![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Journal of Bacteriology, October 2000, p. 5919-5921, Vol. 182, No. 20
Department of Microbiology, University of
Kaiserslautern, D-67663 Kaiserslautern, Germany
Received 30 May 2000/Accepted 19 July 2000
The Streptococcus pneumoniae
is an important human pathogen, causing invasive diseases such as
pneumonia, bacteremia, and meningitis. In order to analyze gene
expression in this organism, the availability of reporter constructs is
highly desirable. The Escherichia coli Identification of the bgaA gene.
For sequence
database searches, the BLAST program was used (2). A BLAST
homology search of the unfinished S. pneumoniae capsular
type 4 strain genome, obtained from The Institute for Genomic Research
at http://www.tigr.org, revealed a 365-residue peptide with 26%
identical amino acids compared to the
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Streptococcus pneumoniae
Beta-Galactosidase Is a Surface Protein
ABSTRACT
Top
Abstract
Text
References
-galactosidase gene of Streptococcus pneumoniae,
bgaA, encodes a putative 2,235-amino-acid protein with the
two amino acid motifs characteristic of the glycosyl hydrolase family
of proteins. In addition, an N-terminal signal sequence and a
C-terminal LPXTG motif typical of surface-associated proteins of
gram-positive bacteria are present. Trypsin treatment of cells resulted
in solubilization of the enzyme, documenting that it is associated with
the cell envelope. In order to obtain defined mutants suitable for
lacZ reporter experiments, the bgaA gene was
disrupted, resulting in a complete absence of endogenous
-galactosidase activity. The results are consistent with
-galactosidase being a surface protein that seems not to be involved
in lactose metabolism but that may play a role during pathogenesis.
TEXT
Top
Abstract
Text
References
-galactosidase
gene lacZ has been used in several studies. It has long been
known that S. pneumoniae produces a -galactosidase that
can be purified from the growth medium (8, 11),
necessitating the isolation of mutants devoid of this enzyme activity
for gene expression studies. However, the -galactosidase-negative
S. pneumoniae strains described so far were spontaneously
obtained and were not further characterized (6, 20). A
-galactosidase activity of S. pneumoniae has been
isolated from culture supernatants. The objectives of the present study
were the identification of the gene encoding the -galactosidase from
S. pneumoniae and the construction of a genetically defined
-galactosidase-negative mutant suitable for work with
lacZ reporter constructs in S. pneumoniae.
-galactosidase of
Streptococcus thermophilus. The peptide represented an
internal region of a putative 2,235-amino acid protein, the product of a 6,704-bp open reading frame. The region covered the two motifs characteristic of glycosyl hydrolase family 2 (9), both of which showed some anomalies in the S. pneumoniae protein:
the highly conserved residues Y in motif I and H in motif II were both
replaced by an N (Fig. 1). The presence
of these alterations was verified by direct sequencing between codons
285 and 716, using PCR products obtained from chromosomal DNA of
S. pneumoniae strain R6, a nonencapsulated derivative of
Rockefeller University strain R36A (3). For direct
sequencing, a BigDye terminator cycle sequencing kit (Perkin-Elmer,
Warrington, England) was used.
View larger version (33K):
[in a new window]
FIG. 1.
Schematic representation of the -galactosidase of
S. pneumoniae (S.p.). The amino acid (aa) sequences are
given for three important regions: the N-terminal signal peptide
(residues 1 to 55; the arrow marks the putative signal peptidase
cleavage site); the two conserved motifs of glycosyl hydrolase family 2 (hatched boxes) within the region homologous to other
-galactosidases (stippled box; approximately residues 90 to 600);
and 35 C-terminal residues with the cell wall-anchoring LPXTG motif
(stippled box at right end). The putative active site is aligned with
-galactosidases of the following organisms: S.t., S. thermophilus (SWISS-PROT P23989); T.e., Thermoanaerobacter
ethanolicus (SWISS-PROT P77989); L.d., Lactobacillus
delbrueckii (SWISS-PROT P33486); and E. coli (GenBank
AJ002684). Strictly conserved amino acid residues within the motifs are
highlighted. The C-terminal region is compared to those of other
proteins containing an LPXTG motif: M-protein, S. pyogenes M
protein (PIR S30283); S. pneumoniae proteins NanA
(neuraminidase A; SWISS-PROT 59959), StrH
(-N-acetylglucosaminidase; SWISS-PROT P49610), and Hya
(hyaluronidase; SWISS-PROT Q54873). Dots indicate gaps in the
alignment; the asterisk marks the C terminus.
-galactosidases, all of which are
only approximately 1,000 amino acids long. The conserved -galactosidase motifs are located in the first half of the protein. A region of about 100 amino acid residues at the N terminus contains a
putative signal peptide (Fig. 1). The structure of this signal peptide
is similar to those of the consensus sequence of signal peptides from
gram-positive bacteria, suggesting that the enzyme is exported
(17, 19). The second half of the protein has no similarity
to other proteins, except for the extreme C terminus, which contains an
LPXTG motif preceding a hydrophobic domain, features of gram-positive
bacterial surface proteins (15). Similar C termini are
present in the Streptococcus pyogenes M protein (16) and several pneumococcal surface proteins, e.g.,
neuraminidase A (5), hyaluronidase (4), and
N-acetylglucosaminidase (7) (Fig. 1).
Disruption of the bgaA gene.
In order to test
whether bgaA encodes the S. pneumoniae
-galactosidase, the erythromycin resistance determinant
ermA from the Enterococcus faecalis plasmid
pAM1 (14) was inserted into bgaA, resulting in
disruption of the reading frame. A single MunI site was
introduced into an internal bgaA fragment by site-directed mutagenesis (10), and the mutagenized fragment was cloned
into vector pCR2.1 (Invitrogen, Leiden, The Netherlands). The
ermA gene was amplified with oligonucleotide primers
5'- AGAGTGTGTTGATAGTGCAGTATC and
5'-TTATTTCCTCCCGTTAAATAATAG from pJDC9 (14),
cloned into pCR2.1, and reisolated after EcoRI restriction;
the ermA gene could now be cloned into the MunI
site of the bgaA fragment to give plasmid pBER. A 1.6-kb DNA
fragment containing the erm cassette and flanking
bgaA regions was amplified from pBER by PCR and used as
donor DNA in transformation experiments with S. pneumoniae R6 as a recipient. Transformation was performed essentially as described previously (18). With 1 µg of erythromycin per
ml for selection, Eryr colonies were readily obtained, and
integration of the Eryr marker in the bgaA gene
in individual mutants was verified by PCR.
-Galactosidase activity in bgaA mutants.
The
Eryr transformant R6
bgaA::erm showed no -galactosidase
activity when tested on D-agar plates (1) containing
5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-Gal)
and catalase (17,000 U ml
1; Sigma-Aldrich, Munich,
Germany), whereas colonies of the parental R6 strain appeared light
blue. In addition, -galactosidase activity was determined in liquid
cultures using C medium (12) supplemented with 0.2% yeast
extract at 37°C without aeration. Samples were removed at different
cell densities. After centrifugation (5 min at 12,000 × g), cells were resuspended in 0.1 M sodium phosphate buffer-0.1%
Triton X-100 and lysed during 5 min of incubation at 37°C.
-Galactosidase activity was determined essentially as described by
Miller (13) with
o-nitrophenyl--D-galactopyranoside as a
substrate. None of the transformants showed any activity compared to
the 60 Miller units of activity of strain R6. These results demonstrate
that the bgaA gene encodes the -galactosidase of S. pneumoniae and that it is solely responsible for the endogenous -galactosidase activity of this species.
Localization of -galactosidase.
Since the -galactosidase
of S. pneumoniae has been isolated from culture supernatants
(11), enzyme activity in the growth medium was determined
and compared to cell-associated activity, i.e., in cell lysates (Table
1). Ninety-five percent of the activity was found in cell lysates. In order to distinguish between
intracellular and surface localization of -galactosidase, intact
cells were harvested by centrifugation, washed once with 0.1 M sodium
phosphate buffer (pH 7.5), resuspended in the same buffer
containing trypsin (1 µg/ml; Promega, Madison, Wis.), and incubated
for 5 min at 37°C. After centrifugation, 57% of the
-galactosidase activity was found in the supernatant. In a control
experiment, bgaA mutant cells that expressed the E. coli lacZ gene (R6 bgaA::erm
uppS-lacZ) were used (22). This mutant produces
E. coli -galactosidase in the cytoplasm and, after
trypsin treatment, only traces of the enzyme could be detected in the
solubilized fraction; these results demonstrate that trypsin does not
induce cellular lysis (Table 1). In wild-type cells, the overall
-galactosidase activity after trypsin treatment was reduced to 51%,
probably due to a limited resistance of the pneumococcal protein to
trypsin.
|
Growth on lactose.
Most -galactosidases play a major role
in lactose metabolism and can be induced by lactose. When S. pneumoniae R6 bgaA::erm was grown
in C medium lacking glucose and sucrose (the only defined carbon
sources in this medium) and without yeast extract, but with lactose, no
effect on generation time was detected compared to that of the parental
strain R6. Strain R6 contained similar -galactosidase activities
independent of the carbon source, and the addition of
isopropyl--D-thiogalactopyranoside (IPTG) also had no
effect on -galactosidase expression (data not shown). These results
confirm that BgaA is the only -galactosidase in S. pneumoniae and strongly suggest that BgaA is not involved in lactose metabolism. This conclusion is further confirmed by the presence in the pneumococcal genome of two ORFs encoding proteins highly similar to the 6-phospho--galactosidases of Lactococcus lactis and Staphylococcus aureus, both of which are
preceded by genes encoding protein IIB/C of a putative lactose-specific
phosphotransferase system.
Concluding remarks.
For several surface proteins of
gram-positive bacteria, proteolytic cleavage and subsequent release
into the environment have been described (15). The present
characterization of the S. pneumoniae -galactosidase as a
surface protein is in agreement with a putative role of the enzyme in
the interaction with host cells, rather than an involvement in lactose
metabolism. Surface proteins such as neuraminidase A, hyaluronidase,
and N-acetylglucosaminidase of S. pneumoniae, all
of which contain an LPXTG motif, have been described as virulence
factors (4, 5, 7), and it is conceivable that
-galactosidase is a virulence factor as well. The presence of
antibodies against -galactosidase in convalescent-phase serum from a
patient with a history of pneumococcal infection is in agreement with
this assumption (24). The unusual high specificity of the
enzyme for -1,4-glycosidic bonds and a 10-times-higher specificity
for Gal1-4GlcNAc than for lactose (23) make it an ideal
candidate for attacking polysaccharides conjugated to surface
components of eukaryotic cells. Indeed, this property has been
exploited for the analysis of complex polysaccharides (21).
Curiously, no homologues of the pneumococcal enzyme with a signal
peptide and the surface-anchoring LPXTG motif were detected in the
genome databases of Streptococcus mutans and S. pyogenes. The availability of defined S. pneumoniae
bgaA mutants will help to clarify the role of -galactosidase in
vivo and provides a suitable genetic background for expression studies
using lacZ reporter constructs.
Nucleotide sequence accession number. The DNA sequence of S. pneumoniae bgaA has been deposited in GenBank under accession number AF282987.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by the Deutsche Forschungsgemeinschaft (grants Ha 1011/7-1 and Ha 1011/7-2) and by European Commission contract no. BI04-CT98-0424.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, University of Kaiserslautern, Paul Ehrlich Strasse, D-67663 Kaiserslautern, Germany. Phone: 49-631-205-2353. Fax: 49-631-205-3799. E-mail: hakenb{at}rhrk.uni-kl.de.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. | Alloing, G., C. Granadel, D. A. Morrison, and J.-P. Claverys. 1996. Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae. Mol. Microbiol. 21:471-478[CrossRef][Medline]. |
| 2. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 3. | Avery, O. T., C. M. MacLeod, and M. McCarty. 1944. Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. J. Exp. Med. 79:137-158[Abstract]. |
| 4. |
Berry, A. M.,
R. A. Lock,
S. M. Thomas,
D. P. Rajan,
D. Hansman, and J. C. Paton.
1994.
Cloning and nucleotide sequence of the Streptococcus pneumoniae hyaluronidase gene and purification of the enzyme from recombinant Escherichia coli.
Infect. Immun.
62:1101-1108 |
| 5. |
Càmara, M.,
G. J. Boulnois,
P. W. Andrew, and T. J. Mitchell.
1994.
A neuraminidase from Streptococcus pneumoniae has the features of a surface protein.
Infect. Immun.
62:3688-3695 |
| 6. | Campbell, E. A., S. Y. Choi, and H. R. Masure. 1998. A competence regulon in Streptococcus pneumoniae revealed by genomic analysis. Mol. Microbiol. 27:929-939[CrossRef][Medline]. |
| 7. |
Clarke, V. A.,
N. Platt, and T. D. Butters.
1995.
Cloning and expression of the beta-N-acetylglucosaminidase gene from Streptococcus pneumoniae. Generation of truncated enzymes with modified aglycon specificity.
J. Biol. Chem.
270:8805-8814 |
| 8. |
Glasgow, L. R.,
J. C. Paulson, and R. L. Hill.
1977.
Systematic purification of five glycosidases from Streptococcus (Diplococcus) pneumoniae.
J. Biol. Chem.
252:8615-8623 |
| 9. | Henrissat, B. 1991. A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 280:309-316. |
| 10. | Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1996. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59. |
| 11. | Hughes, R. C., and R. W. Jeanloz. 1964. The extracellular glycosidases of Diplococcus pneumoniae. I. Purification of a neuraminidase and a beta-galactosidase active on the alpha-1-acid glycoprotein of human plasma. Biochemistry 10:1535-1548. |
| 12. | Lacks, S. A., and R. D. Hotchkiss. 1960. A study of the genetic material determining an enzyme activity in pneumococcus. Biochim. Biophys. Acta 39:508-517[Medline]. |
| 13. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 14. |
Morrison, D. A.,
M. C. Trombe,
M. K. Hayden,
G. A. Waszak, and J.-D. Chen.
1984.
Isolation of transformation-deficient Streptococcus pneumoniae mutants defective in control of competence, using insertion-duplication mutagenesis with the erythromycin resistance determinant of pAM1.
J. Bacteriol.
159:870-876 |
| 15. |
Navarre, W. W., and O. Schneewind.
1999.
Surface proteins of gram-positive bacteria and the mechanism of their targeting to the cell wall envelope.
Microbiol. Mol. Biol. Rev.
63:174-229 |
| 16. |
Pancholi, V., and V. A. Fischetti.
1989.
Identification of an endogenous membrane anchor-cleaving enzyme for group A streptococcal protein.
J. Exp. Med.
170:2119-2133 |
| 17. | Silhavy, T. J., S. A. Benson, and S. D. Emr. 1983. Mechanisms of protein localization. Microbiol. Rev. 4:313-334. |
| 18. |
Tiraby, J.-G., and M. S. Fox.
1974.
Marker discrimination and mutagen-induced alterations in pneumococcal transformation.
Genetics
77:449-458 |
| 19. |
Von Heijne, G.
1986.
A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res.
14:4683-4690 |
| 20. |
Wang, L. F., and R. H. Doi.
1986.
Nucleotide sequence and organization of Bacillus subtilis RNA polymerase major sigma (sigma 43) operon.
Nucleic Acids Res.
14:4293-4307 |
| 21. | Yang, Y., and R. Orlando. 1996. Simplifying the exoglycoside digestion/MALDI-MS procedure for sequencing N-linked carbohydrate side chains. Anal. Chem. 68:570-572[Medline]. |
| 22. | Zähner, D. 1999. Identifizierung von Zielgenen des signaltransduzierenden Zwei-Komponenten-Systems cia von Streptococcus pneumoniae. Ph.D. thesis. Universität Kaiserslautern, Kaiserslautern, Germany. |
| 23. |
Zeleny, R.,
F. Altmann, and W. Praznik.
1997.
A capillary electrophoretic study on the specificity of -galactosidases from Aspergillus oryzae, Escherichia coli, Streptococcus pneumoniae, and Canavalia ensiformis (jack bean).
Anal. Biochem.
246:96-101[CrossRef][Medline].
|
| 24. |
Zysk, G.,
R. J. M. Bongaerts,
E. ten Thoren,
G. Bethe,
R. Hakenbeck, and H.-P. Heinz.
2000.
Detection of 23 immunogenic pneumococcal proteins using convalescent-phase serum.
Infect. Immun.
68:3740-3743 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |
