HincII, HindIII and transferred onto the chromosome of ENS0
(Fig. 1). The shortest rplL leader obtained by this method
comprises 24 nt (see Fig. 3).
(ii) rpsA.
Plasmid pJS200 (29) (gift of J. Schnier) was used as a source of the rpsA sequence. The
partial restriction map (28) and transcriptional
organization of the rpsA operon (22) are
illustrated in Fig. 2A. An
HaeII-XmaI fragment encompassing the sequence
from
145 to +57 was made blunt-ended with mung bean nuclease and in phase cloned into the HincII site of pEMBL
46, generating
plasmid pES1145. Derivatives of this plasmid carrying 5'-truncated
rpsA leaders were obtained as described for the
rplL TIR and named pES191, pES182, pES166, pES145, and
pES129: the last two numbers designate the upstream boundary of
the TIR in each case (i.e.,
91,
82, etc.) (Fig. 3). These TIRs were
then transferred onto the chromosome of ENS0 as described. In the
resulting strains, the transcription of the rpsA'-'lacZ
fusions is driven by the lac promoter (Fig. 1). To create a
fusion retaining a genuine rpsA promoter, we inserted an
rpsA fragment extending from
252 to +57
(BamHI-XmaI fragment of pJS200) (Fig. 2A) into
pEMBL
46 and then onto the E. coli chromosome. The
resulting fusion carries the strong rpsA P3 promoter
("
35" from
169 to
163, "
10" from
145 to
140)
(22) downstream of the lac promoter-operator
sequence.
|
(iii) thrA.
A fragment carrying the thrA
TIR (
36 to +38) had been obtained previously (8); it
contains a stretch of 9 T residues at the 5' end (Fig.
3) corresponding to oligo(U) sequences in
the 5' UTR of the mRNA. Oligo(U) sequences within mRNA leaders
have been proposed to serve as S1 binding sites (3, 45),
hence the interest in testing the role of this stretch upon the
activity of the thrA TIR. To this end, the pEMBL
46
derivative carrying this TIR was treated with TaqI, which
cleaves immediately downstream of the oligo(T) stretch, and then made
blunt-ended and finally digested with PstI. The truncated
TIR was then recloned between the BamHI site (blunt-ended)
and the PstI site of pEMBL
46.
|
(iv) galE.
Two galE TIR variants used here
(Fig. 3) correspond to nt
32 to +26 and
14 to +26, respectively.
Both fragments were obtained as described previously (8).
(v) secA.
A fragment comprising the TIR of the
secA gene (nt
97 to +58) was generated from the E. coli chromosomal DNA by PCR with a couple of
primers bearing BamHI and
HindIII sites convenient for in-phase cloning into
pEMBL
46.
(vi) Growth of cells and
-galactosidase assays.
Cell
growth and
-galactosidase assays were essentially performed as
described previously (43). Briefly, cells were harvested in
the exponential phase (A600, 0.3 to 0.6) after at least
four generations of balanced growth in glycerol-MOPS
(morpholinepropanesulfonic acid)-rich medium (21, 43)
supplemented with chloramphenicol (34 µg/ml) and, unless otherwise
indicated, IPTG (0.2 mM) for lac operon induction. All
-galactosidase activities, measured in sonicated cell extracts, are
expressed in nanomoles of
o-nitrophenyl-
-D-galactopyranoside (ONPG)
hydrolyzed per minute per milligram of total soluble cell proteins.
RNA analysis.
Total RNA from the same cultures used for
-galactosidase assays was isolated and analyzed on Northern blots
essentially as described previously (43). As a probe for the
rpsA mRNA, we used an equimolar mixture of
SmaI-PstI and PstI-PstI
fragments encompassing the region +60 to +1244 of the rpsA
gene. This region is not present in the rpsA-lacZ mRNA,
but it is common to both the wild-type and ssyF alleles of
the rpsA gene. The fragments were uniformly 32P
labeled with a BRL Multiprime kit. The 23S rRNA was probed with 5'-32P-AAGGTTAAGCCTCACGGTTC, an oligonucleotide
complementary to its 3' region. The membranes were hybridized
successively with the rpsA and 23S RNA probes, analyzed with
the Fuji BAS 1000 imager to quantify the results, and autoradiographed.
Structural analysis of the rpsA gene from the
ssyF29 mutant.
DNA fragments containing the mutant or
wild-type rpsA genes were obtained by PCR from chromosomal
DNA of the corresponding strains. Forward (
66 to
45, 5'
GTATGTTAAACACCCCATCCG) and reverse (1738 to 1717, 5'
ACGAAACCTGCAATCTGTCAAG) primers from the 5' and 3' UTRs of the
rpsA gene were designed according to sequences given in
references 22 and 28,
respectively. The PCR products were compared by restriction analysis
and then sequenced to localize the ssyF mutation (see Results).
| |
RESULTS |
|---|
|
|
|---|
Nature of the ssyF29 mutation. The ssyF29 mutation was initially assumed to be a deletion (31). To localize this mutation within the rpsA gene, we have compared the length of PCR fragments amplified from the rpsA chromosomal region of wild-type and ssyF cells by using primers corresponding to the 5' and 3' UTRs of the gene. This analysis revealed an insertion of about 1.3 kb within the ssyF allele (not shown). Restriction analysis showed that the insertion was located within a PstI-HindIII fragment (1378 to 1643 in the wild-type gene) (Fig. 2A). This fragment was subcloned in pUC19 and sequenced on both strands by primer walking. The data revealed that the ssyF mutation actually consists of a disruption of the rpsA gene by the transposable element IS10R (12). Whereas one of the recombinant pUC19 plasmids showed several divergences from the published IS10R sequence (1), others did not, indicating that these changes have arisen during PCR amplification.
In the ssyF mutant, the IS10R sequence within the rpsA gene starts just after the rpsA position 1391, and it is flanked by a 9-bp direct duplication of the target site CGCTAAAGG (Fig. 2B). Such a duplication is typical for Tn10 and IS10R insertions (15), although in our case, the 9-bp repeat does not include the hot spot symmetrical consensus sequence 5'-GCTNAGC. The insertion causes premature termination of translation at the very beginning of the inserted sequence (Fig. 2B). As a result, the ssyF mutant produces a truncated form of S1 comprising 465 amino acids instead of 557 for the wild-type protein. According to current knowledge of the S1 structure (5, 35, 36), the central and C-terminal regions of the protein form its RNA-binding domain, which consists of four highly homologous repeats of 72 to 74 amino acids, the S1 motifs R1 to R4 (Fig. 2C). The SsyF protein therefore lacks most of repeat R4 and is renamed here "S1
4" to emphasize this fact. The questions of why
S1 has evolved this modular organization and what is the functional
role of each repeat remain unsettled. However, the ssyF
mutant is viable (31), even though it grows much more slowly
than the wild-type parent. (At 37°C in fully supplemented
MOPS-glycerol medium, its doubling time was estimated as ca. 110 min
versus 40 min for rpsA+ cells.) Therefore, the
cell can tolerate the loss of repeat R4, and we have exploited this
feature to evaluate its role in translation initiation.
Effect of the ssyF mutation upon translation initiation
from individual TIRs.
To compare the efficiencies of the wild-type
and truncated S1 proteins in translation initiation in vivo, we have
constructed series of either rpsA+ or
ssyF strains in which the translation of the chromosomal
lacZ gene is driven by TIRs originating from a variety of
other genes. Strains within each series are isogenic except for the TIR
replacement (Fig. 1); in particular, the lac
promoter-operator sequences, as well as most of the lac
transcribed sequence, are identical in each case, so that
strain-to-strain differences in
-galactosidase synthesis essentially
reflect the variable efficiencies of the TIRs used. This approach has
proven useful for comparing the strengths of various natural or
artificial TIRs in vivo (8, 11, 43). Here, we exploited it
to assess the effect of the ssyF mutation upon the
efficiency of individual TIRs. To provide a control for the S1
overexpression experiments to be described below, cells used for
-galactosidase assays always harbored pACYC184. The presence of this
plasmid (referred to here as pCtr, for pControl) (Table 1) does not
affect
-galactosidase yield from the different TIRs (not shown).
hence, the belief that this stimulating
effect reflects an improved 30S binding via S1-mRNA
interaction (2, 3, 39, 45). It was therefore of interest to
investigate how this effect is affected by the removal of repeat R4. To
this end, we have selected TIRs from the galE,
thrA, and rplL genes, all of which harbor such
A/U-rich putative S1 binding sites. Meanwhile, to verify that these
regions do stimulate translation, strains carrying truncated
forms of the same TIRs lacking these elements were also constructed
(Fig. 3). Two additional TIRs, corresponding to the secA and rpsA genes, were also included in this
study. As concerns secA, it has been noted that the defect
caused by the secY24 mutation can be corrected by elevated
concentration of the SecA protein (9). It was therefore
plausible that the ssyF mutation suppresses the
secY24(Ts) defect indirectly by stimulating translation from the secA TIR
hence the inclusion of this TIR in our study.
With regard to the rpsA TIR, it has been used here to
evaluate a possible implication of the repeat R4 in autoregulation (see below).
In rpsA+ cells, all three TIRs carrying U- or
A/U-rich upstream sequences were efficient in driving translation of
the lacZ gene, with the corresponding
-galactosidase
levels ranging from ca. 30% (thrA) to 180%
(galE) of that obtained with the genuine lacZ TIR
(5,600 U) (Fig. 4). This observation is
consistent with former results showing that foreign TIRs usually remain
functional within the lacZ gene (8). The deletion
of the upstream U- or A/U-rich regions caused a 4-fold
(rplL) to 30-fold (galE) drop in
-galactosidase synthesis, confirming that these regions indeed stimulate translation (Fig. 4). Remarkably, when the ssyF
mutation was introduced into the strains described above, these
-galactosidase levels were hardly affected, implying that the
fraction of
-galactosidase in total protein synthesis is insensitive
to the ssyF mutation. This conclusion holds true whatever
the TIR used, and, in particular, whether U- or AU-rich upstream
sequences are present or not (Fig. 4). Thus, the S1
4
protein is either as efficient as the wild-type S1 protein in
supporting translation initiation, or, if it is not, its efficiency is
reduced evenly whatever the TIRs. We conclude that the R4 repeat plays
no specific role in the recognition of individual TIRs.
|
-galactosidase level was only 3% of that observed with
the genuine lacZ TIR) (Fig. 4), either because it lacks the GG motif which constitutes the core of most SD elements (Fig. 3) or
because it can form inhibitory secondary structures. Significantly, this level again remained very nearly the same in ssyF
cells. Therefore, the ssyF mutation is unlikely to suppress
the secY24 defect by favoring secA translation.
Effect of the ssyF mutation upon translation initiation
from the rpsA TIR.
In our initial construct, the
rpsA TIR extended from nt
145 to +57 with respect to the
start codon (Fig. 2A and 3). This sequence includes the
10 region
of the strong rpsA promoter P3, but not its
35 region.
Consistently, as for all other fusions described above,
-galactosidase synthesis was strictly dependent upon the presence of
IPTG in the growth medium, showing that transcription of the
rpsA-lacZ fusion originates exclusively from the
lac promoter. The
-galactosidase assay immediately
revealed the unique character of the rpsA TIR (Fig. 4 and
5). First, in
rpsA+ cells, it was more efficient in
driving lacZ translation than any other TIR tested here, or,
indeed, than any other TIR previously assayed in this system (8,
11, 43): thus, the
-galactosidase level in this case was over
300% of the level observed with the genuine lacZ TIR (Fig.
5), a result all the more remarkable since the rpsA SD
element deviates from the consensus even more than the weak
secA SD element (Fig. 3). Second, although already very high, this level was further increased circa threefold by the ssyF mutation. This large overexpression was clearly visible
when cell extracts were analyzed on sodium dodecyl sulfate gels (Fig. 6A). The comparison of the
-galactosidase activity observed in this case (ca. 60,000 U) (Fig.
5) with the specific activity of pure
-galactosidase (400,000 U)
(10) shows that
-galactosidase represents about 15% of
total cell proteins, an amazing value for the product of a single-copy
gene.
|
|
145 to
91 did not
bring any significant change, indicating that this upstream region is
irrelevant to high translation efficiency or stimulation by
ssyF. In contrast, a slightly larger deletion (to
82)
dramatically impaired both properties (Fig. 5). Further shortening
partly restored the translational activity in
rpsA+ cells, but not the ssyF
stimulation; in particular, the shortest rpsA TIR used here
(nt
29 to +57) (Fig. 3) remained fairly efficient in
rpsA+ cells, but was no longer stimulated by
ssyF (Fig. 5).
In summary, stimulation of the rpsA TIR by the
ssyF mutation requires sequences extending far upstream
(i.e., to ca.
90) of the start codon; shorter versions of this
TIR are insensitive to the mutation, as are TIRs unrelated to
rpsA.
The stimulation of the rpsA TIR by the ssyF
mutation is closely related to autogenous control.
It is known
that excess S1 can repress its own translation, i.e., that the
rpsA gene, like other ribosomal protein operons, is
autoregulated (33, 44). To test whether autoregulation can
be reproduced in our experimental system, rpsA+
strains carrying the rpsA TIR-lacZ fusions were
transformed with the multicopy plasmid pSP261 (22). This
pACYC184 derivative (named here "pS1") (Table 1) carries the
rpsA gene under the control of its own promoters; its
presence in E. coli cells is known to repress translation of
individual copies of the rpsA gene so that the overall level
of synthesis of S1 is only slightly higher than in its absence
(22, 24) (Fig. 6B). As a control, we also introduced the
same plasmid into strains harboring TIRs unrelated to
rpsA. In all cases, the presence of the plasmid decreased the growth rate by 10 to 20% at 37°C (at 30°C, this decrease
became more pronounced). Moreover, it also caused a small
decrease in
-galactosidase expression from all TIRs unrelated to
rpsA or from 5'-truncated versions of the rpsA
TIR (Fig. 4 and 5). This modest effect, which reflects a small
reduction in the synthesis of
-galactosidase compared to other
proteins, is obviously not TIR specific and was not investigated
further. A completely different result was obtained with the
rpsA TIR with the longest 5' extensions (i.e., to
145 and
91). In this case,
-galactosidase activity dropped more than
20-fold in the presence of the plasmid (Fig. 5). Thus, autogenous
repression can be reproduced in our experimental system, provided the
rpsA TIR retains regions extending well upstream of the
start codon (i.e., to around
90).
-galactosidase synthesis, whatever the TIR used. In
particular, the extremely high activity of long versions of the
rpsA TIR which is characteristic of ssyF cells
was reduced by nearly 2 orders of magnitude in the presence of the
plasmid, down to the level observed in rpsA+
cells (Fig. 5 and 6A).
In summary, the rpsA TIR possesses two specific
properties
stimulation by the ssyF mutation and repression
by extra rpsA copies
which appear closely related: the
former effect can be completely reverted by the latter effect, and both
require that the TIR extend at least to ca.
90 upstream of the
rpsA start codon.
Effect of the ssyF mutation and S1 overexpression upon
expression of the rpsA gene.
To exclude the remote
possibility that the lac promoter or operator which drives
the transcription of our rpsA TIR-lacZ fusions plays a role in the repression of
-galactosidase synthesis by excess
S1, or in its stimulation by the ssyF mutation, we created a
similar fusion under the control of a genuine rpsA promoter. To this end, the rpsA fragment fused in phase of
lacZ was extended to
252 so as to include a functional P3
rpsA promoter (Fig. 2A). As expected, this particular fusion
was unique in allowing
-galactosidase synthesis in the absence of
IPTG. Synthesis was, however, twofold less in this case than with the
fusion carrying the rpsA TIR extending to
145 in the
presence of IPTG. This difference may reflect the lower strength of the
rpsA P3 compared to that of the lac promoter. Kajitani and Ishihama (13) similarly reported that, under
their assay conditions, the P3 promoter was only 20 to 50% as active as the lacUV5 promoter. Significantly, however, the
-galactosidase synthesis driven by the rpsA P3-TIR
combination was stimulated 2.5-fold by the ssyF mutation and
depressed more than 20-fold when the pS1 plasmid was present (Fig. 5).
These results parallel those observed when transcription is driven by
the lac promoter.
4, respectively (Fig. 6B, lanes
1 and 3). These signals remained the same after protein synthesis had
been inhibited for 4 h, showing that both S1 and S1
4 are stable
in vivo (not illustrated).
Interestingly, when identical amounts of extracts were compared, the
S1
4 signal was not more intense than the signal from the wild-type
S1. While this observation should be interpreted with some caution,
because S1
4 presumably lacks some of the epitopes normally
recognized by the polyclonal antibodies, it nevertheless suggests that
the ssyF mutation does not cause overproduction of S1
4 as
it does for the S1-
-galactosidase fusion protein, although both are
translated from the same rpsA TIR (compare Fig. 6A and B).
This difference is not surprising: whereas the
-galactosidase is
synthesized from identical mRNAs in both
rpsA+ and ssyF cells, this is
definitely not the case for the S1 and S1
4 proteins, since the
corresponding mRNAs differ because of IS10R inserted in
the ssyF allele. The insertion might have decreased the rpsA::IS10 mRNA level,
reducing S1
4 synthesis and neutralizing the effect of TIR
stimulation. Such an effect of IS10 is not unprecedented: it
has been shown that an IS10-like element, inserted
immediately downstream of the rpsO coding region, reduces
the rpsO mRNA level and, correspondingly, the ribosomal
protein S15 synthesis to about 10% of those of the wild type
(42).
To verify whether the IS10 insert does affect the amount of
the rpsA mRNA, we compared the steady-state levels of
the rpsA mRNA in rpsA+ and
ssyF cells by using Northern blot analysis (Fig. 6C). Total RNA from the same cultures which were used for Western blotting (Fig.
6B) was hybridized with labeled rpsA-specific probes, which can hybridize with the rpsA mRNA from both
rpsA+ and ssyF cells, but not with
the mRNA from rpsA-lacZ fusions (see Materials and
Methods). The signals were normalized to those obtained with the 23S
rRNA-specific probe as an internal control. The relative positions of
the rpsA-specific signals in pCtr lanes (Fig. 6C) show that
transcription of the rpsA::IS10 gene
stops early in the IS10 sequence. Quantitatively, the
intensity of the signal was reduced more than fivefold in
ssyF cells compared to that in wild-type cells (Fig. 6C).
Since nevertheless, the synthesis of S1
4 is comparable to that of
the wild-type S1 (pCtr lanes on Fig. 6B), the rpsA mRNA
must be translated much more efficiently in mutant cells, indicating
significant TIR stimulation.
As concerns plasmid pS1, its introduction caused a large increase in
the rpsA mRNA level, but only a small increase in S1 expression (Fig. 6B and C), indicating that translation of individual rpsA mRNA copies is severely inhibited because of
autorepression, as for the rpsA TIR-lacZ fusions
(Fig. 6A). In ssyF cells, introduction of pS1 resulted in
rpsA mRNA and S1 patterns that were almost indistinguishable from those observed for rpsA+
cells carrying the same plasmid; in particular, S1
4 expression was
now barely detectable (Fig. 6B).
Altogether, these results show directly that the ssyF
mutation markedly stimulates rpsA translation, although the
overexpression of S1
4 does not take place because of the small
amount of the rpsA mRNA in mutant cells. We conclude
that the ssyF mutation impairs rpsA
autoregulation, thus allowing the cell to produce a sufficient amount
of S1 from a limited supply of rpsA mRNA.
| |
DISCUSSION |
|---|
|
|
|---|
While ribosomal protein S1, the product of the rpsA gene, clearly plays important and multiple functions in E. coli and other gram-negative bacteria (see the introduction), genetic studies of these functions have been impaired by the fact that S1 is essential for viability. Only two nonlethal chromosomal rpsA mutations have been isolated so far, both yielding truncated products lacking the C-terminal region (31, 35; this paper). Here, we have used one of them (ssyF29) to study in vivo the relationship between the structure of the S1 protein and its role in translation initiation. Thus, although the role of truncated S1 as a suppressor of a protein export defect (31) is intriguing, our primary goal here is not to explain this suppression but rather to characterize the properties of the mutant protein.
We have found that ssyF cells carry an IS10R
element inserted within rpsA, resulting in an S1 polypeptide
lacking the fourth homologous repeat (R4) of the RNA-binding domain
(Fig. 2B and C). Thus, the ssyF29 mutation should be
designated as rpsA::IS10. Mutation
ssyB63, another suppressor from the ssy
collection, also corresponds to an IS10 insertion, and the
corresponding mutant protein (NusB) should be similarly truncated in
its C-terminal region (38). Other ssy suppressors
have not been structurally characterized. The SsyF protein (S1
4) is
particularly intriguing because little is known about the respective
roles of the individual S1 motifs. Earlier in vitro studies showed that
an S1 polypeptide lacking R3 and R4 could still bind to either poly(U),
poly(A), or MS2 RNA. However, with regard to translation initiation, it was only functional toward the two homopolymers and not toward the
natural mRNA (36). In contrast, a longer protein (m1-S1) retaining most of R3 could support the in vitro translation of all
three RNAs with only a slightly reduced efficiency (by 20 to 30%)
compared to that of the full-length protein (35, 36). On
this basis, it has been proposed that at least R3 is strictly necessary
for the in-phase positioning of natural mRNAs on the ribosomal
decoding center, i.e., for the precise fitting of the AUG codon to
the P site (36).
Consistent with these in vitro results, R4 is clearly not strictly
required for protein synthesis in vivo, since ssyF cells are
viable. To gain further insight into the role of R4 in translation initiation from individual genes, we have exploited a genetic system in
which the translation of the chromosomal lacZ gene is driven
by TIRs from other genes (8) (Fig. 1). The removal of R4 has
no effect upon the
-galactosidase synthesis from the diverse TIRs
used here (with the marked exception of the rpsA TIR [see below]). In particular, the U- or A/U-rich upstream sequences which
stimulate translation in vivo (17, 45; this paper)
and in several cases have been shown to constitute strong S1-binding sites in vitro (2, 3, 39; I. Boni, unpublished
results) have the same enhancing effect, whether R4 is present or not. These observations argue against a specific role for R4 in the recognition of individual TIRs. Recently, Sacerdot et al. reported that, similarly, the ssyF mutation affected neither the
activity of the thrS TIR nor that of a derivative lacking an
upstream enhancing sequence (27). Although these authors
concluded that S1 does not participate in the recognition of the
upstream element, a more logical conclusion is that the R4 motif is not
involved in this recognition.
Aside from its role in assisting translation initiation from most or
all TIRs, S1 also represses its own translation when present in excess
(24, 33). Autorepression is easily reproduced in our
experimental system: the
-galactosidase yield from the rpsA TIR is repressed strongly (20-fold) and specifically in
the presence of plasmid pS1 bearing the rpsA gene (Fig. 5
and 6A). It is noteworthy, however, that the TIR must retain ca. 90 nt of rpsA sequence upstream of the start codon for
repression to take place (the 5' boundary of the minimally required
sequence actually lies between
82 and
91). Obviously, the
translational operator extends that far upstream.
The rpsA TIR does not solely differ from all other TIRs
tested here in being repressed by excess S1: it is also unique in being
markedly stimulated by the ssyF mutation (Fig. 5 and 6A). Just like repression by excess S1, stimulation by ssyF
requires that the rpsA TIR extends far upstream of the start
codon, with the minimal required extensions being identical in both
cases. Moreover, the ssyF stimulation can be completely
reverted by excess S1. It seems plausible then that the stimulation by
ssyF and the repression by excess S1 correspond to the same
phenomenon. Although autorepression is most apparent upon introduction
of extra rpsA copies in the cell, it must still take place
even when the rpsA gene is present as a single copy. We
believe that the ssyF mutation alleviates this residual
autorepression, thereby increasing the apparent activity of the TIR.
According to this interpretation, the activity of the rpsA
TIR is intrinsically extremely high (Fig. 5), but it is reduced circa
threefold in cells harboring a single-copy wild-type rpsA
gene because of autorepression. Thus, S1
4 appears to be unable to
repress its own synthesis in the ssyF mutant.
A reasonable interpretation is that repeat R4 is required for formation
of the repressed state of the rpsA TIR. Our attempts to
confirm this point directly by testing the effect of S1
4
overproduction upon the activity of the rpsA TIR in vivo
were frustrated by the fact that the ssyF allele seems to be
too toxic for propagation on a multicopy plasmid, at least in the
genetic context used. However, such an interpretation is supported by
observations from S. Pedersen and colleagues (24). These
authors found that, whereas the expression of a plasmid-borne
rpsA-lacZ fusion was repressed by the presence of pS1 in the
same cell, this repression was relieved when pS1 carried a frameshift
mutation interrupting normal rpsA translation at codon
395, in the middle of R3. Derepression in this case was as large as
that with a mutation interrupting translation at the 15th codon,
i.e., at the very beginning of the coding sequence (24). It
is clear, therefore, that a protein retaining the first 395 amino acids
of S1 (followed by 50 unrelated amino acids resulting from the
frameshift) is inactive as a repressor. This observation, which
pinpoints the C-terminal region as being required for autoregulation, is compatible with our proposal that S1
4 is deficient in this function. In contrast, it seems inconsistent with an earlier result from the same group according to which a polypeptide retaining only the
N-terminal region of S1, corresponding to the ribosome binding domain
(35), can act as a repressor (33). Fragments carrying the N-terminal region of S1 are known to exchange readily with
the ribosome-bound S1 (35); therefore, we consider the possibility that the observed repression (33) was actually
mediated by full-length S1 molecules that had been displaced from the
ribosome in the presence of a high concentration of the N-terminal domain.
As shown here, the IS10 insertion not only causes the
production of the truncated protein S1 lacking R4 repeat, it also
markedly reduces the steady-state level of the rpsA
mRNA, without decreasing the S1
4 level to the same extent.
Taking this fact into account, we cannot at present completely exclude
an alternative explanation for the loss of the rpsA
autogenous control in the ssyF mutant. The scarcity of the
rpsA mRNA may reduce the rate of accumulation of S1
4
in the cell, consistent with the known slow growth of the
ssyF mutant. The steady-state concentration of free S1
4
in the ssyF mutant might then be insufficient to form a
tight repressor complex and to compete with 30S ribosomes for the
rpsA TIR. In vitro experiments are in progress to evaluate
an intrinsic capacity and concentration requirements of S1 lacking R4
to repress translation of its own mRNA.
| |
ACKNOWLEDGMENTS |
|---|
We thank S. Pedersen and J. Schnier for plasmids, K. Ito for strain IQ656 (ssyF29), and A. G. Carpousis for the anti-PNPase antibodies.
This work was supported by the RFBR grant 97-04-48834 to I.V.B. and by an MENRT grant (programme "Microbiologie") to M.D. I.V.B. has been supported by a "Chercheur Associé" fellowship from CNRS, France.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, U1. Miklukho-Maklaya 16/10, GSP-7, 117871 Moscow, Russia. Phone/fax: (7-095)330 65 38. E-mail: irina{at}humgen.siobc.ras.ru.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Artamonova, V. S., and I. V. Boni. 1996. The ssyF29 mutation in E. coli ribosomal protein S1 gene which suppresses the defect in protein export machinery results from an insertion of IS10R-element. Bioorg. Khim. 22:941-943[Medline]. |
| 2. | Artamonova, V. S., N. V. Tsareva, and I. V. Boni. 1998. Regulation of the ribosomal protein L7/12 synthesis: the role of the rplJL intercistronic region as a translational enhancer. Bioorg. Khim. 24:530-538[Medline]. |
| 3. |
Boni, I. V.,
D. M. Issaeva,
M. L. Musychenko, and N. V. Tzareva.
1991.
Ribosome-messenger recognition: mRNA target sites for ribosomal protein S1.
Nucleic Acids Res.
19:155-162 |
| 4. | Boni, I. V., I. V. Zlatkin, and E. I. Budowsky. 1982. Ribosomal protein S1 associates with Escherichia coli ribosomal 30S subunit by means of protein-protein interactions. Eur. J. Biochem. 121:371-376[Medline]. |
| 5. | Bycroft, M., T. J. P. Hubbard, M. Proctor, S. M. V. Freund, and A. G. Murzin. 1997. The solution structure of the S1 RNA binding domain: a member of an ancient nucleic acid-binding fold. Cell 88:235-242[CrossRef][Medline]. |
| 6. |
Chang, A. C. Y., and S. N. Cohen.
1978.
Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.
J. Bacteriol.
134:1141-1156 |
| 7. |
Douville, K.,
A. Price,
J. Eicher,
A. Economou, and W. Wickner.
1995.
SecYEG and SecA are the stoichiometric components of preprotein translocase.
J. Biol. Chem.
270:20106-20111 |
| 8. | Dreyfus, M. 1988. What constitutes the signal for the initiation of protein synthesis on Escherichia coli mRNAs? J. Mol. Biol. 204:79-94[CrossRef][Medline]. |
| 9. |
Fandl, J. P.,
R. Cabeli,
D. Oliver, and P. C. Tai.
1988.
SecA suppresses the temperature-sensitive SecY24 defect in protein translocation in Escherichia coli membrane vesicles.
Proc. Natl. Acad. Sci. USA
85:8953-8957 |
| 10. |
Fowler, A. V., and I. Zabin.
1983.
Purification, structure, and properties of hybrid -galactosidase proteins.
J. Biol. Chem.
258:14354-14358 |
| 11. |
Guillerez, J.,
M. Gazeau, and M. Dreyfus.
1991.
In the Escherichia coli lacZ gene the spacing between the translating ribosomes is insensitive to the efficiency of translational initiation.
Nucleic Acids Res.
19:6743-6750 |
| 12. |
Halling, S. M.,
R. W. Simons,
J. C. Way,
R. B. Wash, and N. Kleckner.
1982.
DNA sequence organization of IS10-right of Tn10 and comparison with IS10-left.
Proc. Natl. Acad. Sci. USA
79:2608-2612 |
| 13. |
Kajitani, M., and A. Ishihama.
1983.
Determination of the promoter strength in the mixed transcription system. II. Promoters of ribosomal RNA, ribosomal protein S1 and recA protein operons from Escherichia coli.
Nucleic Acids Res.
11:3873-3888 |
| 14. | Kalapos, M. P., H. Paulus, and N. Sarkar. 1997. Identification of ribosomal protein S1 as a poly(A) binding protein in Escherichia coli. Biochimie 79:493-502[Medline]. |
| 15. | Kleckner, N. 1989. Transposon Tn10, p. 227-268. In D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. |
| 16. |
Lee, C. A., and J. Beckwith.
1986.
Suppression of growth and protein secretion defects in Escherichia coli secA mutants by decreasing protein synthesis.
J. Bacteriol.
166:878-883 |
| 17. | McCarthy, J. E. G., and C. Gualerzi. 1990. Translational control of prokaryotic gene expression. Trends Genet. 6:78-85[CrossRef][Medline]. |
| 18. | Miller, J. H. 1992. A short course in bacterial genetics, p. 268-274. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 19. |
Mogridge, J., and J. Greenblatt.
1998.
Specific binding of Escherichia coli ribosomal protein S1 to boxA transcriptional antiterminator RNA.
J. Bacteriol.
180:2248-2252 |
| 20. |
Muniyappa, K., and E. Mythili.
1993.
Phage protein, a component of general recombination, is associated with host ribosomal S1 protein.
Biochem. Mol. Biol. Int.
31:1-11[Medline].
|
| 21. |
Neidhardt, F. C.,
P. L. Bloch, and D. F. Smith.
1974.
Culture medium for enterobacteria.
J. Bacteriol.
119:736-747 |
| 22. | Pedersen, S., J. Skouv, M. Kajitani, and A. Ishihama. 1984. Transcriptional organisation of the rpsA operon of Escherichia coli. Mol. Gen. Genet. 196:135-140[CrossRef][Medline]. |
| 23. |
Pugsley, A. P.
1993.
The complete general secretory pathway in gram-negative bacteria.
Microbiol. Rev.
57:50-108 |
| 24. | Rasmussen, M. D., M. A. Sorensen, and S. Pedersen. 1993. Isolation and characterization of mutants with impaired regulation of rpsA, the gene encoding ribosomal protein S1 of Escherichia coli. Mol. Gen. Genet. 240:23-28[Medline]. |
| 25. |
Roberts, M. W., and J. C. Rabinovitz.
1989.
The effect of Escherichia coli ribosomal protein S1 on the translational specificity of bacterial ribosomes.
J. Biol. Chem.
264:2228-2235 |
| 26. |
Ruckman, J.,
S. Ringquist,
E. Brody, and L. Gold.
1994.
The bacteriophage T4 regB ribonuclease. Stimulation of the purified enzyme by ribosomal protein S1.
J. Biol. Chem.
269:26655-26662 |
| 27. | Sacerdot, C., J. Caillet, M. Graffe, F. Eyermann, B. Ehresmann, C. Ehresmann, M. Springer, and P. Romby. 1998. The Escherichia coli threonyl-tRNA synthetase gene contains a split ribosomal binding site interrupted by a hairpin structure that is essential for autoregulation. Mol. Microbiol. 29:1077-1090[CrossRef][Medline]. |
| 28. |
Schnier, J., and K. Isono.
1982.
The DNA sequence of the gene rpsA of Escherichia coli coding for ribosomal protein S1.
Nucleic Acids Res.
10:1857-1865 |
| 29. |
Schnier, J.,
G. Stoffler, and K. Nishi.
1986.
Deletion and insertion mutants in the structural gene for ribosomal protein S1 from Escherichia coli.
J. Biol. Chem.
261:11866-11871 |
| 30. | Shiba, K., K. Ito, Y. Nakamura, J. Dondon, and M. Grunberg-Manago. 1986. Altered initiation factor 2 in the cold-sensitive ssyG mutant affects protein export in Escherichia coli. EMBO J. 5:3001-3006[Medline]. |
| 31. |
Shiba, K.,
K. Ito, and T. Yura.
1986.
Suppressors of the secY24 mutation: identification and characterization of additional ssy genes in Escherichia coli.
J. Bacteriol.
166:849-856 |
| 32. | Singer, M., T. A. Baker, G. Schnitzler, S. M. Deischel, M. Goel, W. Dove, K. J. Jaacks, A. D. Grossman, J. W. Erickson, and C. A. Gross. A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53:1-24. |
| 33. |
Skouv, J.,
J. Schnier,
M. D. Rasmussen,
A. R. Subramanian, and S. Pedersen.
1990.
Ribosomal protein S1 of Escherichia coli is the effector for the regulation of its own synthesis.
J. Biol. Chem.
265:17044-17049 |
| 34. | Sorensen, M. A., J. Fricke, and S. Pedersen. 1998. Ribosomal protein S1 is required for translation of most, if not all, natural mRNAs in Escherichia coli in vivo. J. Mol. Biol. 280:561-569[CrossRef][Medline]. |
| 35. | Subramanian, A. R. 1983. Structure and functions of ribosomal protein S1. Prog. Nucleic Acid Res. Mol. Biol. 28:101-142[Medline]. |
| 36. | Suryanarayana, T., and A. R. Subramanian. 1984. Function of the repeating homologous sequences in nucleic acid binding domain of ribosomal protein S1. Biochemistry 23:1047-1051[CrossRef][Medline]. |
| 37. | Taura, T., Y. Akiyama, and K. Ito. 1994. Genetic analysis of SecY: additional export-defective mutations and factors affecting their phenotypes. Mol. Gen. Genet. 243:261-269[CrossRef][Medline]. |
| 38. | Taura, T., C. Ueguchi, K. Shiba, and K. Ito. 1992. Insertional disruption of the nusB (ssyB) gene leads to cold-sensitive growth of Escherichia coli and suppression of the secY24 mutation. Mol. Gen. Genet. 234:429-432[CrossRef][Medline]. |
| 39. | Tsareva, N., V. Makhno, and I. Boni. 1994. Ribosome-messenger recognition in the absence of the Shine-Dalgarno interactions. FEBS Lett. 337:189-194[CrossRef][Medline]. |
| 40. | Van Duin, J. 1988. The single-stranded RNA bacteriophages, p. 116-166. In H. Fraenkel-Conrad, and R. Wagner (ed.), The viruses. Plenum, New York, N.Y. |
| 41. |
Venkatesh, T. V., and C. M. Radding.
1993.
Ribosomal protein S1 and NusA protein complexed to recombination protein of phage .
J. Bacteriol.
175:1844-1846 |
| 42. |
Yano, R., and T. Yura.
1989.
Suppression of the Escherichia coli rpoH opal mutation by ribosomes lacking S15 protein.
J. Bacteriol.
171:1712-1717 |
| 43. | Yarchuk, O., N. Jacques, J. Guillerez, and M. Dreyfus. 1992. Interdependence of translation, transcription and mRNA degradation in the lacZ gene. J. Mol. Biol. 226:581-596[CrossRef][Medline]. |
| 44. | Zengel, J. M., and L. Lindahl. 1994. Diverse mechanisms for regulating ribosomal protein synthesis in Escherichia coli. Prog. Nucleic Acid Res. Mol. Biol. 47:331-370[Medline]. |
| 45. | Zhang, J., and M. P. Deutsher. 1992. A uridine-rich sequence required for translation of prokaryotic mRNA. Proc. Natl. Acad. Sci. USA 79:2608-2612. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»