Previous Article | Next Article 
Journal of Bacteriology, November 2000, p. 6066-6074, Vol. 182, No. 21
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Sequence of the Genome of the Temperate, Serotype-Converting,
Pseudomonas aeruginosa Bacteriophage D3
Andrew M.
Kropinski*
Department of Microbiology and Immunology,
Faculty of Health Sciences, Queen's University, Kingston, Ontario
K7L 3N6, Canada
Received 14 June 2000/Accepted 16 August 2000
 |
ABSTRACT |
Temperate bacteriophage D3, a member of the virus family
Siphoviridae, is responsible for serotype conversion in its
host, Pseudomonas aeruginosa. The complete sequence of the
double-stranded DNA genome has been determined. The 56,426 bp contains
90 putative open reading frames (ORFs) and four genes specifying tRNAs.
The latter are specific for methionine (AUG), glycine (GGA), asparagine (AAC), and threonine (ACA). The tRNAs may function in the translation of certain highly expressed proteins from this relatively AT-rich genome. D3 proteins which exhibited a high degree of sequence similarity to previously characterized phage proteins included the
portal, major head, tail, and tail tape measure proteins, endolysin,
integrase, helicase, and NinG. The layout of genes was reminiscent of
lambdoid phages, with the exception of the placement of the endolysin
gene, which parenthetically also lacked a cognate holin. The greatest
sequence similarity was found in the morphogenesis genes to coliphages
HK022 and HK97. Among the ORFs was discovered the gene encoding the
fucosamine O-acetylase, which is in part responsible for
the serotype conversion events.
 |
INTRODUCTION |
Upon infection of sensitive cells,
the genomes of temperate bacteriophages have two pathways open to them:
development associated with cell lysis and the release of progeny
(lytic response), or repression of lytic development usually associated
with integration into the host chromosome and maintenance in a
quiescent state (lysogenic response). The best studied of the temperate
phages is bacteriophage lambda, which infects Escherichia
coli strains. This phage is the archetype of a group of
phylogenetically related viruses called the lambdoid phages. In many
cases temperate phages also alter the phenotype of the lysogenized
cells, resulting in the production of toxins or expression of surface
components resulting in alterations to the cells' antigenicity. This
phenomenon is called lysogenic conversion.
Bacteriophage D3 was obtained from a clinical isolate of
Pseudomonas aeruginosa by Holloway et al. (35),
who noted subsequently that lysogenization of host cells by phage D3
resulted in a change in the cells' serological properties
(34). Kuzio and Kropinski showed that the lipopolysaccharide
isolated from the lysogens [PAO(D3)] lacked receptor activity for
this phage and that the O-antigenic polysaccharide side chains were
chemically altered (41). Specifically, the hydroxyl group at
position 4 of the D-fucosamine residues became acetylated,
and the bonding between the trisaccharide repeats changed from
1
4
to
1
4. This results in the change of serotype from International
Antigenic Typing Scheme O5 to O16/20 (42, 43).
Simultaneously, the cells become both immune and resistant to
superinfection by D3. Extrapolating from the work with
Salmonella phage
15 (6, 45, 46), I hypothesized that three phage gene products might be involved in the
conversion: an inhibitor of the
-polymerase, a new
-polymerase, and a fucosamine O-acetylase. Extensive early attempts to
clone the conversion genes failed.
Work by Cavenagh and Miller (12) demonstrated that phage D3
integrates at two distinct loci on the P. aeruginosa genome, and subsequent studies showed that it probably utilized the Campbell model of insertion (25). Induction of D3 prophage results in low-frequency-transducing lysates in which genes adjacent to the attB sites are transduced (12). Sharp and
colleagues cloned the D3 cos sequences into a
broad-host-range plasmid and demonstrated efficient transductional
transfer between P. aeruginosa strains with wild-type D3
(60). The latter observation served as the basis for the
development of a cosmid cloning system for P. aeruginosa (62).
Electron microscopic studies have shown that D3 is a member of the B1
(isometric head) subgroup of the family Siphoviridae, possessing a head with a diameter of 55 nm and a long flexible tail (7 by 113 nm) possessing six tail fibers with terminal knobs (26). The genome is double-stranded DNA of 56.4 kb
(25) with 9-bp 3'-extended cohesive ends (61).
The reported base composition is 50 mol% GC (49), which is
unusually low relative to that (67 mol% GC) of its host, P. aeruginosa.
We have previously described the cloning and analysis of those regions
involved in immunity (21, 22) and capsid morphogenesis (26). The immunity region (repressor gene [c1]
and antirepressor [cro], together with the left
operator-promoter [OLPL] and right operator-promoter [ORPR] complexes) from D3,
is clearly homologous in structure and function to the immunity region
of lambdoid phages (21, 22). Furthermore, in the case of
both D3 and
, the repressor mRNAs originating from the promoter
for repressor maintenance (PRM) lack the typical
prokaryotic ribosome-binding sites (Shine-Dalgarno box), and the first
three nucleotides of the message code for formylmethionine.
Another point, which supports our contention that D3 is a
lambdoid phage, was the observation that the capsid morphogenesis genes
(portal-protease-major head protein) are laid out in the same
orientation as in coliphage HK97. In addition, the portal and head
proteins of these two phages show considerable sequence identity. Last,
the D3 capsid protein undergoes proteolytic processing and
cross-linking during head morphogenesis in a manner identical to that
of the coliphage (26).
While exhibiting considerable similarities, these two phages differ in
some significant ways. Their host range is restricted to either
E. coli (
) or P. aeruginosa (D3), making the
generation of recombinant phages problematic. Coliphage
DNA
exhibits extensive segmented base composition, while melting
temperature (Tm) analysis with D3 DNA indicates
that this occurs to only a limited extent in D3 (A. Kropinski,
unpublished results). The two phages are heteroimmune; that is, their
repressors do not bind to the other's operator sequences. In the case
of D3, the mRNA transcript from PRM originates from
within OR3, rather than upstream of OR3 as it
does in
. Analysis of 2 kb of D3 sequence data to the left of the
OLPL complex failed to demonstrate open reading
frames (ORFs) with homology to proteins in lambda (e.g., N) or its
relatives. While the DNA of coliphage
possesses 5'-extended
termini, that of phage D3, along with coliphages HK97 and HK022, has
3'-extended cohesive ends. These are 9 bases in the case of D3
(61) and 10 bases in the case of the latter two coliphages
(38). In addition, D3, unlike other lambdoid phages which
have been sequenced, encodes four tRNAs (63). Last, the sole
cellular receptor for coliphage
is the LamB protein, while the
receptor for D3 appears to be lipopolysaccharide (41).
To fully elucidate the relationship between D3 and other phages,
particularly of the lambdoid group, I have completed sequencing the
genome of D3. Analysis of the phage gene data indicates once gain that
viral evolution is a far more complex issue than simple family
relationships would explain.
 |
MATERIALS AND METHODS |
Cloning and sequencing.
Specific D3 HindIII,
SalI, EcoRI, SphI, PstI,
XbaI, BclI, and partial Sau3A
fragments were cloned into pGEM3Zf(+) and grown in E. coli
DH5
(F
80dlacZ
M15 recA1 endA1
gyrA96 thi-1 hsdR17 (rK
mK+) supE44 relA1 deoR
(lacZYA-argF) U169] (Gibco/BRL). The cultures were routinely grown in Terrific broth (Difco Laboratories) at 37°C.
Plasmid DNA was isolated by the alkaline lysis procedure with
treatments with boiled RNase A and extractions with
phenol-chloroform-isoamyl alcohol (27:24:1, vol/vol/vol) in the
presence of silicone high-vacuum grease (Dow Corning) (52)
prior to ethanol precipitation. DNA sequencing was carried out at the
Institute for Molecular Biology and Biotechnology (McMaster University,
Hamilton, Ontario, Canada) and the Guelph Molecular Supercenter
(Guelph, Ontario, Canada), using the dideoxy-chain termination method
(58) and Applied Biosystems automated fluorescence
sequencers. The complete sequence was obtained through sequencing the
termini of cloned fragments and primer walking on the clones. On
two occasions, PCR was required to obtain intervening sequence for
adjacent contigs.
Sequence assembly and analysis.
The results of automated
sequencing were collected, stripped of poor-quality data and vector
sequences, and assembled into contigs using Seqman II (DNASTAR Inc.).
ORFs were analyzed using ORF Finder at the National Center for
Biotechnology Information (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and
WebGeneMark.HMM (http://genemark.biology.gatech.edu/GeneMark/whmm.cgi). In
addition, the Find ORF feature of SeqEdit (DNASTAR) was used to
manually scan the sequence for potential genes. A
compendium of online tools
(http://www.queensu.ca/micr/faculty/kropinski/online.html) was used for analysis of the putative genes. Proteins translated at ORF
Finder or "translate tool" (http://www.expasy.ch/tools/dna.html) were scanned for homologs using BLASTP (2, 3) at
http://www.ncbi.nlm.nih.gov; their masses and isoelectric points were
determined online at ProtParam tools
(http://www.expasy.ch/tools/protparam.html). Where homologs
were identified, the sequences were compared using CLUSTAL W
(70) at the EMBL-European Bioinformatics Institute
(http://www2.ebi.ac.uk/clustalw/). In addition, Genestream's
(Institute de Génétique Humaine) program ALIGN at its
website (http://www2.igh.cnrs.fr /bin/align-guess.cgi) was used to
compare two sequences. Proteins were also examined using PROSITE
(4, 32) for conserved motifs at ExPASy-Swiss Institute of
Bioinformatics homepage (http://www.expasy.ch/tools/scnpsit1.html). To
predict transmembrane proteins, two online programs were used: TMPred
(33) at European Molecular Biology network-Swiss node (http://www.ch.embnet.org/software/TMPRED form.html) and
TMHMM (65) at the Center for Biological Sequence Analysis at
the Technical University of Denmark
(http://www.cbs.dtu.dk/services/TMHMM-1.0/).
For basic analysis of the DNA sequence, including restriction sites and
motifs, DNAMAN (Lynnon BioSoft, Vaudreuil, Quebec, Canada) and Omiga
(Oxford Molecular Group, Campbell, Calif.) were used. The DNA sequence
was scanned for putative tRNA species using tRNAScan (18,
47) at its website
(http://www.genetics.wustl.edu/eddy/tRNAscan-SE/) and FAStRNA
(19) at http://bioweb.
pasteur.fr/seqanal/interfaces/fastrna.html. Potential integration
host factor (IHF)-binding sites were assessed using
MacTargsearch (27) at SEQSCAN
(http://www.bmb.psu.edu/seqscan/seqform1.htm), while potential
transcriptional terminators (7, 8) were assessed using the
Genetics Computer Group program terminator at Bionavigator
(http://www.bionavigator.com).
Nucleotide sequence accession number.
The phage D3 sequence
has been deposited with GenBank (accession no. AF165214).
 |
RESULTS AND DISCUSSION |
Sequence of D3.
We have previously published reports
describing specific aspects of D3 and its sequence: analysis of the
cos (61) and immunity regions (21),
the existence of tRNA genes (63), and the identification of
those proteins involved in DNA packaging and capsid morphogenesis (26). The complete nucleotide sequence of D3 is 56,426 bp,
making it the largest Pseudomonas phage genome sequenced to
date, the next largest being the 35.5-kb, cytotoxin-converting phage
CTX (53). This value agrees completely with the mass
determined by restriction mapping (56.4 kb [25]) but
is significantly less than values calculated from the sedimentation
coefficient measured by Davison and colleagues (14) or the
mass calculated from electron micrographs by Miller and colleagues
(49). The work of Davison et al. (14) indicated
that D3 DNA was significantly larger than the genome of phage F116,
which Caruso and Shapiro have measured at 61.7 kb (10).
Furthermore, a size of 65 kb can be calculated from the data based on
electron micrographs and zone sedimentation by Miller and coworkers
(49). While estimations of mass based on sedimentation would
be influenced by the cohesive ends of the phage DNA which display a
strong tendency to form hydrogen-bonded circles (62), the
reason for the discrepancy based on electron microscopic data is unknown.
The overall base composition (57.8 mol% GC) is considerably higher
than the published value (50 mol% GC [
49]) but very
similar
to the value (58 mol% GC) derived on the basis of
Tm analysis
for the phage DNA (Kropinski,
unpublished). This value is still
significantly less than that of the
host bacterium (67 mol% GC),
which is unusual since the GC contents of
temperate phage genomes
usually closely match those of their hosts
(Kropinski, unpublished).
This may result in codon usage problems in
P. aeruginosa (see
below and reference
63). Unlike coliphage

DNA, which displays
segmented base composition (
64), the
Tm profile revealed only
one region of differing
base composition. This was verified by
measuring variations in base
composition across the genome length
(Fig.
1). The only region of higher than
expected AT content corresponds
to the position of the serotype
conversion gene (
orf28), suggesting
that this may have
arisen by lateral gene transfer from another
bacterium or phage with a
lower GC content.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Variation in AT content of D3 DNA presented as a
function of genome length. The horizontal line corresponds to the
average AT content (42.2 mol%), with the peak corresponding to the
region associated with conversion.
|
|
The restriction map published by Miller and Kokjohn (
48)
suggested multiple
BamHI sites, which I have been unable to
verify.
The map of Gertman et al. (
25) also contains several
errors
of fragment order. The genetic map (Fig.
2) is presented in the
same orientation
as that of coliphage

, with the repressor gene
located to the right
rather than the left, as published previously
(
25). The
previous
HindIII map (
25) indicated that the
fragments
were arrayed C-A-G-I-H-D-E-B-F; this has been corrected to
C-G-I-A-H-D-E-B-F.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
Arrangement of ORFs in D3 DNA, indicating those which
have significant sequence similarity or could otherwise be identified
(open arrows) and those of unknown function (filled arrows). Potential
Rho-independent terminators in the top and complementary strands are
presented as open and filled lollipops, respectively.
|
|
DNA motifs and their implication.
A number of DNA motifs have
been found in D3 DNA, including long direct repeats,
Rho-independent terminators, and putative CII- and IHF-binding
sites. Between nucleotides 29768 and 41830, seven direct repeats of 18, 23, 27, 28, 35, 210 and 247 bp were discovered. The significance
of these repeats is unknown.
Lambda protein CII is an activator, stimulating transcription by
binding to the opposite face of the DNA from that which the
RNA
polymerase binds in three promoters:
PRE
(promoter for repressor
establishment),
PI
(integrase promoter), and
PaQ (anti-Q promoter).
The P22 homolog, C1 protein, recognizes TTGCN
6TTGY
(
30), while
the lambda protein recognizes
TTGCN
6TTGC (
31). A search for
TTGCN
6TTGY identified five sites in D3 DNA, two of which
may play
a role in development. A

consensus CII-binding site
(TTGCN
6TTGC),
probably representing
PRE, was found within the
cII
gene (
orf71).
A site upstream of integrase
(
int) gene may represent a region
homologous to the phage
P22 promoter P
al, which is a C1-activated
anti-integrase
promoter (
30). Farinha and colleagues (
21)
identified a number of promoters, including P
L,
P
R, and P
RM in
D3 DNA through cloning into a
chloramphenicol acetyltransferase
reporter gene vector. They also
reported that two strong promoters
existed downstream of the immunity
region which were not affected
by repression in lysogens. One of these,
contained within the
SphI R fragment, lies between bases
53879 and 54693, that is,
between the tRNA genes and
orf90,
and may represent the late promoter
for this phage. The fact that it is
constitutive suggests that
we have stripped it away from its normal
regulatory circuits.
While a number of potential

54 promoters lie in
this region,
the exact location of the promoter and its function remain
unresolved.
This also applies to the promoter found in the
SphI B fragment
(
21).
In bacteria and their phages, termination of transcription occurs in a
factor (Rho)-dependent (
54) or -independent (
13,
57) manner. The intrinsic mode of transcription termination
is
often characterized by a GC-rich sequence that could form a
stem-loop
structure immediately followed by a run of thymidine
residues. Using
the search algorithm of Brendel and colleagues
(
7,
8) I was
able to identify many potential Rho-independent
terminators. Those that
fell between genes are listed in Table
1
and illustrated in Fig.
2. Interestingly, all of the putative
terminators lie to the left of the repressor (
c1) gene.
Since
one might expect that the morphogenesis genes would be expressed
from the late promoter, the presence of sites following
orf15 and
orf18 suggests that these may function
to modulate expression
of downstream genes. The existence of
factor-independent termination
motifs flanking
orf29,
followed by a region apparently devoid
of ORFs, suggests that the
endolysin gene (
orf30) may have its
own promoter.
In many lambdoid phages, the switch from immediate-early to
delayed-early gene expression is regulated through antitermination
by a
small (98- to 127-amino-acid) basic (pI 8.1 to 11.7) protein
which in
lambda is called N (
24). In addition, antitermination
is
dependent on the presence of several host proteins, including
RNA
polymerase, NusA, -B, -E, and -G, Rho, and ribosomal protein
S10, and
cis-acting sites on the RNA. The Nut (N-utilization)
region
is comprised of two nucleotide motifs,
boxA, which is
conserved
in sequence (CGCTCTTTAACA), and a downstream
sequence (
boxB) which
is not (
23). The
latter is capable of forming a small stem-loop
structure and is
associated with RNA polymerase-NusA-NusG-S10
binding, while NusB
and N bind to the former. We have detected
a
boxA site
between genes 68 and 69, suggesting that transcriptional
antitermination catalyzed by an N-type protein may exist in phage
D3
early transcription (
51) (Fig.
3). All attempts to identify
N-like
proteins using BLASTP or sequence examination for conserved
motifs such
as those found in P22, ES18, L (ICNIIDSIF), H-19B,
HK97, or 933W
(MTRRTQFKNSR) failed to identify an N homolog in
D3.
The possible exception is the product of
orf67, which has
a
short motif (KARR) in common with

21 gpN. A hyphenated stem-loop
structure
(
GA
GCCAACA
GGCG
C) is
found 9 bp downstream of
boxA and
may function as the
boxB analog in this phage.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
DNA sequence of the putative immediate-early leftward
transcription region showing locations of the terminator downstream of
c1, operators (OL1 and OL2), and
NutL (boxA sequence), each in boldface and underlined.
Asterisks mark PL, which overlaps the operators; the
position of orf68 is also indicated.
|
|
Description of selected ORFs.
ORFs were designated very
carefully, and as a result five regions apparently lack ORFs. These are
between orf27 and -28, orf41 and
42, orf68 and 69, and the first and
second tRNA genes and from orf95 to the end of the sequence.
Otherwise, the ORFs were fairly densely packed, with many incidences of
overlapping gene sequences. A total of 94 potential genes were
discovered, of which 60 (63%) encoded polypeptides that showed no
homology to proteins in the GenBank databases using the BLASTP search
algorithm (Fig. 2; Table
2). The
properties of some of those which showed sequence similarity will be
discussed below, with special emphasis on the 17 ORFs that encode
proteins that are significantly similar to proteins of
characterized lambdoid phages.
Morphogenesis genes.
We have previous shown that the
pathway for capsid morphogenesis closely resembles that of coliphage
HK97, with the prohead undergoing a number of transformations including
proteolysis and cross-linking (26). Recent data from Juhala
et al. on the completed sequence of lambdoid coliphages HK022 (GenBank
accession no. AF069308) and HK97 (AF069529) proved most useful in
the determination of which of the D3 gene products corresponded to
other structural proteins (38). The sequence of ORF16 was
60% identical to that of HK022 gp12, which is the major tail
protein. Interestingly, it is also shares 62% identity with
a P. aeruginosa prophage protein. The product of
D3 orf17 is a protein of 119 amino acids that shares 56%
identity with the 161-amino-acid-containing tail protein (gp13) of phage HK022. In addition, the products of D3 orf10,
-14, and -15 show 41, 42, and 58% identity with
HK022 gp9, 10, and 11, respectively. Gene 19 specifies a
88-kDa protein with sequence similarity (32% identity) to tail
tape measure protein of coliphage HK022.
Conversion.
The 687-amino-acid product of orf28
shows homology to a variety of proteins which have been identified as
acetylases. These include the product of the Salmonella
enterica serovar Typhimurium oaf gene and the WbpC
protein of P. aeruginosa (GenBank accession no. 1545849; E
[expect] value of 4 × 10
41). In both
cases, the overall sequence identity is 26%. Other hypothetical or
inferred acetylases which show sequence relatedness include those from
Rhizobium (1531614),
Mycobacterium (CAA17305), Bacillus, and Caenorhabitis (2291126),
with E values of 4 × 10
21 to 5 × 10
36. This protein gave no hits with PROSITE but did so
with pfam, indicating motifs found in a number of transport
proteins including the xanthine/uracil permease family. Using TMPred
and THMMH to evaluate this protein, 11 strong transmembrane regions are
predicted with the amino terminus in the cytoplasm and the carboxy
terminus in the periplasm. The original hypothesis had suggested that
three proteins would be involved in the conversion event: an
O-acetylase, a
-polymerase, and an inhibitor of the host
-polymerase (41). While the sequence evidence is strong
for the first protein, neither of the others was identified in this
study. In view of the fact that adjacent to orf28 are
regions apparently deficient in ORFs, it is possible that the other
conversion genes map in these regions but are sufficiently
dissimilar from the normal D3 ORFs to have been ignored. It
is interesting that this protein has such a high molecular
weight, while those acetyltransferases which modify antibiotics are
significantly smaller (39). The multiple transmembrane domain of this protein may facilitate acetyl coenzyme A transport to
periplasms or organization of a macromolecular membrane complex involved in O-antigen biosynthesis.
Lysis.
The product of orf31 is a polypeptide of 160 amino acids with strong homology to certain bacteriophage
lyzozymes. The degrees of sequence identity to the
, P2, 186, HK022, and HK97 endolysins are 54.5, 48.8, 48.2, 55.1, and
55.1%, respectively. Lambda endolysin, which has a
high affinity for GlcNAc polymers (16), functions as a
transglucosylase to cleave glycosidic bonds between the
C-1 of MurNAc and C-4 of GlcNAc residues in cell wall
peptidoglycan. Its active site has been defined by site-directed
mutagenesis (37) as Glu19, which lies, with its side chain
exposed, in a cleft between the two domains of the protein
(20). In the case of the homologous protein in D3, which has
a slightly longer amino-terminal region, this corresponds to Glu25. D3,
HK97, HK022, and
endolysins have two oligopeptides in common at the
amino (AFLDMLAWSEGT) and carboxyl (CSNIWASLPGAGYGQ) termini of
the proteins.
With the possible exception of coliphage T4 and
Staphylococcus
aureus phage 187, in all phages studied the endolysin gene
is
preceded or overlapped by a gene encoding a holin. This protein
creates
pores in the inner or cytoplasmic membrane permitting
the endolysin to
access the peptidoglycan layer in the periplasm,
resulting in cell
lysis and release of progeny viruses. In the
case of T4, the holin gene
is unlinked to the endolysin (E. Cutter,
personal communication), while
in phage 187 the holin gene is
completely embedded within the endolysin
gene (
44). These proteins
are characterized by their
relatively small size (71 to 161 amino
acid residues), the existence of
two to three membrane-spanning
helices, and poor sequence identity to
other members of this group
of functionally similar proteins
(
28,
72,
73). Furthermore,
they sometimes possess a
dual-translation start regulatory motif;
for example, the holins
of coliphages

, HK97, and HK022 begin
MetLysMet, whereas that of
the phage 187 holin starts with MetLeuMet.
With the possible
exception of the
O-acetylase, no D3 protein
displaying
these features was identified in the D3
sequence.
Integration.
The sequence of integrase (ORF35) was 27.1%
identical to the integrase sequence from filamentous Shigella
flexneri phage SfX, which is a member of the virus family
Inoviridae. It contained within it two conserved motifs,
HDLRHT and RYAH. This gene and my analysis of the integration of the
phage will be the subject of a future communication.
Immunity region.
Our first published data on D3
(21) suggested that the immunity region was arranged very
similarly to that of coliphage
. Furthermore, while sequence
similarity between
CI and D3 C1 proteins was poor, residues
which were shown be to essential for
repressor function were
strongly conserved in the D3 repressor. The
ORPR complex contained three operators
and two promoters (PR and PRM) as it did in
phage
. One fundamental difference exists between the spatial
arrangement of genes in the classical lambdoid phages and in
Pseudomonas phage D3, that is, the lack of intervening nucleotide sequence between cro and cII. In
this region contains a Rho-independent transcriptional terminator
(tR1) in addition to sites involved in antitermination.
The region to the left of the
c1 gene is illustrated in Fig.
3. This region contains two putative Rho-independent terminators
(t
L1 and t
c1), the Nut site, and two genes
(
orf67 and
orf68).
Overlapped
orf67 is
another potential genes (
orf67A) which is
not listed in
Table
1 but contains a sequence (THW-P-PEPPQ) which
is also found in
two hypothetical proteins, the products of genes
L0065 and
orf4 from coliphages 933W (GenBank accession no.
AAD25410)
(
57) and VT2-Sa (BA84287) (
50), respectively.
This protein
would have a mass of 6.9 kDa and a pI of 5.8. Furthermore,
the
alleged P
L overlaps the O
L1 and
O
L2 and has the sequence
TTGACAACGAATATGAGCAATCT
CATACT.
The
bases in bold match the consensus

70 promoter sequence in
the

35
box completely and at the

10 site by four out of six
bases.
DNA replication.
We have shown that replication of D3 DNA
involves a switch, as it does in
, from a theta to a sigma mode
during lytic development (60, 62). DNA replication in
coliphage
involves assembly of an activated replication complex
involving gpO, gpP, and a variety of host proteins, including primase
(DnaG) and helicase (DnaB), at the origin of replication
ori
(69). This region also contains
DnaA-binding sites (68). While D3 DNA encodes a 37-kDa basic
protein with homology to
gpO, there is no indication of a gpP
homolog or DnaA-binding sites (consensus TTWTNCACA
[59]). In its stead D3 possesses, as do certain other
phages including Salmonella serovar Typhimurium phage
P22 (36), a helicase homolog with a mass of 49 kDa. In this
case, the greatest sequence similarity is shown to the
Bacillus subtilis DnaB helicase.
tRNAs.
Using tRNAscan-SE (47) and FAStRNA
(19), Sibbald and Kropinski identified four tRNA genes in
the delayed-early region of the bacteriophage D3 genome
(63). These are specific for methionine (AUG), glycine
(GGA), asparagine (AAC), and threonine (ACA). In D3, Thr- and Gly-tRNAs
recognize codons which are rarely used in P. aeruginosa and
presumably influence the rate of translation of phage proteins. Two
codons, AGA (Arg) and AUA (Ile), are rarely used in E. coli but employed more frequently in coliphage
. It has been
noted that the
integrase has a higher proportion of the rare
arginine codons AGA and AGG and that this influences expression of this
gene (74). Taking two pairs of proteins which one would
expect to be expressed at different levels, capsid (orf6) and major tail protein (orf16), compared with repressor
(orf69) and integrase (orf35), it was noted that
certain codons are favored in the highly expressed genes. These include
UUC (Phe) and AAC (Asn), while UCA (Ser), AUA (Ile), ACA (Ala), AGG
(Arg), and both GGA and GGG (Gly) are selected against in the highly
expressed proteins. This presents a conundrum as to why this phage
should have tRNA genes for GlyGGA, AsnAAC, and
MetATG.
Phage evolution.
The phylogeny of phages has been discussed in
two excellent reviews by Campbell (9) and Casjens et al.
(11). Relationships have been hypothesized through
similarities in morphology, conservation of gene arrangement, ability
to recombine, cross-hybridization patterns, and sequence. Hendrix and
colleagues have stated that while conserved patterns exist, which
indicates familial relationships, the overall picture suggests that
considerable intervirus or virus-host recombination has occurred, often
between distant bacterial groups (29). Their proposition is
that all double-stranded DNA phage genomes are "mosaics with access,
by horizontal exchange, to a large common genetic pool but in which
access to the gene pool is not uniform for all phages." The data
presented for D3 show clear evidence that this type of evolutionary
process may have operated in the evolution of this
Pseudomonas phage, making it the first bacteriophage outside
the family Enterobacteriaceae that clearly shows
phylogenetic relatedness to members of the lambdoid family of
coliphages. With minor exceptions, including the placement of the
lyzozyme gene, the genomic layout, particularly the morphogenesis
and immunity-replication regions, mimics that of lambdoid phages. This
is borne out by the sequence data which suggest that D3 is most closely
related to HK022 and HK97, both well-recognized members of the lambdoid
group. In part, this may be expected since the databases are
overrepresented by data from enterobacterial phages and have only a
limited selection of genome data from the large Pseudomonas
phages. While E. coli and its relatives and the fluorescent
pseudomads (55) are both members of the
subdivision of
the phylum Proteobacteria (66), they are only
distantly related. Other intriguing data suggest a relationship between
D3 and members of the Siphoviridae infecting gram-positive bacteria, particularly those of the lactic acid bacteria of the genera
Streptococcus and Lactobacillus. D3 proteins
involved in packaging (terminase large subunit) show sequence
similarity to analogous proteins of B. subtilis phage
105
(K. Kobayashi, K. Okamura, T. Inouse, T. Sato, and Y. Kobayashi,
unpublished data [GenBank accession no. BAA36628]) and
Lactobacillus casei phage A2 (J. E. Suarez,
unpublished data [GenBank accession no. LCA251790]), while the
capsid maturation protease appears related to ClpP proteases from
Lactobacillus gasseri phage
adh (1) and
Streptococcus thermophilus phages
7201 (67),
DT1 (71), and Sfi21 (15). Furthermore, in the
case of many of the phage genomes for gram-positive bacteria, the
endolysin genes are found downstream of those involved in morphogenesis
whereas in the classical lambdoid phages these genes are located before
those genes involve in morphogenesis. These results suggest a bipartite
ancestry to D3 involving recombination between phages of gram-positive
bacteria and a protolambdoid phage with the packaging originating among the phage of gram-positive bacteria, while the remainder of the phage
genome evolved from lambdoid phages of gram-negative bacteria. This
could occur following the superinfection of a common host cell by two
different species of phages (or DNA) or through recombination between
superinfecting and resident prophage genomes. Those phages that had the
ability to infect different species could then pass on the new genomic
segments, ultimately resulting in unrelated bacteriophages possessing
homologous genes. From an ecological perspective, lactic acid bacteria
and pseudomonads have been isolated from the rumen (5),
while both Bacillus species and pseudomonads are soil
microorganisms, resulting in the potential for genetic exchange through
transformation (17, 40).
In all phages examined to date, a considerable percentage of the ORFs
do not encode proteins with homologs in the current
database. It is
imperative that GenBank contain more annotated
phage sequence data,
representing complete phage genomes, so that
useful conclusions can
drawn about the nature of these unknown
genes and the evolution of
phages.
 |
ACKNOWLEDGMENTS |
This research was funded by a grant from the Natural Sciences and
Engineering Research Council of Canada.
Thanks are extended to Brad Cooney (Guelph Molecular Supercentre,
Guelph, Ontario, Canada) and Brian Allore (MOBIX, The Institute for
Molecular Biology and Biotechnology, McMaster University, Hamilton,
Ontario, Canada) for the DNA sequencing. To all my students and
research associates, particularly Mark Farinha, Robert Sharp, Mali
Galakjan, and Mary-Jo Sibbald, many thanks for their contributions to
this project, and thanks also to Harrald Bruessow for useful discussions on phage evolution.
 |
FOOTNOTES |
*
Mailing address: Room 743 Botterell Hall, Department of
Microbiology and Immunology, Queen's University, Kingston, Ontario K7L
3N6, Canada. Phone: (613) 533-2459. Fax: (613) 533-6796. E-mail: kropinski{at}post.queensu.ca.
 |
REFERENCES |
| 1.
|
Altermann, E.,
J. R. Klein, and B. Henrich.
1999.
Primary structure and features of the genome of the Lactobacillus gasseri temperate bacteriophage adh.
Gene
236:333-346[CrossRef][Medline].
|
| 2.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 3.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-4022[Abstract/Free Full Text].
|
| 4.
|
Bairoch, A.
1992.
PROSITE: a dictionary of sites and patterns in proteins.
Nucleic Acids Res.
11:2013-2088[Abstract/Free Full Text].
|
| 5.
|
Biesheuvel, M. H.,
P. G. Bijker, and H. A. Urlings.
1991.
Some aspects of the gastrointestinal microflora of veal calves fed different rations: a pilot study.
Vet. Q.
13:97-104[Medline].
|
| 6.
|
Bray, D., and P. W. Robbins.
1967.
Mechanism of 15 conversion studied with bacteriophage mutants.
J. Mol. Biol.
30:457-475[CrossRef][Medline].
|
| 7.
|
Brendel, V.,
G. H. Hamm, and E. N. Trifonov.
1986.
Terminators of transcription with RNA polymerase from Escherichia coli: what they look like and how to find them.
J. Biomol. Struct. Dyn.
3:705-723[Medline].
|
| 8.
|
Brendel, V., and E. N. Trifonov.
1984.
A computer algorithm for testing potential prokaryotic terminators.
Nucleic Acids Res.
12:4411-4427[Abstract/Free Full Text].
|
| 9.
|
Campbell, A.
1994.
Comparative molecular biology of lambdoid phages.
Annu. Rev. Microbiol.
48:193-222[CrossRef][Medline].
|
| 10.
|
Caruso, M., and J. A. Shapiro.
1999.
Interactions of Tn7 and temperate phage F116L of Pseudomonas aeruginosa.
Mol. Gen. Genet.
188:292-298[CrossRef].
|
| 11.
|
Casjens, S.,
G. F. Hatfull, and R. Hendrix.
1992.
Evolution of dsDNA tailed bacteriophage genomes, p. 383-397.
In
E. Koonin (ed.), Seminars in virology. Academic Press, London, England.
|
| 12.
|
Cavenagh, M. M., and R. V. Miller.
1986.
Specialized transduction of Pseudomonas aeruginosa PAO by bacteriophage D3.
J. Bacteriol.
165:448-452[Abstract/Free Full Text].
|
| 13.
|
Das, A.
1993.
Control of transcription termination by RNA-binding proteins.
Annu. Rev. Biochem.
62:893-930[CrossRef][Medline].
|
| 14.
|
Davison, P. F.,
D. Freifelder, and B. W. Holloway.
1964.
Interruptions in the polynucleotide strands in bacteriophage DNA.
J. Mol. Biol.
8:1-10.
|
| 15.
|
Desiere, F.,
S. Lucchini, and H. Brüssow.
1998.
Evolution of Streptococcus thermophilus bacteriophage genomes by modular exchanges followed by point mutations and small deletions and insertions.
Virology
241:345-356[CrossRef][Medline].
|
| 16.
|
Duewel, H. S.,
E. Daub, and J. F. Honek.
1995.
Investigations of the interactions of saccharides with the lysozyme from bacteriophage lambda.
Biochim. Biophys. Acta
1247:149-158[CrossRef][Medline].
|
| 17.
|
Duncan, S. H.,
C. J. Doherty,
J. R. Govan,
S. Neogrady,
P. Galfi, and C. S. Stewart.
1999.
Characteristics of sheep-rumen isolates of Pseudomonas aeruginosa inhibitory to the growth of Escherichia coli O157.
FEMS Microbiol. Lett.
180:305-310[CrossRef][Medline].
|
| 18.
|
Eddy, S. R., and R. Durbin.
1994.
RNA sequence analysis using covariance models.
Nucleic Acids Res.
22:2079-2088[Abstract/Free Full Text].
|
| 19.
|
El-Mabrouk, N., and F. Lisacek.
1996.
Very fast identification of RNA motifs in genomic DNA. Application to tRNA search in the yeast genome.
J. Mol. Biol.
264:46-55[CrossRef][Medline].
|
| 20.
|
Evrard, C.,
J. Fastrez, and J. P. Declercq.
1998.
Crystal structure of the lysozyme from bacteriophage lambda and its relationship with V and C-type lysozymes.
J. Mol. Biol.
276:151-164[CrossRef][Medline].
|
| 21.
|
Farinha, M. A.,
B. J. Allan,
E. M. Gertman,
S. L. Ronald, and A. M. Kropinski.
1994.
Cloning of the early promoters of Pseudomonas aeruginosa bacteriophage D3: sequence of the immunity region of D3.
J. Bacteriol.
176:4809-4815[Abstract/Free Full Text].
|
| 22.
|
Farinha, M. A., and A. M. Kropinski.
1997.
Overexpression, purification, and analysis of the c1 repressor protein of Pseudomonas aeruginosa bacteriophage D3.
Can. J. Microbiol.
43:220-226[Medline].
|
| 23.
|
Franklin, N. C.
1984.
Conservation of genome form but not sequence in the transcription antitermination determinants of bacteriophages lambda, phi 21 and P22.
J. Mol. Biol.
181:75-84.
|
| 24.
|
Franklin, N. C.
1985.
"N" transcription antitermination proteins of bacteriophages , 21 and P22.
J. Mol. Biol.
181:85-91[CrossRef][Medline].
|
| 25.
|
Gertman, E.,
D. Berry, and A. M. Kropinski.
1987.
Serotype-converting bacteriophage D3 of Pseudomonas aeruginosa: vegetative and prophage restriction maps.
Gene
52:51-57[CrossRef][Medline].
|
| 26.
|
Gilakjan, Z. A., and A. M. Kropinski.
1999.
Cloning and analysis of the capsid morphogenesis genes of Pseudomonas aeruginosa bacteriophage D3: another example of protein chainmail?
J. Bacteriol.
181:7221-7227[Abstract/Free Full Text].
|
| 27.
|
Goodrich, J. A.,
M. L. Schwartz, and W. R. McClure.
1990.
Searching for and predicting the activity of sites for DNA binding proteins: compilation and analysis of the binding sites for Escherichia coli integration host factor (IHF).
Nucleic Acids Res.
18:4993-5000[Abstract/Free Full Text].
|
| 28.
|
Grundling, A.,
U. Blasi, and R. Young.
2000.
Biochemical and genetic evidence for three transmembrane domains in the class I holin, lambda S.
J. Biol. Chem.
275:769-776[Abstract/Free Full Text].
|
| 29.
|
Hendrix, R.,
M. C. Smith,
R. N. Burns,
M. E. Ford, and G. F. Hatfull.
1999.
Evolutionary relationships among diverse bacteriophages and prophages: all the world's a phage.
Proc. Natl. Acad. Sci. USA
96:2192-2197[Abstract/Free Full Text].
|
| 30.
|
Ho, Y. S.,
D. Pfarr,
J. Strickler, and M. Rosenberg.
1992.
Characterization of the transcription activator protein C1 of bacteriophage P22.
J. Biol. Chem.
267:14388-14397[Abstract/Free Full Text].
|
| 31.
|
Ho, Y. S., and M. Rosenberg.
1985.
Characterization of a third, cII-dependent, coordinately activated promoter on phage lambda involved in lysogenic development.
J. Biol. Chem.
260:11838-11844[Abstract/Free Full Text].
|
| 32.
|
Hofmann, K.,
P. Bucher,
L. Falquet, and A. Bairoch.
1999.
The PROSITE database, its status in 1999.
Nucleic Acids Res.
27:215-219[Abstract/Free Full Text].
|
| 33.
|
Hofmann, K., and W. Stoffel.
1993.
TMbase a database of membrane spanning proteins segments.
Biol. Chem. Hoppe-Seyler
347:166-175.
|
| 34.
|
Holloway, B. W., and G. N. Cooper.
1962.
Lysogenic conversion in Pseudomonas aeruginosa.
J. Bacteriol.
84:1324.
|
| 35.
|
Holloway, B. W.,
J. B. Egan, and M. Monk.
1960.
Lysogeny in Pseudomonas aeruginosa.
Aust. J. Exp. Biol.
38:321-330[Medline].
|
| 36.
|
IIyina, T. V.,
A. E. Gorbalenya, and E. V. Koonin.
1992.
Organization and evolution of bacterial and bacteriophage primase-helicase systems.
J. Mol. Evol.
34:351-357[CrossRef][Medline].
|
| 37.
|
Jespers, L.,
E. Sonveaux, and J. Fastrez.
1992.
Is the bacteriophage lambda lysozyme an evolutionary link or a hybrid between the C and V-type lysozymes? Homology analysis and detection of the catalytic amino acid residues.
J. Mol. Biol.
228:529-538[CrossRef][Medline].
|
| 38.
|
Juhala, R. J.,
M. E. Ford,
R. L. Duda,
A. Youlton,
G. F. Hatfull, and R. W. Hendrix.
2000.
Genetic sequences of bacteriophages HK97 and HK022: pervasive genetic mosaicism in the lambdoid bacteriophages.
J. Mol. Biol.
299:27-51[CrossRef][Medline].
|
| 39.
|
Kato, T.,
K. Hirai, and K. Okuda.
1995.
Identification of a chromosomally encoded kanamycin acetylase in Porphyromonas gingivalis.
FEMS Microbiol. Lett.
131:301-306[CrossRef][Medline].
|
| 40.
|
Kozak, S., and C. W. Forsberg.
1979.
Transformation of mercuric chloride and methylmercury by the rumen microflora.
Appl. Environ. Microbiol.
38:626-636[Abstract/Free Full Text].
|
| 41.
|
Kuzio, J., and A. M. Kropinski.
1983.
O-antigen conversion in Pseudomonas aeruginosa PAO1 by bacteriophage D3.
J. Bacteriol.
155:203-212[Abstract/Free Full Text].
|
| 42.
|
Liu, P. V.,
H. Matsumoto,
H. Kusama, and T. Bergan.
1983.
Survey of heat-stable, major somatic antigens of Pseudomonas aeruginosa.
Int. J. Syst. Bacteriol.
33:256-264[Abstract/Free Full Text].
|
| 43.
|
Liu, P. V., and S. Wang.
1990.
Three new major somatic antigens of Pseudomonas aeruginosa.
J. Clin. Microbiol.
28:922-925[Abstract/Free Full Text].
|
| 44.
|
Loessner, M. J.,
S. Gaeng, and S. Scherer.
1999.
Evidence for a holin-like protein gene fully embedded out of frame in the endolysin gene of Staphylococcus aureus bacteriophage 187.
J. Bacteriol.
181:4452-4460[Abstract/Free Full Text].
|
| 45.
|
Losick, R.
1969.
Isolation of a trypsin-sensitive inhibitor of O-antigen synthesis involved in lysogenic conversion by bacteriophage 15.
J. Mol. Biol.
42:237-246[CrossRef][Medline].
|
| 46.
|
Losick, R., and P. W. Robbins.
1967.
Mechanism of 15 conversion studied with a bacterial mutant.
J. Mol. Biol.
30:445-455[CrossRef][Medline].
|
| 47.
|
Lowe, T. M., and S. R. Eddy.
1997.
tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.
Nucleic Acids Res.
25:955-964[Abstract/Free Full Text].
|
| 48.
|
Miller, R. V., and T. A. Kokjohn.
1987.
Cloning and characterization of the c1 repressor of Pseudomonas aeruginosa bacteriophage D3: a functional analog of phage lambda cI protein.
J. Bacteriol.
169:1847-1852[Abstract/Free Full Text].
|
| 49.
|
Miller, R. V.,
J. M. Pemberton, and K. E. Richards.
1974.
F116, D3, and G101: temperate bacteriophages of Pseudomonas aeruginosa.
Virology
59:566-569[CrossRef][Medline].
|
| 50.
|
Miyamoto, H.,
W. Nakai,
N. Yajima,
A. Fujibayashi,
T. Higuchi,
K. Sato, and A. Matsushiro.
1999.
Sequence analysis of Stx2-converting phage VT2-Sa shows a great divergence in early regulation and replication regions.
DNA Res.
6:235-240[Abstract].
|
| 51.
|
Mogridge, J.,
T. F. Mah, and J. Greenblatt.
1998.
Involvement of boxA nucleotides in the formation of a stable ribonucleoprotein complex containing the bacteriophage lambda N protein.
J. Biol. Chem.
273:4143-4148[Abstract/Free Full Text].
|
| 52.
|
Mukhopadhyay, T., and J. A. Roth.
1993.
Silicone lubricant enhances recovery of nucleic acids after phenol-chloroform extraction.
Nucleic Acids Res.
21:781-782[Free Full Text].
|
| 53.
|
Nakayama, K.,
S. Kanaya,
M. Ohnishi,
Y. Terawaki, and T. Hayashi.
1999.
The complete nucleotide sequence of CTX, a cytotoxin-converting phage of Pseudomonas aeruginosa: implications for phage evolution and horizontal gene transfer via bacteriophages.
Mol. Microbiol.
31:399-419[CrossRef][Medline].
|
| 54.
|
Opperman, T., and J. P. Richardson.
1994.
Phylogenetic analysis of sequences from diverse bacteria with homology to the Escherichia coli rho gene.
J. Bacteriol.
176:5033-5043[Abstract/Free Full Text].
|
| 55.
|
Palleroni, N. J.,
R. Kunisawa,
R. Contopoulou, and M. Doudoroff.
1973.
Nucleic acid homologies in the genus Pseudomonas.
Int. J. Syst. Bacteriol.
23:333-339.
|
| 56.
|
Plunkett, G. 3.,
D. J. Rose,
T. J. Durfee, and F. R. Blattner.
1999.
Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product.
J. Bacteriol.
181:1767-1778[Abstract/Free Full Text].
|
| 57.
|
Reynolds, R.,
R. M., and M. J. Chamberlin.
1992.
Parameters affecting transcription termination by Escherichia coli RNA polymerase. I. Analysis of 13 rho-independent terminators.
J. Mol. Biol.
224:31-51[CrossRef][Medline].
|
| 58.
|
Sanger, F.,
A. R. Coulson,
G. F. Hong,
D. F. Hill, and G. B. Peterson.
1982.
Nucleotide sequence of bacteriophage lambda DNA.
J. Mol. Biol.
162:729-773[CrossRef][Medline].
|
| 59.
|
Schaper, S., and W. Messer.
1995.
Interaction of the initiator protein DnaA of Escherichia coli with its DNA target.
J. Biol. Chem.
270:17622-17626[Abstract/Free Full Text].
|
| 60.
|
Sharp, R.,
E. Gertman,
M. A. Farinha, and A. M. Kropinski.
1990.
Transduction of a plasmid containing the bacteriophage D3 cos site in Pseudomonas aeruginosa.
J. Bacteriol.
172:3509-3511[Abstract/Free Full Text].
|
| 61.
|
Sharp, R.,
I. S. Jansons,
E. Gertman, and A. M. Kropinski.
1996.
Genetic and sequence analysis of the cos region of the temperate Pseudomonas aeruginosa bacteriophage, D3.
Gene
177:47-53[CrossRef][Medline].
|
| 62.
|
Sharp, R. W.
1991.
Development of a cosmid cloning system for Pseudomonas aeruginosa. Doctoral dissertation.
Queen's University, Kingston, Ontario, Canada.
|
| 63.
|
Sibbald, M. J., and A. M. Kropinski.
1999.
Transfer RNA genes and their significance to codon usage in the Pseudomonas aeruginosa lamboid bacteriophage D3.
Can. J. Microbiol.
45:791-796[CrossRef][Medline].
|
| 64.
|
Skalka, A.,
E. Burgi, and A. D. Hershey.
1968.
Segmental distribution of nucleotides in the DNA of bacteriophage lambda.
J. Mol. Biol.
34:1-16[CrossRef][Medline].
|
| 65.
|
Sonnhammer, E. L. L.,
G. von Heijne, and A. Krogh.
1998.
A hidden Markov model for predicting transmembrane helices in protein sequences, p. 175-182.
In
J. Glasgow, T. Littlejohn, F. Major, R. Lathrop, D. Sankoff, and C. Sensen (ed.), Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology. AAAI Press, Menlo Park, Calif.
|
| 66.
|
Stackbrandt, E.,
R. G. E. Murray, and H. Truper.
1988.
Proteobacteria classis nov., a name for the phylogenetic taxon that includes the purple bacteria and their relatives.
Int. J. Syst. Bacteriol.
38:321-325[Abstract/Free Full Text].
|
| 67.
|
Stanley, E.,
L. Walsh,
Z. A. van der,
G. F. Fitzgerald, and D. van Sinderen.
2000.
Identification of four loci isolated from two Streptococcus thermophilus phage genomes responsible for mediating bacteriophage resistance.
FEMS Microbiol. Lett.
182:271-277[CrossRef][Medline].
|
| 68.
|
Szalewska-Palasz, A.,
C. Weigel,
C. Speck,
S. Srutkowska,
G. Konopa,
R. Lurz,
J. Marszalek,
K. Taylor,
W. Messer, and G. Wegrzyn.
1998.
Interaction of the Escherichia coli DnaA protein with bacteriophage lambda DNA.
Mol. Gen. Genet.
259:679-688[CrossRef][Medline].
|
| 69.
|
Taylor, K., and G. Wegrzyn.
1995.
Replication of coliphage lambda DNA.
FEMS Microbiol. Rev.
17:109-119[CrossRef][Medline].
|
| 70.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 71.
|
Tremblay, D. M., and S. Moineau.
1999.
Complete genomic sequence of the lytic bacteriophage DT1 of Streptococcus thermophilus.
Virology
255:63-76[CrossRef][Medline].
|
| 72.
|
Young, R.
1992.
Bacteriophage lysis: mechanism and regulation.
Microbiol. Rev.
56:430-481[Abstract/Free Full Text].
|
| 73.
|
Young, R., and U. Blasi.
1995.
Holins: form and function in bacteriophage lysis.
FEMS Microbiol. Rev.
17:191-205[CrossRef][Medline].
|
| 74.
|
Zahn, K., and A. Landy.
1996.
Modulation of lambda integrase synthesis by rare arginine tRNA.
Mol. Microbiol.
21:69-76[CrossRef][Medline].
|
Journal of Bacteriology, November 2000, p. 6066-6074, Vol. 182, No. 21
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Winstanley, C., Langille, M. G.I., Fothergill, J. L., Kukavica-Ibrulj, I., Paradis-Bleau, C., Sanschagrin, F., Thomson, N. R., Winsor, G. L., Quail, M. A., Lennard, N., Bignell, A., Clarke, L., Seeger, K., Saunders, D., Harris, D., Parkhill, J., Hancock, R. E.W., Brinkman, F. S.L., Levesque, R. C.
(2009). Newly introduced genomic prophage islands are critical determinants of in vivo competitiveness in the Liverpool Epidemic Strain of Pseudomonas aeruginosa. Genome Res
19: 12-23
[Abstract]
[Full Text]
-
Ceyssens, P.-J., Mesyanzhinov, V., Sykilinda, N., Briers, Y., Roucourt, B., Lavigne, R., Robben, J., Domashin, A., Miroshnikov, K., Volckaert, G., Hertveldt, K.
(2008). The Genome and Structural Proteome of YuA, a New Pseudomonas aeruginosa Phage Resembling M6. J. Bacteriol.
190: 1429-1435
[Abstract]
[Full Text]
-
Heo, Y.-J., Chung, I.-Y., Choi, K. B., Lau, G. W., Cho, Y.-H.
(2007). Genome sequence comparison and superinfection between two related Pseudomonas aeruginosa phages, D3112 and MP22. Microbiology
153: 2885-2895
[Abstract]
[Full Text]
-
Kaluzny, K., Abeyrathne, P. D., Lam, J. S.
(2007). Coexistence of Two Distinct Versions of O-Antigen Polymerase, Wzy-Alpha and Wzy-Beta, in Pseudomonas aeruginosa Serogroup O2 and Their Contributions to Cell Surface Diversity. J. Bacteriol.
189: 4141-4152
[Abstract]
[Full Text]
-
Daniel, A., Bonnen, P. E., Fischetti, V. A.
(2007). First Complete Genome Sequence of Two Staphylococcus epidermidis Bacteriophages. J. Bacteriol.
189: 2086-2100
[Abstract]
[Full Text]
-
Ceyssens, P.-J., Lavigne, R., Mattheus, W., Chibeu, A., Hertveldt, K., Mast, J., Robben, J., Volckaert, G.
(2006). Genomic Analysis of Pseudomonas aeruginosa Phages LKD16 and LKA1: Establishment of the {phi}KMV Subgroup within the T7 Supergroup.. J. Bacteriol.
188: 6924-6931
[Abstract]
[Full Text]
-
Shen, K., Sayeed, S., Antalis, P., Gladitz, J., Ahmed, A., Dice, B., Janto, B., Dopico, R., Keefe, R., Hayes, J., Johnson, S., Yu, S., Ehrlich, N., Jocz, J., Kropp, L., Wong, R., Wadowsky, R. M., Slifkin, M., Preston, R. A., Erdos, G., Post, J. C., Ehrlich, G. D., Hu, F. Z.
(2006). Extensive Genomic Plasticity in Pseudomonas aeruginosa Revealed by Identification and Distribution Studies of Novel Genes among Clinical Isolates. Infect. Immun.
74: 5272-5283
[Abstract]
[Full Text]
-
Smart, C. H. M., Walshaw, M. J., Hart, C. A., Winstanley, C.
(2006). Use of suppression subtractive hybridization to examine the accessory genome of the Liverpool cystic fibrosis epidemic strain of Pseudomonas aeruginosa. J Med Microbiol
55: 677-688
[Abstract]
[Full Text]
-
Govind, R., Fralick, J. A., Rolfe, R. D.
(2006). Genomic Organization and Molecular Characterization of Clostridium difficile Bacteriophage {Phi}CD119.. J. Bacteriol.
188: 2568-2577
[Abstract]
[Full Text]
-
Kwan, T., Liu, J., DuBow, M., Gros, P., Pelletier, J.
(2006). Comparative Genomic Analysis of 18 Pseudomonas aeruginosa Bacteriophages. J. Bacteriol.
188: 1184-1187
[Abstract]
[Full Text]
-
Lobocka, M. B., Rose, D. J., Plunkett, G. III, Rusin, M., Samojedny, A., Lehnherr, H., Yarmolinsky, M. B., Blattner, F. R.
(2004). Genome of Bacteriophage P1. J. Bacteriol.
186: 7032-7068
[Abstract]
[Full Text]
-
Resch, G., Kulik, E. M., Dietrich, F. S., Meyer, J.
(2004). Complete Genomic Nucleotide Sequence of the Temperate Bacteriophage Aa{Phi}23 of Actinobacillus actinomycetemcomitans. J. Bacteriol.
186: 5523-5528
[Abstract]
[Full Text]
-
Stavrinides, J., Guttman, D. S.
(2004). Nucleotide Sequence and Evolution of the Five-Plasmid Complement of the Phytopathogen Pseudomonas syringae pv. maculicola ES4326. J. Bacteriol.
186: 5101-5115
[Abstract]
[Full Text]
-
DeShazer, D.
(2004). Genomic Diversity of Burkholderia pseudomallei Clinical Isolates: Subtractive Hybridization Reveals a Burkholderia mallei-Specific Prophage in B. pseudomallei 1026b. J. Bacteriol.
186: 3938-3950
[Abstract]
[Full Text]
-
Casjens, S. R., Gilcrease, E. B., Huang, W. M., Bunny, K. L., Pedulla, M. L., Ford, M. E., Houtz, J. M., Hatfull, G. F., Hendrix, R. W.
(2004). The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca. J. Bacteriol.
186: 1818-1832
[Abstract]
[Full Text]
-
Wang, P. W., Chu, L., Guttman, D. S.
(2004). Complete Sequence and Evolutionary Genomic Analysis of the Pseudomonas aeruginosa Transposable Bacteriophage D3112. J. Bacteriol.
186: 400-410
[Abstract]
[Full Text]
-
Wolfgang, M. C., Kulasekara, B. R., Liang, X., Boyd, D., Wu, K., Yang, Q., Miyada, C. G., Lory, S.
(2003). Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA
100: 8484-8489
[Abstract]
[Full Text]
-
Canchaya, C., Proux, C., Fournous, G., Bruttin, A., Brussow, H.
(2003). Prophage Genomics. Microbiol. Mol. Biol. Rev.
67: 238-276
[Abstract]
[Full Text]
-
Zimmer, M., Scherer, S., Loessner, M. J.
(2002). Genomic Analysis of Clostridium perfringens Bacteriophage {phi}3626, Which Integrates into guaA and Possibly Affects Sporulation. J. Bacteriol.
184: 4359-4368
[Abstract]
[Full Text]
-
Rohwer, F., Edwards, R.
(2002). The Phage Proteomic Tree: a Genome-Based Taxonomy for Phage. J. Bacteriol.
184: 4529-4535
[Abstract]
[Full Text]
-
Woods, D. E., Jeddeloh, J. A., Fritz, D. L., DeShazer, D.
(2002). Burkholderia thailandensis E125 Harbors a Temperate Bacteriophage Specific for Burkholderia mallei. J. Bacteriol.
184: 4003-4017
[Abstract]
[Full Text]
-
Williams, K. P.
(2002). Integration sites for genetic elements in prokaryotic tRNA and tmRNA genes: sublocation preference of integrase subfamilies. Nucleic Acids Res
30: 866-875
[Abstract]
[Full Text]
-
Lewis, J. A., Hatfull, G. F.
(2001). Control of directionality in integrase-mediated recombination: examination of recombination directionality factors (RDFs) including Xis and Cox proteins. Nucleic Acids Res
29: 2205-2216
[Abstract]
[Full Text]