Previous Article | Next Article 
Journal of Bacteriology, October 2000, p. 5880-5884, Vol. 182, No. 20
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Characterization of tpp1+ as Encoding a
Main Trehalose-6P Phosphatase in the Fission Yeast
Schizosaccharomyces pombe
Alejandro
Franco,1
Teresa
Soto,1
Jero
Vicente-Soler,1
Pedro Valero
Guillen,2
Jose
Cansado,1 and
Mariano
Gacto1,*
Department of Genetics and Microbiology,
Facultad de Biologia,1 and Facultad
de Medicina,2 University of Murcia, 30071 Murcia, Spain
Received 12 May 2000/Accepted 26 July 2000
 |
ABSTRACT |
We have characterized an open reading frame of 2,454 bp on
chromosome I of Schizosaccharomyces pombe as the gene
encoding trehalose-6P phosphatase (tpp1+).
Disruption of tpp1+ caused in vivo accumulation
of trehalose-6P upon heat shock and prevented cell growth at 37 to
40°C. Accumulation of trehalose-6P in cells bearing a chromosomal
disruption of the tpp1+ gene and containing a
plasmid with tpp1+ under the control of the
thiamine-repressible promotor correlated with
tpp1+ repression. The level of
tpp1+ mRNA rose upon heat shock,
osmostress, or oxidative stress and was negatively controlled by cyclic
AMP-dependent protein kinase activity. Expression of
tpp1+ during oxidative or osmotic stress, but
not during heat shock, was under positive control by the
wis1-sty1 (equivalent to phh1 and
spc1) mitogen-activated protein kinase pathway. Analysis of Tpp1 protein levels suggests that the synthesis of trehalose-6P phosphatase may also be subjected to translational or posttranslational control.
 |
INTRODUCTION |
In yeast cells, trehalose functions
as a carbohydrate reserve and also as a stress metabolite (16, 32,
34). Biosynthesis and mobilization of this nonreducing
disaccharide are under multiple controls and are exquisitely regulated
(13, 18, 29, 30). Trehalose accumulation requires only two
enzymes. In a first step, trehalose-6P synthase (TPS1) transfers a
glucosyl residue from UDP-glucose to glucose-6P to yield
trehalose-6P, which is subsequently dephosphorylated by
trehalose-6P phosphatase (TPS2) to trehalose (5). In
Saccharomyces cerevisiae, the genes involved in trehalose synthesis have been cloned and sequenced (1, 9, 33).
Purification of the corresponding enzymes has revealed that trehalose
is synthesized by a large bifunctional complex which includes two
catalytic activities, trehalose-6P synthase and trehalose-6P
phosphatase, closely associated with the regulatory subunits TSL1 and
TPS3 (2, 9, 19). Disruption of TPS1 (also
called CIF1, FDP1, TSS1, and
GGS1), which codes for the smallest (56-kDa)
polypeptide of the trehalose synthase-phosphatase complex, causes not
only absence of trehalose accumulation but also inability of the yeast
cells to grow on glucose and other rapidly fermentable sugars. Hence,
TPS1 seems to catalyze the formation of trehalose-6P and to play an
important role in the regulation of sugar metabolism in
S. cerevisiae (1, 14). Disruption of TPS2, encoding a larger (100-kDa) component of
the trehalose synthase complex, causes accumulation of the
phosphorylated intermediate trehalose-6P and renders cells
permanently unable to grow at 40°C (9).
While much work has been done on trehalose synthesis in S. cerevisiae, less is known about the process of trehalose
accumulation in other yeast species (22). In this context,
evidence indicates that disruption of tpp1+ in
the fission yeast Schizosaccharomyces pombe, which is
homologous to the S. cerevisiae TPS1 gene, does
not affect growth in glucose but prevents spore germination
(4). These findings suggest that the trehalose pathway may
have different roles in the two species. In contrast to the situation
in S. cerevisiae (31), there is no
information on the enzyme which splits trehalose-6P into trehalose
and Pi in the fission yeast. In this work we have identified a gene (tpp1+) encoding a
trehalose-6P phosphatase which is involved in trehalose biosynthesis in S. pombe. Also, we have characterized
the phenotype associated with tpp1+ disruption
and determined the main regulatory pathways that control the expression
of this gene at the mRNA and protein levels under various stress conditions.
 |
MATERIALS AND METHODS |
Strains and culture media.
The S. pombe
strains employed in this study are listed in Table
1. They were routinely grown with shaking
at 28°C in YES (21) or EMM2 minimal medium with or without
thiamine (5 mg/liter) (7). Culture media were supplemented
with adenine, leucine, histidine, or uracil (100 mg/liter; Sigma
Chemical Co.), depending on the requirements of each strain. Solid
media were made by the addition of 2% (wt/vol) Bacto Agar (Difco
Laboratories, Detroit, Mich.). Transformation of strains was performed
by the lithium acetate method as described elsewhere (7).
Escherichia coli DH5
F' was employed as a host to
propagate plasmids. It was grown at 37°C in Luria-Bertani medium plus
50 µg of ampicillin/ml.
Cloning and disruption of tpp1+.
The
S. pombe sequence that codes for a putative
trehalose-6P phosphatase was amplified by PCR using DNA from cosmid
clone CRFc60GT219 as a template (obtained from the Resource
Center/Primary Database of the German Human Genome Project, Max-Planck
Institut für Molekulare Genetik, Berlin-Charlottenburg, Germany)
and the 5' oligonucleotide TPP5
(CAGTGTCGACGAAGAAGTTGCCAATAG), incorporating a
SalI site, and the 3' oligonucleotide TPP3
(CCACCCGGGTCGGGCATCTTCGTTGAA), incorporating a
SmaI site (both restriction sites are italicized). The
resulting 2.5-kbp product was cloned into the pREP3X expression vector
(20) as a SalI-SmaI fragment and
sequenced. The tpp1+ gene was interrupted by the
ura4+ gene as follows. Plasmid
pREP3X-tpp1 was digested with NotI and BglII, releasing an internal fragment of 1.4 kbp from the
cloned sequence, which was then replaced with an S. pombe 1.8-kbp NotI-BglII fragment containing
the ura4+ gene (15), giving rise to
plasmid pMTM-10. This plasmid was digested with SalI and
SmaI, releasing a 2.9-kbp fragment that was gel purified and
transformed into the haploid strain JY742 and the homothallic strain
P698. Stable ura+ transformants were screened
for tpp1+ disruption by Southern blot hybridization.
Determination of neutral trehalose activity, trehalose, and
trehalose-6P.
Neutral trehalose activity was assayed after
cell breakage as described previously (7). Trehalose and
trehalose-6P were extracted from the cells as indicated previously
(3), and the extract was heated at 100°C for 10 min in the
presence of 0.1 M NaOH and neutralized with HCl. The resulting
preparation was deproteinized by phenol treatment and resolved by
thin-layer chromatography (TLC) analysis on silica gel 60 plates
(Merck, Darmstadt, Germany) using butanol-ethanol-water (5:3:2
[vol/vol/vol]) as a solvent (35). Authentic
trehalose-6P, trehalose, and glucose were run in parallel as a
control. Sugar spots were visualized by charring them at 95°C after
spraying them with 25% H2SO4. For
quantification, the areas matching trehalose-6P spots in duplicate
plates were scraped, dissolved in methanol-water (1:1 [vol/vol]), and
identified by mass spectrometry in the electronic-impact mode in a
Finnigan (Manchester, United Kingdom) Trace MS 2000 by comparison with authentic trehalose-6P (Sigma Chemical Co.). The samples were directly inserted, a 70-eV potential of ionization was applied, and the
temperature range for sample evaporation was 50 to 350°C at
50°C/min. The source temperature was 200°C. In both cases, the
appearance of fragments at m/zs of 73, 85, 97, 127, 145, 163, 235, and 325 was observed, the last being characteristic of
trehalose-6P and absent in the mass spectrum of
nonphosphorylated trehalose. A quantitative estimation was
performed of the amounts of trehalose-6P in cell extracts of mutant
and wild-type cells after heat shock based on the relative abundance of
the m/z 325 fragment.
Northern and Southern blot hybridization.
Wild-type and
disruption mutant strains were grown in YES medium and subjected to
different stresses. Total mRNAs were then extracted, transferred to
nylon membranes, and hybridized to tpp1+ and
leu1+ (internal control) 32P-labeled
probes as previously described (7, 26). Southern blot
hybridization was performed under high-strigency conditions, employing
the tpp1+ open reading frame (ORF) as a
digoxigenin-labeled probe (7).
Construction of a Tpp1-HA-tagged strain.
A 5'-truncated
version of tpp1+ was amplified by PCR using DNA
from the pREP3X-tpp1+ plasmid as a template and
the 5' oligonucleotide TPP5F (TCAGCTGCTGTTCTCGAGTCCTTG, which hybridizes at positions 846 to 869 in the
tpp1+ ORF and shows an internal XhoI
site) together with the 3' oligonucleotide TPP3F
(GATGCGGCCGCGGTTAGTAAAATTTGCCA, which hybridizes
at positions 2436 to 2456 in the tpp1+ ORF and
incorporates a NotI site placed immediately upstream of the
stop codon). The restriction sites in both oligonucleotides are
italicized. The resulting 1.6-kbp product was then double digested with
XhoI and NotI and cloned into plasmid pSFL172
(12), creating plasmid pSFL172-F, which expresses a
truncated version of Tpp1p fused to a triple hemagglutinin (HA) tag at
its C terminus (Tpp1pHA) under the regulation of the strong thiamine
promoter (Pnmt1). A version of this plasmid without the
promoter (pSFL172-I) was constructed and digested at the unique
BglII site within tpp1+, and the
linear fragment was transformed into the haploid strain JY742 to target
integration at the tpp1+ locus. Uracil
prototrophs were selected, and identification of strains with one copy
of tpp1-HA expressed from the genomic
tpp1+ promoter was performed by immunoblotting
whole-cell extracts with anti-HA antibody and by Southern blot analysis.
SDS-PAGE and Western immunoblotting.
Total-cell homogenates
were prepared under native conditions, and 20 µg of protein was
resolved in each case by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) as previously described (21). The
gels were transferred to nitrocellulose filters (Amersham-Pharmacia)
and incubated with anti-HA (clone 12CA5; Roche Molecular Biochemicals)
or anti-
-tubulin (loading control; Sigma Chemical Co.) antibodies.
The immunoreactive bands were revealed with a mouse horseradish
peroxidase-conjugated secondary antibody (Sigma Chemical Co.) and the
ECL system (Amersham-Pharmacia).
Nucleotide sequence accession number.
The nucleotide
sequence of the tpp1+ gene has been submitted to
the EMBL database under accession no. AJ242743.
 |
RESULTS AND DISCUSSION |
Isolation and disruption of the trehalose-6P
phosphatase gene in S. pombe.
In an attempt to
identify new genes related to trehalose metabolism in S. pombe, a putative trehalose-6P phosphatase gene was identified
in clone ICRFc60G1219 from the S. pombe sequencing project. The ORF was 2,454 bp long, mapped in chromosome I, and presumably coded for a protein containing 813 amino acids, showing 36%
identity with the trehalose-6P phosphatase protein from
S. cerevisiae (TPS2). This sequence was
amplified by PCR using DNA from the corresponding cosmid clone as a
template and the oligonucleotides TPP5 and TPP3 (see Materials and
Methods), cloned into the pREP3X expression vector (20), and
sequenced to confirm identity with the sequence of the cosmid clone. To
verify that the cloned sequence represented the coding region of a
trehalose-6P phosphatase gene, it was interrupted by the
ura4+ gene and integrated via homologous
recombination into h+ and h90
ura4-D18 strains JY742 and P698, respectively (Fig. 1A and
B). Disruption of the phosphatase gene
was not expected to be lethal, since disruption of other members of the
trehalose biosynthetic pathway (tpp1+) does not
have a noticeable effect on the growth of vegetative cells of the
fission yeast (4). Congruent with this, prototrophs for
uracil were recovered at high frequency from each recipient strain.
Effective disruption of the putative trehalose-6P phosphatase gene
was verified by PCR and Southern blot hybridization using the analyzed
ORF as a probe (Fig. 1C).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Disruption of the tpp1+ gene from
S. pombe. (A) Restriction map of the genomic region
containing the tpp1+ gene. The solid bar and the
arrow below indicate the tpp1+ ORF. (B)
Construct used for the disruption of the tpp1+
gene. An internal NotI-BamHI fragment of the
tpp1+ gene was replaced by the
ura4+ cassette. The restriction sites X, N, and
B correspond to XhoI, NotI, and BamHI
sites, respectively. (C) Southern hybridization analysis of
XhoI-digested genomic DNA from strains JY742 (h+
tpp1+; lane 1) and P698 (h90
tpp1+; lane 3) and transformants MMP-3
(h+ tpp1::ura4+; lane 2)
and MMP-5 (h90
tpp1::ura4+; lane 4), with the
complete tpp1+ ORF as a digoxigenin-labeled
probe.
|
|
The intracellular concentration of the intermediate trehalose-6P in
heat-shocked exponential cells of S. pombe is about 2 orders of magnitude lower than for the trehalose pool (4). Thus, if the isolated sequence coded for an enzyme able to
dephosphorylate trehalose-6P, a strain disrupted in such a gene
would then hyperaccumulate trehalose-6P instead of (or in addition
to) trehalose after mild heat stress. To investigate this, cultures
from the wild-type and disruption strains were heat shocked to trigger
trehalose-6P synthase activity as previously described
(28), and intracellular disaccharides were then extracted
and resolved by TLC on silica gel 60 plates (35) (Fig.
2). Indeed, following heat shock,
wild-type cells showed negligible content of trehalose-6P and
accumulated significant amounts of trehalose. However, all the
disruption strains tested showed high yields of trehalose-6P in
addition to trehalose (Fig. 2). Hence, the gene disrupted in
S. pombe appears to code for a main trehalose-6P
phosphatase, although additional nonspecific phosphatase
activities are likely able to dephosphorylate part of the increased
trehalose-6P pool, apparently with lower affinity. We have called
this gene tpp1+ (for trehalose-6P
phosphatase of pombe). A quantitative estimation of the
amount of trehalose-6P in extracts of mutant and wild-type cells
after heat shock was performed by mass spectrometry in the electronic-impact mode. The results showed a 10-fold increase in
trehalose-6P in tpp1-disrupted cells compared to that in
wild-type cells (10.5 versus 1.1 mg/g [wet weight] [mean of two
independent determinations]).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of disaccharides present in wild-type and
trehalose-6P phosphatase disruption mutants of S. pombe. Cells were grown to mid-log phase in YES medium (control
strain JY742 and tpp1 strain MMP3) and in EMM2 minimal
medium strain
tpp1+pREP3X-tpp1+ with
or without thiamine (±B1). After heat shock (40°C for 90 min),
trehalose and trehalose-6P were extracted and resolved by TLC
analysis on silica gel 60 plates. Authentic trehalose-6P,
trehalose, and glucose were run in parallel as a control (lane C).
Corresponding areas in duplicate plates were analyzed by mass
spectrometry, as described in the text.
|
|
To demonstrate further that the accumulation of trehalose-6P in
tpp1 strains was due to loss of
tpp1+ function, a leu1-32
tpp1
disrupted strain was transformed with plasmid
pREP3X-tpp1+, which expresses the gene under the
control of the strong thiamine-repressible promoter (20).
Leucine prototrophs were isolated, and the trehalose and
trehalose-6P contents in either thiamine-repressed (i.e., no Tpp1
activity) or thiamine-derepressed (i.e., full Tpp1 activity) strains
were analyzed by TLC. As indicated in Fig. 2, trehalose and
trehalose-6P accumulated in the presence of thiamine, while only
trehalose was detected chromatographically in cells growing in the
absence of thiamine. Therefore, tpp1+ codes for
a protein whose activity is able to dephosphorylate trehalose-6P in vivo.
The predicted amino acid sequence of Tpp1p is 813 amino acids
long (97.3 kDa) and exhibited the highest identities with S. cerevisiae trehalose-6P phosphatase (TPS2; 36%), an
S. pombe putative trehalose-6P synthase (35%), and
an Arabidopsis thaliana putative trehalose-6P synthase
(31%). A search for potential phosphorylation sites in the Tpp1
sequence showed the presence of a cyclic AMP phosphorylation site
at position 819 (-KKLS-), although there is at present no evidence that
Tpp1p activation and deactivation are mediated by phosphorylation in
yeasts (31).
Properties of tpp1+-disrupted
cells.
Several studies have shown that the loss of
trehalose-6P synthase activity in S. pombe greatly
reduces tolerance of heat stress and severely compromises the ability
of spores to germinate (4, 7, 23). We reasoned that a
limited trehalose availability in
tpp1 cells might make
these cells functionally similar to
tps1 cells in some
respects. Disruption of tpp1+ did not have any
noticeable effect on the growth rates of strains growing at 25 to
30°C in either rich (YES) or minimal (EMM-2) medium, which were found
to be close to those shown by control strains. Under these growth
conditions, the level of trehalose-6P is almost undetectable in
normal and tpp1+-disrupted cells (reference
4 and our results). However, after a shift to 37°C
(YES agar medium) or 40°C (YES liquid medium), which enhances
trehalose synthesis in wild-type cells and triggers trehalose-6P accumulation in
tpp1+-disrupted cells, the former were able to
resume growth, while the latter ceased cell proliferation (data
not shown). This finding indicates that
tpp1+ function is indispensable for growth at
high temperatures. Interestingly, disruption of TPS2 in
S. cerevisiae also results in
temperature-sensitive growth, suggesting that accumulation of high
levels of the metabolic intermediate trehalose-6P may be inhibitory
to growth or promote a shortage of free intracellular Pi
(9).
Consistent with the presence in
tpp1 strains of at least
one additional phosphatase activity able to partially dephosphorylate the trehalose-6P pool, purified spores from strain MMP-5
(h90
tpp1::ura4 ura4D-18) were able
to germinate with the same efficiency as spores from the control strain
P698 (h90 ura4D-18) (data not shown). In the
absence of such "extra" phosphatase activity,
tpp1
spores should be phenotypically similar to
tps1 spores
(4), i.e., unable to mobilize trehalose and therefore unable
to germinate, since neutral trehalase of S. pombe does not recognize trehalose-6P as a substrate (data not shown).
Besides, all the known routes for neutral trehalase activation
previously described in S. pombe (8, 10, 24, 25,
27) were shown to be fully functional in
tpp1
strains, which is clearly different from
tps1 strains,
where neutral trehalase is activated only by osmostress (6).
Different pathways regulate transcription of
tpp1+ and the corresponding protein levels
under stress.
The expression of tpp1+ under
various adverse environmental conditions was analyzed by Northern blot
hybridization experiments. The corresponding mRNA migrates as a
single band of about 2.5 kb, which coincides with the size of the
tpp1+ ORF. Similar to other enzymes involved in
the synthesis and breakdown of trehalose, the level of
tpp1+ mRNA increases rapidly during heat
shock and more slowly during osmotic and oxidative stress (Fig.
3A), suggesting the existence of at least
two different and conserved regulatory pathways (26). In
this context, the absence of increase in tpp1+
expression in
phh1 cells during osmostress (and also
during oxidative stress but not during heat shock [Fig. 3B])
demonstrates that the wis1-sty1 (equivalent to
phh1 and spc1) stress-activated mitogen-activated
protein kinase cascade regulates this pathway.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Analysis of tpp1+ expression in
S. pombe. (A) Increase in the level of expression of
tpp1+ mRNA following heat, osmotic, or
oxidative stress in control strain CHP429. (B) Evidence for regulation
of the expression of tpp1+ by the
wis1-sty1 (equivalent to phh1 and
spc1) mitogen-activated protein kinase pathway during
osmotic stress using strain TK107
( phh1::ura4+). (C) Analysis of
pka1 strain CHP433 indicates that Pka1 activity
negatively modulates the basal level and the expression of
tpp1+ during heat and osmotic shock. (D)
Expression of tpp1+ in a pka1
sck1 strain suggests that derepression of
tpp1+ in the absence of Pka1 is dependent on the
cellular level of Sck1 activity.
|
|
In addition, basal expression (zero time) of
tpp1+ mRNA in cells growing in rich
medium appears to be negatively controlled by cyclic AMP-dependent
protein kinase (Pka1) function (Fig. 3C). Interestingly, this result is
similar to those shown previously for tps1+,
which codes for trehalose-6P synthase, and for
ntp1+, which codes for neutral trehalase
(reference 11 and unpublished results). Thus, basal
expression of the genes involved in either synthesis or degradation of
trehalose appears to be repressed by Pka1 activity. However, in a
double disruptant for Pka1 and Sck1 (a protein kinase that supresses
some defects of
pka1 mutants and regulates
neutral-trehalase activation under different conditions) (17,
25), tpp1+ expression recovered the
wild-type basal levels (Fig. 3D). This suggests that Sck1 function is
somewhat responsible for the derepressing effect observed in
Pka1-deficient cells. In this context, it is worth mentioning that in
the double-mutant ntp1+, expression follows the
same pattern as in tpp1+ (not shown), which
might be consistent with a model in which these protein kinases
regulate transcription of enzymes involved in trehalose metabolism.
Finally, to test whether the above-described increase in mRNA
expression of tpp1+ upon thermal, osmotic, or
oxidative stress correlated with a similar increase in Tpp1p protein
levels, we constructed a strain carrying a chromosomal HA-tagged
version of tpp1+. One of these strains, MMPI-3,
was subjected to either thermal shock or osmostress, and the level of
Tpp1p-HA fusion was estimated by Western blot analysis employing
anti-HA antibody. As shown in Fig. 4,
Tpp1HA protein migrates as a single 100-kDa band, almost identical to
the 97.3-kDa mass calculated on the basis of its amino acid sequence
(see above). Moreover, a clear rise in Tpp1pHA synthesis was observed
when the Tpp1pHA-tagged strain was subjected to thermal or osmotic
stress. However, unlike the results obtained from Northern blot
experiments concerning tpp1+ mRNA (Fig.
3), Tpp1pHA synthesis reached a maximum 30 to 60 min after the
treatment, decreased rapidly, and was independent of the type of stress
applied. This implies the existence of a control of Tpp1p expression at
the translational or posttranslational level during heat and osmotic
stresses. How the transcriptional and translational machinery
coordinates Tpp1p synthesis with Tpp1p activity during the
S. pombe life cycle and what the interaction of Tpp1p
with other members of the trehalose synthesis and breakdown pathways
are unresolved questions which deserve further investigation.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 4.
Tpp1pHA protein levels following thermal or osmotic
stress. The strain MMPI-3 was grown in YES medium to mid-log phase and
harvested before or after heat (40°C) or osmotic (0.75 M NaCl) stress
for the indicated times. The SDS-PAGE gels were transferred to
nitrocellulose filters and incubated with anti-HA or anti- -tubulin
(loading control) antibodies.
|
|
 |
ACKNOWLEDGMENTS |
A. F. and T. S. contributed equally to this work.
We thank F. Garro for expert technical assistance. We are indebted to
C. S. Hoffman, S. L. Forsburg, T. Kato, and A. Duran for kind provision of plasmids and strains.
A. F. is a predoctoral fellow of PFPI from the University of
Murcia. This work was supported in part by grant PB97-1049 from DGES, Spain.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Genetics and Microbiology, University of Murcia, 30071 Murcia, Spain. Phone: (34) 968 367132. Fax: (34) 968 363963. E-mail:
maga{at}fcu.um.es.
 |
REFERENCES |
| 1.
|
Bell, W.,
P. Klaassen,
M. Ohnacker,
T. Boller,
M. Herweiger,
P. Schoppink,
P. Van der Zee, and A. Wiemken.
1992.
Characterization of the 56-kDa subunit of yeast trehalose-6-phosphate synthase and cloning of its gene reveal its identity with the product of CIF1, a regulator of carbon catabolite inactivation.
Eur. J. Biochem.
209:951-959[Medline].
|
| 2.
|
Bell, W.,
W. Sun,
S. Hohmann,
S. Wera,
A. Reinders,
C. De Virgilio,
A. Wiemken, and J. M. Thevelein.
1998.
Composition and functional analysis of the Saccharomyces cerevisiae trehalose synthase complex.
J. Biol. Chem.
273:33311-33319[Abstract/Free Full Text].
|
| 3.
|
Blazquez, M. A.,
R. Lagunas,
C. Gancedo, and J. M. Gancedo.
1993.
Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexokinases.
FEBS Lett.
329:51-54[CrossRef][Medline].
|
| 4.
|
Blazquez, M. A.,
R. Stucka,
H. Feldmann, and C. Gancedo.
1994.
Trehalose-6-P synthase is dispensable for growth on glucose but not for spore germination in Schizosaccharomyces pombe.
J. Bacteriol.
176:3895-3902[Abstract/Free Full Text].
|
| 5.
|
Cabib, E., and F. Leloir.
1958.
The biosynthesis of trehalose phosphate.
J. Biol. Chem.
231:259-275[Free Full Text].
|
| 6.
|
Cansado, J.,
J. Vicente-Soler,
T. Soto,
J. Fernandez, and M. Gacto.
1998.
Trehalose-6P synthase is essential for trehalase activation triggered by glucose, nitrogen source or heat shock, but not by osmostress, in Schizosaccharomyces pombe.
Biochim. Biophys. Acta
1381:271-278[Medline].
|
| 7.
|
Cansado, J.,
T. Soto,
J. Fernandez,
J. Vicente-Soler, and M. Gacto.
1998.
Characterization of mutants devoid of neutral trehalase activity in the fission yeast Schizosaccharomyces pombe: partial protection from heat shock and high-salt stress.
J. Bacteriol.
180:1342-1345[Abstract/Free Full Text].
|
| 8.
|
Carrillo, D.,
J. Vicente-Soler, and M. Gacto.
1994.
Cyclic AMP signalling pathway and trehalase activation in the fission yeast Schizosaccharomyces pombe.
Microbiology
140:1467-1472[Abstract].
|
| 9.
|
De Virgilio, C.,
N. Burckert,
W. Bell,
P. Jena,
T. Boller, and A. Wiemken.
1993.
Disruption of TPS2, the gene encoding the 100-kDa subunit of the trehalose-6-phosphate synthase/phosphatase complex in Saccharomyces cerevisiae, causes accumulation of trehalose-6-phosphate and loss of trehalose-6-phosphate phosphatase activity.
Eur. J. Biochem.
212:315-323[Medline].
|
| 10.
|
Fernandez, J.,
T. Soto,
J. Vicente-Soler,
J. Cansado, and M. Gacto.
1997.
Osmo-stress-induced changes in neutral trehalase activity of the fission yeast Schizosaccharomyces pombe.
Biochim. Biophys. Acta
1357:41-48[Medline].
|
| 11.
|
Fernandez, J.,
T. Soto,
J. Vicente-Soler,
J. Cansado, and M. Gacto.
1997.
Heat-shock response in Schizosaccharomyces pombe cells lacking cyclic AMP-dependent phosphorylation.
Curr. Genet.
31:112-118[CrossRef][Medline].
|
| 12.
|
Forsburg, S. L., and D. A. Sherman.
1997.
General purpose tagging vectors for fission yeast.
Gene
191:191-195[CrossRef][Medline].
|
| 13.
|
François, J.,
M. J. Neves, and H. G. Hers.
1991.
The control of trehalose biosynthesis in Saccharomyces cerevisiae: evidence for a catabolite inactivation and repression of trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase.
Yeast
7:575-587[CrossRef][Medline].
|
| 14.
|
Gonzalez, M. I.,
R. Stucka,
M. A. Blazquez,
H. Feldmann, and C. Gancedo.
1992.
Molecular cloning of CIF1, a yeast gene necessary for growth on glucose.
Yeast
8:183-192[CrossRef][Medline].
|
| 15.
|
Grimm, C., and J. Kohli.
1988.
Observations on integrative transformation in Schizosaccharomyces pombe.
Mol. Gen. Genet.
215:87-93[CrossRef][Medline].
|
| 16.
|
Hottiger, T.,
C. De Virgilio,
M. N. Hall,
T. Boller, and A. Wiemken.
1994.
The role of trehalose synthesis for the acquisition of thermotolerance in yeast. II. Physiological concentrations of trehalose increase the thermal stability of protein in vitro.
Eur. J. Biochem.
219:187-193[Medline].
|
| 17.
|
Jin, M.,
M. Fujita,
B. M. Culley,
E. Apolinario,
M. Yamamoto,
K. Maundrell, and C. S. Hoffman.
1995.
Sck1, a high copy number suppressor of defects in the cAMP-dependent protein kinase pathway in fission yeast, encodes a protein homologous to the Saccharomyces cerevisiae SCH9 kinase.
Genetics
140:457-467[Abstract].
|
| 18.
|
Jorge, J. A.,
M. L. T. M. Polizeli,
J. M. Thevelein, and H. F. Terenzi.
1999.
Trehalases and trehalose hydrolysis in fungi.
FEMS Microbiol. Lett.
154:165-171[CrossRef].
|
| 19.
|
Londesborough, J., and O. Vuorio.
1991.
Trehalose-6-phosphate synthase/phosphatase complex from baker's yeast: purification of a proteolytically activated form.
J. Gen. Microbiol.
137:323-330[Medline].
|
| 20.
|
Maundrell, K.
1993.
Thiamine-repressible expression vectors pREP and pRIP for fission yeast.
Gene
123:127-130[CrossRef][Medline].
|
| 21.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of the fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
194:795-823[Medline].
|
| 22.
|
Reinders, A.,
I. Romano,
A. Wiemken, and C. De Virgilio.
1999.
The thermophilic yeast Hansenula polymorpha does not require trehalose synthesis for growth at high temperatures but does for normal acquisition of thermotolerance.
J. Bacteriol.
181:4665-4668[Abstract/Free Full Text].
|
| 23.
|
Ribeiro, M. J. S.,
A. Reinders,
T. Boller,
A. Wiemken, and C. De Virgilio.
1997.
Trehalose synthesis is important for the acquisition of thermotolerance in Schizosaccharomyces pombe.
Mol. Microbiol.
25:571-581[CrossRef][Medline].
|
| 24.
|
Soto, T.,
J. Fernandez,
J. Cansado,
J. Vicente-Soler, and M. Gacto.
1995.
Glucose-induced, cyclic-AMP-independent signalling pathway for activation of neutral trehalase in the fission yeast Schizosaccharomyces pombe.
Microbiology
141:2665-2671.
|
| 25.
|
Soto, T.,
J. Fernandez,
J. Cansado,
J. Vicente-Soler, and M. Gacto.
1997.
Protein kinase Sck1 is involved in trehalase activation by glucose and nitrogen source in the fission yeast Schizosaccharomyces pombe.
Microbiology
143:2457-2463[Abstract].
|
| 26.
|
Soto, T.,
J. Fernandez,
A. Dominguez,
J. Vicente-Soler,
J. Cansado, and M. Gacto.
1998.
Analysis of the ntp1+ gene, encoding neutral trehalase in the fission yeast Schizosaccharomyces pombe.
Biochim. Biophys. Acta
1443:225-229[Medline].
|
| 27.
|
Soto, T.,
J. Fernandez,
J. Vicente-Soler,
J. Cansado, and M. Gacto.
1995.
Nitrogen-source-induced activation of neutral trehalase in Schizosaccharomyces pombe and Pachysolen tannophilus: role of cAMP as second messenger.
FEMS Microbiol. Lett.
132:229-232[CrossRef][Medline].
|
| 28.
|
Soto, T.,
J. Fernandez,
J. Vicente-Soler,
J. Cansado, and M. Gacto.
1999.
Accumulation of trehalose by overexpression of tps1, coding for trehalose-6-phosphate synthase, causes increased resistance to multiple stresses in the fission yeast Schizosaccharomyces pombe.
Appl. Environ. Microbiol.
65:2020-2024[Abstract/Free Full Text].
|
| 29.
|
Thevelein, J. M.
1984.
Regulation of trehalose mobilization in fungi.
Microbiol. Rev.
48:42-59[Free Full Text].
|
| 30.
|
Thevelein, J. M., and S. Hohmann.
1995.
Trehalose synthase: guard to the gate of glycolysis in yeast?
Trends Biochem. Sci.
20:3-10[CrossRef][Medline].
|
| 31.
|
Vandercammen, A.,
J. François, and H. G. Hers.
1989.
Characterization of trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase of Saccharomyces cerevisiae.
Eur. J. Biochem.
182:613-620[Medline].
|
| 32.
|
Van Laere, A.
1989.
Trehalose, reserve and/or stress metabolite?
FEMS Microbiol. Rev.
63:201-210[CrossRef].
|
| 33.
|
Vuorio, O. E.,
N. Kalkkinen, and J. Londesborough.
1993.
Cloning of two related genes encoding the 56-kDa and 123-kDa subunits of trehalose synthase from the yeast Saccharomyces cerevisiae.
Eur. J. Biochem.
216:849-861[Medline].
|
| 34.
|
Wiemken, A.
1990.
Trehalose in yeast, stress protectant rather than reserve carbohydrate.
Antonie Leeuwenhoek
58:209-217[CrossRef][Medline].
|
| 35.
|
Zähringer, H. M.,
M. Burgert,
H. Holzer, and S. Nwaka.
1997.
Neutral trehalase Nth1p of Saccharomyces cerevisiae encoded by the NTH1 gene is a multiple stress responsive protein.
FEBS Lett.
412:615-620[CrossRef][Medline].
|
Journal of Bacteriology, October 2000, p. 5880-5884, Vol. 182, No. 20
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Petzold, E. W., Himmelreich, U., Mylonakis, E., Rude, T., Toffaletti, D., Cox, G. M., Miller, J. L., Perfect, J. R.
(2006). Characterization and Regulation of the Trehalose Synthesis Pathway and Its Importance in the Pathogenicity of Cryptococcus neoformans.. Infect. Immun.
74: 5877-5887
[Abstract]
[Full Text]
-
Madrid, M., Soto, T., Franco, A., Paredes, V., Vicente, J., Hidalgo, E., Gacto, M., Cansado, J.
(2004). A Cooperative Role for Atf1 and Pap1 in the Detoxification of the Oxidative Stress Induced by Glucose Deprivation in Schizosaccharomyces pombe. J. Biol. Chem.
279: 41594-41602
[Abstract]
[Full Text]
-
Paredes, V., Franco, A., Soto, T., Vicente-Soler, J., Gacto, M., Cansado, J.
(2003). Different roles for the stress-activated protein kinase pathway in the regulation of trehalose metabolism in Schizosaccharomyces pombe. Microbiology
149: 1745-1752
[Abstract]
[Full Text]
-
Zaragoza, O., de Virgilio, C., Ponton, J., Gancedo, C.
(2002). Disruption in Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity. Microbiology
148: 1281-1290
[Abstract]
[Full Text]
-
Van Dijck, P., De Rop, L., Szlufcik, K., Van Ael, E., Thevelein, J. M.
(2002). Disruption of the Candida albicans TPS2 Gene Encoding Trehalose-6-Phosphate Phosphatase Decreases Infectivity without Affecting Hypha Formation. Infect. Immun.
70: 1772-1782
[Abstract]
[Full Text]
-
Shinohara, M. L., Correa, A., Bell-Pedersen, D., Dunlap, J. C., Loros, J. J.
(2002). Neurospora Clock-Controlled Gene 9 (ccg-9) Encodes Trehalose Synthase: Circadian Regulation of Stress Responses and Development. Eukaryot Cell
1: 33-43
[Abstract]
[Full Text]