Previous Article | Next Article 
Journal of Bacteriology, November 2000, p. 6287-6291, Vol. 182, No. 22
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
radC102 of Escherichia coli
Is an Allele of recG
Mary-Jane
Lombardo* and
Susan M.
Rosenberg
Department of Molecular and Human Genetics,
Baylor College of Medicine, Houston, Texas 77030
Received 22 May 2000/Accepted 21 August 2000
 |
ABSTRACT |
The radC102 mutation causes mild UV and X-ray
sensitivity and was mapped previously to near pyrE and
recG at 82 min on the Escherichia coli
chromosome (I. Felzenszwalb, N. J. Sargentini, and K. C. Smith, Radiat. Res. 97:615-625, 1984). We report that radC102 has two striking phenotypes characteristic of
recG mutations. First, it causes dramatically increased
RecA-dependent mutation in a stationary-phase mutation assay. Second,
it causes extreme UV sensitivity in combination with ruv
mutations affecting the RuvABC Holliday junction resolution system. DNA
sequencing of the radC and recG genes in
radC102 strains revealed that the radC102 mutation creates a stop codon in recG that is predicted to
truncate the RecG protein at 410 of 603 amino acids. A low-copy-number plasmid carrying the radC+ gene did not affect
the UV sensitivity of a wild-type strain, a radC102 strain,
or a
recG258::Tn10mini-kan
strain. We conclude that radC102 is an allele of
recG and that the function of the RadC protein remains to
be determined.
| |
INTRODUCTION |
The radC102 mutation
causes a mild UV and X-ray sensitivity and was mapped by transduction
previously to the pyrE recG region at 82 min on the
Escherichia coli chromosome (11). Further work identified a novel open reading frame (ORF), designated
radC, as the site of the radC102 mutation
(9, 10). We present here several lines of evidence that
radC102 is an allele of recG. The recG
gene was identified originally by mutations that cause mild UV
sensitivity and slight defects in transductional and conjugational recombination (20, 22, 35). recG encodes a
helicase capable of binding and unwinding strand exchange recombination
intermediates (such as Holliday junctions) in vitro (39, 40)
and probably carries out branch migration of recombination substrates
in vivo (reviewed in reference 21). The importance
of the RecG protein in recombination became clear with the discovery
that cells lacking both RecG and RuvA, -B, or -C are extremely UV
sensitive and recombination defective (18). Because the
absence of either RecG or RuvABC has only slight effects on
transductional and conjugational recombination (in the RecBCD pathway
of recombination [21]), they were thought to play
functionally redundant roles in recombination of linear substrates.
However, they do not play identical roles, because their substrate
specificities and directions of branch migration differ in vitro
(1, 38, 39) and their effects on stationary-phase mutation
(13, 17) and on recombination in some assays (19, 20, 25; M. Motamedi and S. M. Rosenberg, unpublished
results) differ in vivo.
We began this work to ask whether radC102 might affect
lac frameshift mutation in stationary-phase E. coli cells, a mutational process dependent upon the recombination
proteins RecA, RecBC, and RuvABC (13, 16, 17). In this
stationary-phase (or adaptive) Lac+ mutation process,
recombination intermediates are proposed to promote DNA replication and
mutation (16, 23, 30). In the course of these experiments we
found that the phenotypes of radC102 strains mimicked those
of recG mutations in two assays, stationary-phase mutation
and UV sensitivity. Subsequently, sequencing revealed that
radC102 strains carry a mutation in the recG gene
and that the radC gene is wild type in radC102
strains. We conclude that radC102 is an allele of
recG. The function of the E. coli radC gene (and
its many bacterial homologs) remains to be determined.
| |
MATERIALS AND METHODS |
Bacterial strains.
Strains used in this work are shown in
Table 1. All strains were constructed by
standard transformation or P1 transduction techniques (28).
Antibiotics were used as necessary at the following concentrations:
tetracycline, 15 µg/ml; ampicillin, 100 µg/ml. The
radC102 allele was transduced from SR1187 (11)
with selection for nearby pyrE+ into SMR5426.
Eleven of 12 Pyr+ transductants tested were mildly UV
sensitive on YENB medium (11), consistent with the linkage
and UV sensitivity described previously (11). One of these
transductants (SMR5441) was used for strain constructions and
experiments. The radC102 ruvC53 strain was constructed and
grown at 30°C. Initial constructions at 37°C gave widely varying
colony sizes, UV sensitivities, and stationary-phase mutation
phenotypes. Instability of such phenotypes in ruv recG strains was observed previously (13, 17, 24).
Mutation and UV sensitivity assays.
Stationary-phase
mutation assays were as described previously (17). Briefly,
multiple independent cultures of each strain were grown to saturation
in minimal glycerol medium, washed twice in minimal medium with no
carbon source, and plated on minimal lactose medium. Lac
scavenger cells, incapable of reverting to Lac+ (FC29
[4]), were plated along with each strain at
approximately a 20-fold excess cell number to prevent growth on any
contaminating nonlactose carbon sources (4). Plates were
incubated at 37°C, and Lac+ colonies were counted each
day for 5 days. recA strains were concentrated 10-fold prior
to plating to obtain enough Lac+ colonies. Viability of the
Lac frameshift-bearing cells on the selection plates was
monitored each day as described previously (16, 17). There
was no net change in the total number of Lac
frameshift-bearing cells on the plates during the course of these experiments (data not shown).
UV sensitivity was determined using saturated LBH (
36)
cultures. When plasmid-bearing strains were tested, ampicillin was
included in the broth and in plates. Cultures were diluted and
plated
on LBH or LBH-ampicillin, irradiated or not, incubated
at 37°C for
approximately 24 h, and then counted. The fraction
surviving was
calculated as cells surviving/cells plated. All
cultures were grown at
37°C, except when
radC102 ruv and
recG ruv
strains were involved (see Fig.
1), in which case all cultures
were
incubated at 32°C for all steps of the experiment to prevent
faster-growing suppressor mutants from accumulating (
17).
Construction of a radC+ plasmid and DNA
sequence analysis.
The entire radC+ gene
(as annotated in the E. coli genome sequence [Swiss-Prot
no. P25531,3]) and its promoter region (14) were amplified
by PCR from E. coli SMR4562 cells using primers
5'CGTAGTGGTATAGAAGTGACCAGTA3' and
5'ACCAGAAACCGCCTGCAAGCTAAGT3'. This product was cut at an
AatII site flanking the radC gene and ligated as
a 1,489-bp AatII blunt fragment into
AatII-SmaI digested pLG338-30, a pSC101-derived
low-copy-number plasmid (5). The resulting
radC+ plasmid was designated pMJ10. DNA
sequencing confirmed that the entire fragment cloned is identical to
the sequence in the published E. coli genome (3).
Cloning of the same PCR product into
AatII-ScaI-digested pBR322 (a higher-copy-number
plasmid) gave small sickly transformants, suggesting that
radC+ is toxic in high copy number. Similar
toxicity in high copy was reported for a plasmid carrying the complete
radC+ gene and flanking sequences
(10). One radC plasmid previously reported to
complement the UV sensitivity of the radC102 mutation does
not contain the entire ORF (a site within the radC ORF was used as the cloning site) (10). A predicted RadC protein of 99 amino acids was proposed to be expressed from that plasmid (8,
10).)
The chromosomal
radC and
recG genes of several
strains (see Results and Discussion) were sequenced using PCR-generated
templates
(Lone Star Labs, Inc., Houston, Tex.). Primers for
radC amplification
were the same as those used for cloning
(see above). Primers for
recG amplification were
5'AGCAACAACGCCTGTTGTTTGAAG3' and
5'GTGATGAATCGCATCCGGCAGGAA3'.
Additional primers were
designed for sequencing. The absence of
the reported frameshift
mutation in the
radC102 strain SR1187
(
9) was
confirmed by sequencing across the mutation site in
five independent
PCR
products.
| |
RESULTS AND DISCUSSION |
radC102 greatly elevates stationary-phase mutation of a
lac frameshift allele.
Stationary-phase (or adaptive)
mutation in the lac frameshift assay system requires the
recombination proteins RecA, RecBC, and RuvABC (13, 16, 17).
In this mutation assay (4), cells carrying a lac
frameshift allele on an F' plasmid are placed on lactose minimal medium
and Lac+ mutant colonies are scored each day for several
days. New colonies appear each day due to mutations that occur on the
selective plate and not prior to plating (27). The
recombination gene dependence (13, 16, 17), sequence
spectrum (12, 31), and other features of Lac+
stationary-phase mutation support the hypothesis that the mutations are
formed by DNA polymerase errors during synthesis primed from recombination intermediates (16, 30). We wondered whether radC102 might affect stationary-phase mutation, given its
effects on UV sensitivity (11) and recombination between
tandem repeats (33). We find that radC102
dramatically increases the frequency of Lac+ mutations in
this assay (Table 2). The increase is
completely dependent on the RecA protein (Table 2). These phenotypes of radC102 are very similar to those of recG
mutations, which also stimulate RecA-dependent Lac+
stationary-phase mutation strongly (13, 17).
radC102 ruv mutants are extremely UV sensitive.
We
constructed strains carrying radC102 and mutations in
ruvA or ruvC. Both of these strains are extremely
UV sensitive, as shown in Fig. 1.
radC102 strains carrying ruvA or ruvC
mutations are as sensitive as the recA deletion strain and
as a recG258 ruvC53 strain at this dose. In contrast,
radC102 or the single ruv mutations alone cause
little or no UV sensitivity at this dose. Extreme UV sensitivity is a
phenotype of recG258 ruv strains (18). Thus,
radC102 also behaves like a recG mutation in
combination with ruv mutations. In addition, the
radC102 ruv strains show an absence of stationary-phase
mutation (data not shown), as do the recG258 ruv
combinations (13, 17).
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 1.
radC102 confers extreme UV sensitivity in
combination with ruv mutations. Values are averages from one
experiment with three independent cultures of each strain. The error
bars represent one standard deviation. Similar results were obtained in
another experiment (data not shown). All strains were grown at 32°C
to prevent accumulation of suppressor mutants or revertants (detected
as heterogeneity of colony size and UV resistance) in the double
ruv recG mutants (17). The
eda-51::Tn10 transposon linked with
ruvC53 has no phenotype on its own (data not shown). The
strains are (from left to right): SMR4562, SMR5441, RSH316, RSH154,
SMR5517, SMR2041, SMR5509, SMR5518, and SMR624.
|
|
The radC102 mutation is in the recG
gene.
The striking similarity between radC102 and
recG in stationary-phase mutation and in UV sensitivity led
us to consider that, contrary to published work (9, 10),
radC102 might be an allele of the nearby recG
gene. We sequenced the entire radC coding region (Swiss-Prot
accession no. P25531) in two isolates of the radC102 strain
SR1187 (obtained on separate occasions from N. Sargentini
[9]) in SMR5441 (radC102) and in SMR4562
(radC+). SR1187 is the source of the
radC102 allele for the experiments reported here and those
of Saveson and Lovett (33). All of these radC
sequences were identical to that in the genome sequence. None displayed
the frameshift mutation in the radC ORF that was reported to
be the radC102 mutation in SR1187 (9). The
recG genes of the two radC102 strains (SR1187 and
SMR5441) and the radC+ strain SMR4562 were also
sequenced completely. The radC102 strains both contain a
substitution mutation in recG (TGG to TGA) that changes
Trp411 to a stop codon, predicting translation of a truncated RecG of
410 amino acids rather than 603 amino acids. Based on these data, we
conclude that radC102 is an allele of recG.
The radC102 allele and recG258 alleles of
recG have similar UV sensitivity phenotypes.
Because
radC102 had not been compared directly with recG
alleles previously, we assayed the UV sensitivities of a set of
isogenic radC102,
recG258::Tn10mini-kan,
and recG+ strains (Fig.
2). The radC102 strain is as
sensitive to UV as the strain carrying
recG258::Tn10mini-kan, a
commonly used null allele of recG (20).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
radC102 and recG258 confer similar
UV sensitivities. Values are the averages from one experiment with
three independent cultures. The error bars represent one standard
deviation. A similar result was obtained in a second experiment (data
not shown). The strains are as follows: recG+
(rec+), SMR4562; radC102, SMR5441;
recG258::Tn10mini-kan
(recG258), RSH316.
|
|
Effect of radC overexpression on UV sensitivity.
With the above findings, the evidence that E. coli radC
encodes a DNA repair gene becomes limited to the report that expression of the complete radC+ gene (and of a fragment of
radC) from a low-copy-number vector complements the UV
sensitivity of the radC102 (recG) mutation (10). The plasmid carrying the complete
radC+ gene was also reported to confer UV
sensitivity to a wild-type strain (10). We cloned the
complete radC+ gene on a related low-copy-number
vector and found that this radC+ plasmid does
not alter the UV sensitivity of either a radC102 strain, a
recG258::Tn10mini-kan
strain, or a recG+ strain (Fig.
3). This result is consistent with our
finding that the radC102 mutation affects the
recG gene. The apparent conflict between these
overexpression results and those reported previously (10)
might be due to differences between the plasmid constructs. An observed
high-copy toxicity of the radC+ gene (see
Materials and Methods), similar to that seen previously (10), suggests that radC+ is
expressed.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Effect of pradC+ on UV
sensitivity. Values are averages from one experiment with three
independent cultures of each strain. The error bars represent one
standard deviation. Within each set of strains
(rec+, radC, and recG258),
the error bars are overlapping, with the exception of the
radC102 set at the 25 J/m2 dose. Similar results
were obtained in a second experiment (data not shown). The strains used
are (from top to bottom) SMR5678, SMR5677, SMR5682, SMR5681, SMR5686,
and SMR5685.
|
|
Implications for RecG and RadC function.
The
radC102 mutation causes a large decrease in tandem repeat
recombination stimulated by a dnaB107 mutation
(33). Our results demonstrating that radC102 is
an allele of recG indicate that RecG is required for that
RecA-dependent process. The dnaB107-stimulated recombination
assay (33) provides an example in which the RuvABC and RecG
systems appear to play dramatically different roles in vivo, in
contrast to their overlapping functions in recombination of linear DNA
substrates (18). The ruv dnaB107 combination is inviable, suggesting that RecG cannot process some lethal recombination substrate(s) created in the dnaB107 strains or that RecG
processes them to lethal intermediates (33). In contrast,
the radC102 dnaB107 combination appears to be viable
(33), indicating that RuvABC deals efficiently with the
potentially lethal recombination substrates produced in a
dnaB107 strain lacking RecG.
There are several other recombinational assay systems in which RecG and
RuvABC appear to play different roles, including recombination
in the
RecF pathway (
19,
20), recombination-dependent
stationary-phase
Lac
+ mutation (
13,
17),
homeologous recombination (
25),
Red-mediated
recombination (
29), and double-strand break repair (M. Motamedi
and S. M. Rosenberg, unpublished results). In
stationary-phase
Lac
+ mutation, RuvA, -B, and -C are
required for mutation and RecG
is inhibitory (
13,
17). In
that system, these opposing roles
are proposed to reflect different
effects of RuvABC and RecG on
initiation of DNA synthesis from 3'
strand invasion intermediates,
with RuvABC facilitating and RecG
inhibiting due to opposite polarities
of branch migration
(
17). This proposal is supported by work
with the
Red
system, a known 3' end invasion system inhibited
by RecG and requiring
RuvC (
29).
The distinct functions of the Ruv and RecG systems in vivo are likely
to be dictated by two classes of factors. First, their
intrinsic
properties, such as different polarities of branch migration
(
37,
40) or different affinities for particular recombination
substrates such as D-loops and three-stranded junctions (
26,
37), will govern which substrates can be bound and whether branch
migration will facilitate or abort the reaction. Second, competition
with other proteins for recombination intermediates will help
define
which substrates will be accessible. For example, genetic
and
biochemical evidence indicates that RecG and PriA, a primosome
assembly
protein with important roles in replication restart and
double-strand
break repair (reviewed in reference
32), probably
compete for D-loop recombination intermediates in vivo (
1,
26). Further investigation of assay systems in which RuvABC
and
RecG have differential effects will help to reveal their functions
and
substrates in
vivo.
With the finding that the
radC102 mutation affects
recG, the evidence that
E. coli RadC is involved
in DNA repair becomes
very limited, as discussed above. Construction
and characterization
of
radC mutations will be necessary to
reveal its function and
to provide clues to the function of the
multiple bacterial
radC homologs. These include three
E. coli homologs (
ykfG,
yfiY, and
yeeS), which lack the putative helix-hairpin-helix DNA
binding
motif in the N terminus of RadC (
2).
| |
ACKNOWLEDGMENTS |
We thank N. Sargentini for radC102 strains, R. Montelaro for pLG338-30, the E. coli Genetic Stock Center
for bacterial strains, and M. Price for medium preparation.
This work was supported by National Institutes of Health grants
F32-GM19909 (to M.-J. L.), R01-GM53158, and R01-AI43917.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Room S809, Mail Stop 225, Houston, TX 77030-3498. Phone: (713)
798-6693. Fax: (713) 798-8704. E-mail:
lombardo{at}bcm.tmc.edu.
| |
REFERENCES |
| 1.
|
Al-Deib, A. A.,
A. A. Mahdi, and R. G. Lloyd.
1996.
Modulation of recombination and DNA repair by the RecG and PriA helicases of Escherichia coli K-12.
J. Bacteriol.
178:6782-6789[Abstract/Free Full Text].
|
| 2.
|
Aravind, L.,
D. R. Walker, and E. V. Koonin.
1999.
Conserved domains in DNA repair proteins and evolution of repair systems.
Nucleic Acids Res.
27:1223-1242[Abstract/Free Full Text].
|
| 3.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glassner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 4.
|
Cairns, J., and P. L. Foster.
1991.
Adaptive reversion of a frameshift mutation in Escherichia coli.
Genetics
128:695-701[Abstract].
|
| 5.
|
Cunningham, T. P.,
R. C. Montelaro, and K. E. Rushlow.
1993.
Lentivirus envelope sequences and proviral genomes are stabilized in Escherichia coli when cloned in low-copy-number plasmid vectors.
Gene
124:93-98[CrossRef][Medline].
|
| 6.
|
Dri, A. M.,
J. Rouviere-Yaniv, and P. L. Moreau.
1991.
Inhibition of cell division in hupA hupB mutant bacteria lacking HU protein.
J. Bacteriol.
173:2852-2863[Abstract/Free Full Text].
|
| 7.
|
Dutreix, M.,
P. L. Moreau,
A. Bailone,
F. Galibert,
J. R. Battista,
G. C. Walker, and R. Devoret.
1989.
New recA mutations that dissociate the various RecA protein activities in Escherichia coli provide evidence for an additional role for RecA protein in UV mutagenesis.
J. Bacteriol.
171:2415-2423[Abstract/Free Full Text].
|
| 8.
|
Felzenszwalb, I.,
S. Boiteux, and J. Laval.
1993.
Cloning of the Escherichia coli radC gene: identification of the RadC protein.
Braz. J. Med. Biol. Res.
26:1261-1268[Medline].
|
| 9.
|
Felzenszwalb, I.,
S. Boiteux, and J. Laval.
1992.
Identification of the radC102 mutation. Order of the genes in the 81.5-82.0 min region of the Escherichia coli chromosome.
Nucleic Acids Res.
20:366[Free Full Text].
|
| 10.
|
Felzenszwalb, I.,
S. Boiteux, and J. Laval.
1992.
Molecular cloning and DNA sequencing of the radC gene of Escherichia coli K-12.
Mutat. Res.
273:263-269[Medline].
|
| 11.
|
Felzenszwalb, I.,
N. J. Sargentini, and K. C. Smith.
1984.
Characterization of a new radiation-sensitive mutant, Escherichia coli K-12 radC102.
Radiat. Res.
97:615-625[Medline].
|
| 12.
|
Foster, P. L., and J. M. Trimarchi.
1994.
Adaptive reversion of a frameshift mutation in Escherichia coli by simple base deletions in homopolymeric runs.
Science
265:407-409[Abstract/Free Full Text].
|
| 13.
|
Foster, P. L.,
J. M. Trimarchi, and R. A. Maurer.
1996.
Two enzymes, both of which process recombination intermediates, have opposite effects on adaptive mutation in Escherichia coli.
Genetics
142:25-37[Abstract].
|
| 14.
|
Gifford, C. M., and S. S. Wallace.
1999.
The genes encoding formamidopyrimidine and MutY DNA glycosylases in Escherichia coli are transcribed as part of complex operons.
J. Bacteriol.
181:4223-4236[Abstract/Free Full Text].
|
| 15.
|
Harris, R. S.
1997.
Ph.D. thesis.
University of Alberta, Edmonton, Canada.
|
| 16.
|
Harris, R. S.,
S. Longerich, and S. M. Rosenberg.
1994.
Recombination in adaptive mutation.
Science
264:258-260[Abstract/Free Full Text].
|
| 17.
|
Harris, R. S.,
K. J. Ross, and S. M. Rosenberg.
1996.
Opposing roles of the Holliday junction processing systems of Escherichia coli in recombination-dependent adaptive mutation.
Genetics
142:681-691[Abstract].
|
| 18.
|
Lloyd, R. G.
1991.
Conjugational recombination in resolvase-deficient ruvC mutants of Escherichia coli depends on recG.
J. Bacteriol.
173:5414-5418[Abstract/Free Full Text].
|
| 19.
|
Lloyd, R. G.,
F. E. Benson, and C. E. Shurvinton.
1984.
Effect of ruv mutations on recombination and DNA repair in Escherichia coli K12.
Mol. Gen. Genet.
194:303-309[CrossRef][Medline].
|
| 20.
|
Lloyd, R. G., and C. Buckman.
1991.
Genetic analysis of the recG locus of Escherichia coli K-12 and of its role in recombination and DNA repair.
J. Bacteriol.
173:1004-1011[Abstract/Free Full Text].
|
| 21.
|
Lloyd, R. G., and K. B. Low.
1996.
Homologous recombination, p. 2236-2255.
In
F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
|
| 22.
|
Lloyd, R. G., and G. J. Sharples.
1991.
Molecular organization and nucleotide sequence of the recG locus of Escherichia coli K-12.
J. Bacteriol.
173:6837-6843[Abstract/Free Full Text].
|
| 23.
|
Lombardo, M.-J., and S. M. Rosenberg.
1999.
Hypermutation in stationary-phase E. coli: tales from the lac operon.
J. Genet.
78:13-21.
|
| 24.
|
Mandal, T. N.,
A. A. Mahdi,
G. J. Sharples, and R. G. Lloyd.
1993.
Resolution of Holliday intermediates in recombination and DNA repair: indirect suppression of ruvA, ruvB, and ruvC mutations.
J. Bacteriol.
175:4325-4334[Abstract/Free Full Text].
|
| 25.
|
Matic, I.,
C. Rayssiguier, and M. Radman.
1995.
Interspecies gene exchange in bacteria: the role of SOS and mismatch repair systems in evolution of species.
Cell
80:507-515[CrossRef][Medline].
|
| 26.
|
McGlynn, P.,
A. A. Al-Deib,
J. Liu,
K. J. Marians, and R. G. Lloyd.
1997.
The DNA replication protein PriA and the recombination protein RecG bind D-loops.
J. Mol. Biol.
270:212-221[CrossRef][Medline].
|
| 27.
|
McKenzie, G. J.,
M.-J. Lombardo, and S. M. Rosenberg.
1998.
Recombination-dependent mutation in Escherichia coli occurs in stationary phase.
Genetics
149:1163-1165[Free Full Text].
|
| 28.
|
Miller, J. H.
1992.
A short course in bacterial genetics.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 29.
|
Poteete, A. R.,
A. C. Fenton, and K. C. Murphy.
1999.
Roles of RuvC and RecG in phage Red-mediated recombination.
J. Bacteriol.
181:5402-5408[Abstract/Free Full Text].
|
| 30.
|
Rosenberg, S. M.
1997.
Mutation for survival.
Curr. Opin. Genet. Dev.
7:829-834[CrossRef][Medline].
|
| 31.
|
Rosenberg, S. M.,
S. Longerich,
P. Gee, and R. S. Harris.
1994.
Adaptive mutation by deletions in small mononucleotide repeats.
Science
265:405-407[Abstract/Free Full Text].
|
| 32.
|
Sandier, S. J., and K. J. Marians.
2000.
Role of PriA in replication fork reactivation in Escherichia coli.
J. Bacteriol.
182:9-13[Free Full Text].
|
| 33.
|
Saveson, C. J., and S. T. Lovett.
1999.
Tandem repeat recombination induced by replication fork defects in Escherichia coli requires a novel factor, RadC.
Genetics
152:5-13[Abstract/Free Full Text].
|
| 34.
|
Shurvinton, C. E.,
R. G. Lloyd,
F. E. Benson, and P. V. Attfield.
1984.
Genetic analysis and molecular cloning of the Escherichia coli ruv gene.
Mol. Gen. Genet.
194:322-329[CrossRef][Medline].
|
| 35.
|
Storm, P. K.,
W. P. Hoekstra,
P. G. de Haan, and C. Verhoef.
1971.
Genetic recombination in Escherichia coli. IV. Isolation and characterization of recombination-deficiency mutants of Escherichia coli K12.
Mutat. Res.
13:9-17[Medline].
|
| 36.
|
Torkelson, J.,
R. S. Harris,
M.-J. Lombardo,
J. Nagendran,
C. Thulin, and S. M. Rosenberg.
1997.
Genome-wide hypermutation in a subpopulation of stationary-phase cells underlies recombination-dependent adaptive mutation.
EMBO J.
16:3303-3311[CrossRef][Medline].
|
| 37.
|
Whitby, M. C., and R. G. Lloyd.
1995.
Branch migration of three-strand recombination intermediates by RecG, a possible pathway for securing exchanges initiated by 3'-tailed duplex DNA.
EMBO J.
14:3302-3310[Medline].
|
| 38.
|
Whitby, M. C., and R. G. Lloyd.
1998.
Targeting Holliday junctions by the RecG branch migration protein of Escherichia coli.
J. Biol. Chem.
273:19729-19739[Abstract/Free Full Text].
|
| 39.
|
Whitby, M. C.,
L. Ryder, and R. G. Lloyd.
1993.
Reverse branch migration of Holliday junctions by RecG protein: a new mechanism for resolution of intermediates in recombination and DNA repair.
Cell
75:341-350[CrossRef][Medline].
|
| 40.
|
Whitby, M. C.,
S. D. Vincent, and R. G. Lloyd.
1994.
Branch migration of Holliday junctions: identification of RecG protein as a junction specific DNA helicase.
EMBO J.
13:5220-5228[Medline].
|
Journal of Bacteriology, November 2000, p. 6287-6291, Vol. 182, No. 22
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Attaiech, L., Granadel, C., Claverys, J.-P., Martin, B.
(2008). RadC, a Misleading Name?. J. Bacteriol.
190: 5729-5732
[Abstract]
[Full Text]
-
Ruiz-Maso, J. A., Anand, S. P., Espinosa, M., Khan, S. A., del Solar, G.
(2006). Genetic and Biochemical Characterization of the Streptococcus pneumoniae PcrA Helicase and Its Role in Plasmid Rolling Circle Replication. J. Bacteriol.
188: 7416-7425
[Abstract]
[Full Text]
-
Donaldson, J. R., Courcelle, C. T., Courcelle, J.
(2004). RuvAB and RecG Are Not Essential for the Recovery of DNA Synthesis Following UV-Induced DNA Damage in Escherichia coli. Genetics
166: 1631-1640
[Abstract]
[Full Text]
-
McGlynn, P., Lloyd, R. G.
(2001). Action of RuvAB at Replication Fork Structures. J. Biol. Chem.
276: 41938-41944
[Abstract]
[Full Text]
-
Bull, H. J., Lombardo, M.-J., Rosenberg, S. M.
(2001). Stationary-phase mutation in the bacterial chromosome: Recombination protein and DNA polymerase IV dependence. Proc. Natl. Acad. Sci. USA
98: 8334-8341
[Abstract]
[Full Text]
-
Avison, M. B., Horton, R. E., Walsh, T. R., Bennett, P. M.
(2001). Escherichia coli CreBC Is a Global Regulator of Gene Expression That Responds to Growth in Minimal Media. J. Biol. Chem.
276: 26955-26961
[Abstract]
[Full Text]
Top
Abstract
Introduction
