Previous Article | Next Article 
Journal of Bacteriology, November 2000, p. 6424-6433, Vol. 182, No. 22
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A DNA Ligase from a Hyperthermophilic Archaeon
with Unique Cofactor Specificity
Masaru
Nakatani,
Satoshi
Ezaki,
Haruyuki
Atomi, and
Tadayuki
Imanaka*
Department of Synthetic Chemistry and
Biological Chemistry, Graduate School of Engineering, Kyoto
University, Yoshida-Honmachi, Sakyo-ku, Kyoto 606-8501, Japan
Received 30 June 2000/Accepted 30 August 2000
 |
ABSTRACT |
A gene encoding DNA ligase (ligTk) from a
hyperthermophilic archaeon, Thermococcus kodakaraensis
KOD1, has been cloned and sequenced, and its protein product has been
characterized. ligTk consists of 1,686 bp,
corresponding to a polypeptide of 562 amino acids with a predicted
molecular mass of 64,079 Da. Sequence comparison with previously
reported DNA ligases and the presence of conserved motifs suggested
that LigTk was an ATP-dependent DNA ligase.
Phylogenetic analysis indicated that LigTk was closely related to the ATP-dependent DNA ligase from
Methanobacterium thermoautotrophicum
H, a moderate
thermophilic archaeon, along with putative DNA ligases from
Euryarchaeota and Crenarchaeota. We expressed
ligTk in Escherichia coli and
purified the recombinant protein. Recombinant
LigTk was monomeric, as is the case for other
DNA ligases. The protein displayed DNA ligase activity in the presence
of ATP and Mg2+. The optimum pH of
LigTk was 8.0, the optimum concentration of
Mg2+, which was indispensable for the enzyme activity, was
14 to 18 mM, and the optimum concentration of K+ was 10 to
30 mM. LigTk did not display single-stranded DNA ligase activity. At enzyme concentrations of 200 nM, we observed significant DNA ligase activity even at 100°C. Unexpectedly,
LigTk displayed a relatively small, but
significant, DNA ligase activity when NAD+ was added as the
cofactor. Treatment of NAD+ with hexokinase did not affect
this activity, excluding the possibility of contaminant ATP in the
NAD+ solution. This unique cofactor specificity was also
supported by the observation of adenylation of
LigTk with NAD+. This is the first
biochemical study of a DNA ligase from a hyperthermophilic archaeon.
 |
INTRODUCTION |
DNA ligases (EC 6.5.1.1 and EC
6.5.1.2) catalyze the phosphodiester bond formation between adjacent
3'-hydroxyl and 5'-phosphoryl groups at a single-strand break in
double-stranded DNA (22). They are essential enzymes for
maintaining the integrity of the genome during DNA replication
(24), DNA excision repair (48), and DNA
recombination (16). DNA strand breaks are commonly generated as reaction intermediates in these events, and the sealing of these
breaks solely depends on the proper function of DNA ligase. Therefore,
DNA ligases are indispensable enzymes in all organisms.
DNA ligases fall into two groups on the basis of the required cofactor
for activity: the group requiring ATP (8) and the group
requiring NAD+ (43). There is high similarity
among the ligases within the ATP-dependent group (19) or
NAD+-dependent group (42). ATP-dependent DNA
ligase I from humans and Saccharomyces cerevisiae are 42%
identical, and NAD+-dependent enzymes from
Escherichia coli and Thermus thermophilus are
46% identical. However, enzymes between the two groups show no
similarity, with the exception of the KXDG motif, which includes the
active-site lysine (19). Furthermore, biochemical
investigations have indicated that there is strict specificity towards
the respective cofactors. This suggests that the two groups have
evolved through completely different pathways.
It is now accepted that both ATP-dependent and
NAD+-dependent DNA ligases catalyze their reactions through
a common mechanism (7). The ligation reaction proceeds
through three steps: (i) activation of the enzyme through the covalent
addition of AMP to the conserved active-site lysine of the protein,
accompanied by the release of PPi or nicotinamide
mononucleotide from the cofactor (ATP or NAD+), (ii)
transfer of AMP from the protein to the 5'-phosphoryl group of the nick
on the DNA, and (iii) phosphodiester bond formation with concomitant
release of free AMP from the adenylated DNA intermediate.
Biochemical and genetic studies have been performed for DNA ligases
from various organisms. It has been shown that eukaryotes (17, 33,
46), viruses (29, 30), and bacteriophages (7, 20) harbor ATP-dependent enzymes. Although only a single type of
DNA ligase has been reported for viruses and bacteriophages, eukaryotic
organisms have multiple enzymes. Five distinct DNA ligases have been
reported from mammalian cells (17, 33, 45, 46).
ATP-dependent enzymes show a wide range in molecular mass, from 41 kDa
(bacteriophage T7) (7) to 102 kDa (human DNA ligase I)
(2). This considerable difference in size is mainly due to
the diversity of the N-terminal region of each DNA ligase. DNA ligase I
from humans includes a regulatory domain of 216 amino acid residues in
its N-terminal region, which is dispensable for DNA ligase activity in
vitro (5, 31). On the other hand, the C-terminal catalytic
domain of DNA ligase I is highly similar among ATP-dependent DNA
ligases (19, 47). The active-site lysine of these DNA
ligases is mostly located at a distance of 332 ± 20 residues from
the C terminus (47).
Various DNA ligases from bacteria (3, 15, 41, 42) have also
been characterized and have been shown to utilize NAD+ as a
cofactor. These enzymes include those from mesophiles, such as E. coli (11), and thermophilic bacteria, such as
Bacillus stearothermophilus (3), T. thermophilus (41), Thermus scotoductus (42), and Rhodothermus marinus (42).
The enzyme from T. thermophilus has been reported to show
DNA ligase activity at temperatures of up to 85°C, with an optimal
reaction temperature of approximately 70°C (41).
Interestingly, genome analysis has indicated the presence of an
ATP-dependent DNA ligase gene on the chromosome of the bacterium
Aquifex aeolicus VF5 (6).
Little is known about DNA ligases from Archaea, the third
kingdom of life. The recently reported ATP-dependent DNA ligase (Mth ligase) from Methanobacterium
thermoautotrophicum
H, a moderate thermophilic archaeon, is the
only enzyme that has been characterized (38). Genome
analyses of hyperthermophilic archaeal strains, such as
Pyrococcus abyssi (http://www.genoscope.cns.fr/Pab/), Archaeoglobus fulgidus (18), and
Methanococcus jannaschii (4), have revealed the
presence of putative DNA ligase genes on their genomes. The sequence of
the gene from Desulfurolobus ambivalens has also been
reported and compared with eukaryotic DNA ligases (19).
Sequence comparison of these putative genes, along with the data from
Mth ligase, indicates that archaeal enzymes are ATP
dependent (19). Thermococcus kodakaraensis KOD1
(previously reported as Pyrococcus kodakaraensis KOD1) is a
sulfur-reducing hyperthermophilic archaeon that was isolated from a
geothermal spring in Kodakara Island, Kagoshima, Japan (28).
We have been focusing on the biochemical and structural
characterization of protein products of genes with putative functions,
including archaeal DNA polymerase (14, 40), archaeal
ribulose 1,5-bisphosphate carboxylase/oxygenase (9, 26),
O6-methylguanine-DNA methyltransferase (13, 21),
and archaeal aspartyl-tRNA synthetase (12, 35). As there is
no information concerning DNA ligases from hyperthermophilic archaea,
we performed detailed characterization of the protein product of a DNA
ligase gene from T. kodakaraensis KOD1. This is the first
characterization of a DNA ligase from a hyperthermophilic archaeon.
 |
MATERIALS AND METHODS |
Microbial strains, plasmids, phages, and media.
T.
kodakaraensis KOD1 was cultivated using a medium described in the
previous report (28). E. coli DH5
and the
vector pUC19 were used for cloning and gene manipulation. E. coli XL1-Blue MRA (P2) (Stratagene, La Jolla, Calif.) was used as
a host strain for
EMBL4 phage (Toyobo, Osaka, Japan). E. coli BL21(DE3)pLysS (Stratagene) and the vector pET21a(+)
(Novagen, Madison, Wis.) were used for overexpression of
ligTk. Luria-Bertani (LB) medium was used for
the cultivation of E. coli, and NZYM medium was used for the
amplification of phage (27).
Isolation of ligTk.
A genomic library was
constructed from T. kodakaraensis KOD1 by using the
EMBL4
phage vector system. A DNA fragment containing a part of the
ligTk gene was obtained through sequence
analysis of the genome of T. kodakaraensis KOD1. A phage
clone which carried the complete ligTk gene was
screened from the genomic library by plaque hybridization using the DNA
fragment as a probe.
DNA manipulation and sequencing.
For isolation of plasmid
DNA, Plasmid Mini-, Midi-, and Lambda Kits (QIAGEN, Hilden, Germany)
were used along with the alkaline extraction method (27).
Restriction enzymes and modifying enzymes were purchased from Toyobo,
Takara (Kyoto, Japan), and Boehringer GmbH (Mannheim, Germany). DNA
sequencing on both strands of DNA was conducted using the ABI PRISM kit
and Model 310 capillary DNA sequencer (Perkin-Elmer Applied Biosystems,
Foster City, Calif.). Sequence data were analyzed and compared using
DNASIS software package (Hitachi Software Engineering, Yokohama, Japan).
Phylogenetic analysis.
The multiple alignment of protein
sequences and the identity and similarity between sequences were
obtained with the program ALIGN contained within the ClustalW program
provided by DNA Data Bank of Japan (DDBJ). The phylogenetic tree was
constructed by the neighbor-joining method after alignment. Bootstrap
resampling was performed with the BSTRAP program 2,000 times.
Cloning and expression of the ligTk
gene.
Two oligonucleotides derived from the
ligTk gene sequence were designed: a 5'-primer
containing an NdeI site (in bold), 5' CGGTGGTGCATATGAGCGATATGCGCTACTCTGAACTGG 3', and a 3'
primer containing a BamHI site (in bold), 5'
CTCGGGATCCCTGGGAGGGAAAAGGAATCTCACTCGCC 3'. PCR was
performed with these primers, along with the phage DNA as a template.
The PCR product, cleaved with NdeI and BamHI, was
inserted into an NdeI-BamHI site of pET-21a(+)
(Novagen). The resulting plasmid pET-lig was transferred to E. coli BL21(DE3)pLysS. The transformants were cultivated in LB
medium containing 50 µg of ampicillin/ml at 37°C until the optical
density at 660 nm reached 1.0. Isopropyl-D-thiogalactopyranoside (IPTG) was added at a
final concentration of 1 mM to induce ligTk gene
expression for 6 h.
Purification of recombinant LigTk.
The
cells were harvested by centrifugation (5,000 × g, 15
min, 4°C), washed with buffer A (50 mM Tris-HCl [pH 7.5], 10 mM MgCl2), and then resuspended in buffer A. The cells were
disrupted by sonication, and the supernatant was obtained by
centrifugation (12,000 × g, 30 min, 4°C). The
soluble fraction of cell-free extract was heat treated at 80°C for 30 min, and the precipitate was removed by centrifugation
(12,000 × g, 30 min, 4°C) to obtain thermostable proteins. The supernatant was applied to a ResourceQ column (Amersham Pharmacia Biotech, Uppsala, Sweden) equilibrated with buffer A. LigTk did not bind to the resin, and the
flowthrough fractions were collected and applied to a cation-exchange
column (ResourceS; Amersham Pharmacia Biotech) equilibrated with buffer B (50 mM Tris-HCl, pH 7.5). After washing with buffer B, the enzyme was
eluted with a 0 to 1.0 M MgCl2 linear gradient with buffer B. The peak fractions containing LigTk, which
eluted between 0.09 and 0.10 M MgCl2, were concentrated by
using Centricon-30 (Millipore, Bedford, Mass.). The enzyme solution was
applied to a gel filtration column (Superdex 200HR 10/30; Amersham
Pharmacia Biotech) equilibrated with buffer C (50 mM Tris-HCl [pH
7.5], 100 mM MgCl2) and eluted with the same buffer. The
active fractions were desalted with buffer B and used as purified
LigTk in the following experiments. The protein
concentration was determined by the Bio-Rad protein assay system
(Bio-Rad, Hercules, Calif.) with bovine serum albumin as a standard.
The N-terminal amino acid sequence of purified
LigTk was determined by a protein sequencer
(Model 270; Perkin-Elmer Applied Biosystems).
DNA substrates.
DNA ligase activity measurements were
carried out with synthesized oligonucleotides consisting of a
5'-phosphorylated 30-mer (5' P-CAGAGGATTGTTGACCGGCCCGTTTGTCAG 3')
and a 40-mer (5' CGCACCGTGACGCCAAGCTTGCATTCCTACAGGTCGACTC-OH 3') annealed to a complementary 80-mer (5'
CGTTGCTGACAAACGGGCCGGTCAACAATCCTCTGGAGTCGACCTGTAGGAATGCAAGCTTGGCGTCACGGTGCGCCAAC 3').
DNA ligase assays.
Nick joining activity was measured by
using the DNA substrates described above. Unless otherwise stated,
ligation reaction mixtures (20 µl) contained 20 mM Bicine-KOH, pH
8.0, 15 mM MgCl2, 20 mM KCl, 1 mM ATP, 10 µM
concentration of the 30-mer, 10 µM concentration of the 40-mer, 5 µM concentration of the 80-mer, and 200 nM
LigTk. The enzyme and other constituents of the
reaction mixture were incubated separately at the desired temperature,
and reactions were initiated by mixing the two solutions. Standard
reactions were carried out at 80°C for 15 min. The reactions were
stopped by addition of 30 µl of loading buffer (98% [vol/vol] formamide, 10 mM EDTA, 0.05% [wt/vol] xylene cyanol FF) and cooling in ice water. The products (12 µl) were heated at 95°C for 3 min and then electrophoresed through a denaturing 6% polyacrylamide-7 M
urea gel (18 cm [width] × 20 cm [height] × 0.5 mm). Super Reading DNA Sequence PreMix Solution (6%) (Toyobo) and Gel-Mix Running Mate
TBE buffer (GIBCO BRL, Rockville, Md.) were used for electrophoresis. The gel was stained with ethidium bromide, and the 70-mer ligation product was quantified by densitometric analysis and Quantity One
software (pdi; Huntington Station, N.Y.).
DNA ligase assays with labeled oligonucleotide.
A
nonphosphorylated 30-mer oligonucleotide (5'
CAGAGGATTGTTGACCGGCCCGTTTGTCAG 3') was synthesized and
phosphorylated at its 5' terminus by using [
-32P]ATP.
The oligonucleotide (10 pmol) was phosphorylated and radiolabeled by
incubation with 1.85 MBq of [
-32P]ATP (Amersham
Pharmacia Biotech) and 10 U of T4 polynucleotide kinase (MEGALABEL;
Takara) at 37°C for 30 min. The reaction product was purified by
centrifugation through a CENTRI-SEP Spin Column (Perkin-Elmer Applied
Biosystems). Nick joining activity was measured by using the
DNA substrates described above. Ligation reaction mixtures (20 µl)
contained 20 mM Bicine-KOH, pH 8.0, 15 mM MgCl2, 20 mM KCl,
1 mM ATP, 0.1 µM concentration of the labeled 30-mer, 0.1 µM
concentration of the 40-mer, 0.1 µM concentration of the 80-mer, and
200 nM LigTk. The reaction was carried out at 80°C for 15 min and stopped by addition of 30 µl of loading buffer (98% [vol/vol] formamide, 10 mM EDTA, 0.05% [wt/vol]
xylene cyanol FF) and cooling in ice water. The products (10 µl) were heated at 95°C for 3 min and then electrophoresed through a
denaturing 6% polyacrylamide-7 M urea gel. Super Reading DNA Sequence
PreMix Solution (6%) (Toyobo) and Gel-Mix Running Mate TBE buffer
(GIBCO BRL) were used for electrophoresis. The gel was dried, and
labeled oligonucleotides were detected by autoradiography.
Measurement of DNA ligase activity with other cofactors.
NAD+ and ADP were added at a concentration of 0.1 mM each,
and reactions were carried out under the same conditions as when ATP
was used as a cofactor. Methods used for detailed analysis of
NAD+ utilization as a cofactor are described below.
Elimination of ATP from NAD+ solution.
NAD+ of the highest grade commercially available (99+%;
Sigma, St. Louis, Mo.) was used for initial examination of cofactor specificity. We further eliminated any small traces of contaminant ATP
enzymatically. ATP was eliminated from NAD+ solution by
treating the solution with hexokinase (Sigma) and D-glucose. As a control, ATP solution was also treated with
hexokinase. NAD+ solution (1 ml) contained 20 mM Tris-HCl
(pH 7.5), 10 mM D-glucose, 10 mM MgCl2, 20 mM
NAD+, and 0.2 U of hexokinase. ATP solution (1 ml)
contained 20 mM Tris-HCl (pH 7.5), 10 mM D-glucose, 10 mM
MgCl2, 2 mM ATP, and 0.2 U of hexokinase. One unit of
hexokinase consumes 1.0 µmol of ATP to phosphorylate 1.0 µmol of
D-glucose per min. Optimal conditions for the enzyme are pH
7.6 and 25°C. These solutions were incubated at 25°C for 2 h.
After incubation, the enzyme was excluded from these solutions by using
Centricon-10 (Millipore).
Adenylation of LigTk.
Adenylation of
LigTk was performed with
[
-32P]ATP or
[adenylate-32P]NAD+, both with
32P in the phosphate group of the AMP moieties. The
adenylation reaction mixture (20 µl) contained 20 mM Bicine-KOH, pH
8.0, 15 mM MgCl2, 200 nM LigTk, and
740 kBq of [
-32P]ATP (Amersham Pharmacia Biotech) or
258 kBq of [adenylate-32P]NAD+ (ICN
Pharmaceuticals, Costa Mesa, Calif.). Reactions were carried out at
80°C for 2 h. The proteins were applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels, and after
gels were dried, adenylated proteins were detected by autoradiography.
Nucleotide sequence accession number.
The gene sequence and
deduced amino acid sequence of ligTk are
available under the accession no. AB042527.
 |
RESULTS |
Cloning and nucleotide sequence of the DNA ligase gene
(ligTk).
Through sequence analysis of the
genome of T. kodakaraensis KOD1, we found a sequence
with similarity to the DNA ligase gene of M. thermoautotrophicum. A genomic library was constructed from T. kodakaraensis KOD1 by using the
EMBL4 phage vector
system. A phage clone harboring the complete open reading frame
(ligTk) was isolated by plaque hybridization. We
determined the nucleotide sequence of approximately 7 kbp within the
isolated DNA fragment, in which the complete
ligTk gene was included.
ligTk consists of 1,686 bp, corresponding to a
polypeptide of 562 amino acids with a predicted molecular mass of
64,079 Da.
Phylogenetic analysis of LigTk.
An unrooted
phylogenetic tree of DNA ligases from various sources was constructed
by the neighbor-joining method (Fig. 1). Phylogenetic analysis indicated that LigTk was
closely related to Mth ligase, along with putative DNA
ligases from Euryarchaeota and Crenarchaeota.
These archaeal sequences showed close relationships with DNA ligase I
from eukaryotes, suggesting that all archaeal DNA ligases, including
LigTk, belong to the ATP-dependent group
(19). The NAD+-dependent DNA ligases were
considerably distant in the tree from ATP-dependent enzymes, indicating
that ATP-dependent and NAD+-dependent enzymes are clearly
different in primary structure.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Phylogenetic tree of DNA ligases. Multiple sequence
alignments were conducted using ClustalW. Tree topology and
evolutionary distance estimations were done by the neighbor-joining
method. The accession numbers for each protein sequence are as follows,
by source: Aquifex aeolicus (AE000699-7), Arabidopsis
thaliana (X97924-1), Archaeoglobus fulgidus (O29632),
Bacillus subtilis (Z99107-110), Borrelia
burgdorferi (G70168), Caenorhabditis elegans (Q27474),
Desulfurolobus ambivalens (Q02093), Escherichia
coli (P15042), fowlpox virus (Z29716-4), Helicobacter
pylori (O25336), human ligase I (NP_000225), human ligase III
(P49916), Lymantria dispar nucleopolyhedrovirus
(AF081810-22), Methanobacterium thermoautotrophicum
(U51624-4), Methanococcus jannaschii (U67474-4), mouse
ligase I (NP_034845), mouse ligase III (U66058-1), Mycoplasma
genitalium (U39704-5), phage T3 (P07717), phage T4 (P00970), phage
T6 (P19088), phage T7 (P00969), Pyrobaculum aerophilum
(U82370), Pyrococcus abyssi (B75173), Rhodothermus
marinus (P49421), Saccharomyces cerevisiae ligase I
(Z74212-1), Schizosaccharomyces pombe (P12000), Shope
fibroma virus (U00761-1), Thermococcus kodakaraensis KOD1
(AB042527), Thermus scotoductus (P49422), Thermus
thermophilus (P26996), Treponema pallidum (O83642),
vaccinia virus (P16272), Zymomonas mobilis (P28719).
|
|
Sequence comparison of LigTk with other
ATP-dependent DNA ligases.
We compared the deduced amino acid
sequence of LigTk with other previously reported
ATP-dependent enzymes (Fig. 2). LigTk showed high identity
with other archaeal DNA ligases: P. abysii (81%), A. fulgidus (53%) (18), M. jannaschii (43%) (4), M. thermoautotrophicum (43%)
(37), Pyrobaculum aerophilum (40%)
(http://genome.caltech.edu/pyrobaculum/), and D. ambivalens (39%) (19). Identity of
LigTk with eukaryotic DNA ligase I was as
follows: human (30%) (2) and S. cerevisiae
(29%) (1). The C-terminal domain of human DNA ligase I has
been reported to be responsible for enzymatic activity (44).
As shown in Fig. 2, alignment of LigTk with
human DNA ligase I indicated that LigTk
corresponds to the C-terminal catalytic domain of human DNA ligase I. Other archaeal DNA ligases also showed the same tendency. Most residues
that were conserved among all archaeal sequences were also conserved in
the eukaryotic sequences. The only major region which was
characteristic of the archaeal sequences was the region from Phe182 to
Ala206 in LigTk. Thirteen of the 25 residues
compared were similar (4 identical residues) in all archaeal sequences,
while only five positions were similarly conserved in the eukaryotic
ligases. There was also a 29-residue insertion in the human DNA ligase
I and a 20-residue insertion in the enzyme from S. cerevisiae. Six motifs (I, III, IIIa, IV, V, VI) have been
previously proposed to be conserved in various ATP-dependent DNA
ligases (39). All motifs were found in
LigTk and other archaeal sequences with the
exception of motif V. Although motif V was conserved in the sequences
from Crenarchaeota, half of the motif was lacking in all
enzymes from Euryarchaeota, including
LigTk. The crystal structure of the
ATP-dependent DNA ligase from bacteriophage T7 complexed with ATP has
been reported, and residues directly interacting with the ATP molecule
have been identified (36, 39). The corresponding residues in
the human DNA ligase I are Lys568, which covalently binds with AMP,
Arg573, Arg589, and Glu621, which form hydrogen bonds with the ribose
ring, Phe660, which stacks on the purine base, and Lys737 and Lys744,
which contact the phosphate groups. Corresponding residues Lys252 (AMP
binding), Arg257, Arg272, and Glu302 (ribose binding), Phe342 (purine
stacking), and Lys423 (phosphate binding) were conserved in
LigTk. However, an Asn416 residue replaced the
position corresponding to Lys737 in the human enzyme.

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence alignment of ATP-dependent DNA ligases
from eukaryotes and DNA ligase sequences from archaea. Enzyme, source,
and accession number are as follows: Pae, Pyrobaculum
aerophilum (U82370); Dam, Desulfurolobus ambivalens
(Q02093); Pab, Pyrococcus abyssi (B75173); Afu,
Archaeoglobus fulgidus (O29632); Mja, Methanococcus
jannaschii (U67474-4); Mth, Methanobacterium
thermoautotrophicum (U51624-4); Tko, Thermococcus
kodakaraensis KOD1 (this work); hu1, DNA ligase I from humans
(NP_000225); and Sc1, DNA ligase I from Saccharomyces
cerevisiae (Z74212-1). P. aerophilum and D. ambivalens belong to Crenarchaeota. A. fulgidus,
M. jannaschii, M. thermoautotrophicum, and
T. kodakaraensis KOD1 belong to Euryarchaeota.
Boxes I to VI represent the six motifs commonly found in ATP-dependent
DNA ligases mentioned in the text. Arrowheads indicate AMP-binding site
(a), ribose binding residues (b), purine ring-stacking residue (c), and
phosphate-binding residues (d). The thick bar indicates a region
distinct among eukaryotic and archaeal sequences. Asterisks above the
Tko sequence indicate conserved residues in archaeal sequences, and
those below the Tko sequence indicate conserved residues among Tko,
hu1, and Sc1.
|
|
Overexpression of ligTk and purification of
the recombinant protein.
In order to examine the enzymatic
properties of LigTk, we expressed
ligTk in E. coli. Cells harboring the
expression plasmid pET-lig were induced by IPTG. The cells were
disrupted by sonication, and the recombinant protein was purified by
heat treatment and column chromatography with ResourceQ, ResourceS, and
Superdex-200 as described in Materials and Methods. Most proteins from
E. coli were precipitated by heat treatment. ResourceQ
column chromatography removed nucleic acids as well as proteins, and ResourceS and Superdex-200 chromatography provided the purified recombinant protein (Fig. 3). We could
observe one major and two minor protein bands with apparent molecular
masses of 62 kDa (band I), 56 kDa (band II), and 50 kDa (band III),
respectively. As we have encountered some cases in which archaeal
proteins showed aberrant migration rates on SDS-PAGE gels
(10), the protein was denatured under various SDS and
reducing-agent concentrations (data not shown). We found that the
presence of the minor band II was inconsistent, and stronger
denaturation conditions led to an increase in this band. This indicates
that band II is a modified product of the intact protein during
denaturation with SDS and reducing agents. We also determined the
N-terminal amino acid sequence of band III. The sequence, FFSQPLTIKR,
corresponded to residues 109 to 118 of LigTk,
indicating that band III was a cleaved peptide fragment. The N-terminal
amino acid sequence of major band I was SDMRYSELADLYRRLEK, identical to
amino acid residues 2 to 18 in the deduced sequence of
LigTk. Supported by these results, we performed
further biochemical characterization of LigTk by
using this enzyme fraction after gel filtration.

View larger version (108K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of ligTk in E. coli and purification of the recombinant protein. Lane 1, molecular mass marker; lane 2, cell-free extract of E. coli
transformant harboring ligTk after 6 h of
induction with IPTG; lane 3, supernatant of cell-free extract after
heat treatment at 80°C for 30 min; lane 4, flowthrough fraction after
anion-exchange chromatography; lane 5, peak fraction after
cation-exchange chromatography; lane 6, peak fraction after gel
filtration chromatography. Arrowheads represent the major band I and
minor bands II and III.
|
|
Subunit composition of recombinant LigTk.
We
investigated the subunit composition of the purified enzyme by gel
filtration chromatography. The native enzyme showed a molecular mass of
52.1 kDa (data not shown), indicating that LigTk
was a monomeric enzyme.
Catalytic properties of LigTk.
We
investigated the DNA ligase activity of recombinant
LigTk. Enzymatic activity was measured by
using complementary oligonucleotides shown in Materials and Methods
(an 80-mer as a template and a complementary 30-mer and 40-mer). When
the DNA substrates and LigTk were added to the
reaction mixture, including 1 mM ATP, 15 mM MgCl2 and 20 mM
KCl, we could clearly detect the 70-mer product after incubation at
80°C for 15 min (Fig. 4A, lane 2). The
70-mer was not detected prior to incubation and could not be observed
when ATP was depleted from the reaction mixture (Fig. 4A, lanes 1 and
3). The results indicate that LigTk is an
ATP-dependent DNA ligase. We also found that
LigTk did not show ligase activity on
single-stranded DNA substrates without template DNA, as no reaction
product could be detected when the 80-mer oligonucleotide was not
included in the reaction (Fig. 4A, lane 4). In order to confirm that
the 70-mer product derived from the 30-mer and 40-mer substrates, we
performed the same experiments with labeled substrates. The 5' terminus
of the 30-mer was phosphorylated using [
-32P]ATP. We
could clearly detect an enzyme-dependent 32P-labeled 70-mer
product after the reaction, coinciding with a decrease in the
32P-labeled 30-mer substrate (Fig. 4B, lane 2).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
ATP-dependent DNA ligase activity of
LigTk. (A) DNA substrates used for DNA ligase
activity measurements were 80-mer as a template and complementary
30-mer and 40-mer. The 30-mer was phosphorylated at its 5' terminus.
DNA ligase joins the nick between the 40-mer and 30-mer, leading to a
70-mer. This change in size was monitored on denaturing 6%
polyacrylamide-7 M urea gels. Lane 1, oligonucleotides with
LigTk and ATP before reaction; lane 2, same as
lane 1, but after 15 min at 80°C; lane 3, same as lane 2 but without
ATP; lane 4, same as in lane 2 but without 80-mer template. (B)
ATP-dependent DNA ligase activity was measured with oligonucleotide
substrates, including a 32P-labeled 30-mer. Lane 1, before
reaction with LigTk; lane 2, after reaction with
LigTk at 80°C for 15 min; lane 3, same as lane
1 but without LigTk; lane 4, same as lane 2 but
without LigTk.
|
|
We performed detailed investigations on the reaction conditions for the
ligation activity of Lig
Tk. The optimum pH
was
8.0 (Fig.
5A). The optimum concentration
of Mg
2+, which was indispensable for enzyme activity, was
14 to 18 mM
(Fig.
5B). A low concentration (0 to 100 mM) of a
monovalent cation,
K
+, significantly stimulated the enzyme
activity, with an optimum
concentration of 10 to 30 mM (Fig.
5C). Under
these optimum conditions,
we performed a kinetic analysis of the
ligation reaction (Fig.
5D). The reaction was linear for approximately
5 min and nearly
complete at 60 min.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 5.
Biochemical characterization of
LigTk. (A) Effect of pH on purified
LigTk. Buffers used were as follows: 20 mM
citrate buffer (pH 4.0 to 5.5), 20 mM MES (morpholineethanesulfonic
acid) buffer (pH 5.5 to 7.0), 20 mM HEPES buffer (pH 7.0 to 8.0), 20 mM
Bicine buffer (pH 8.0 to 9.0), and 20 mM CHES buffer (pH 9.0 to 10.0).
(B) Effect of Mg2+ concentration on activity of
LigTk. Reactions were carried out at 80°C for
15 min at various concentrations of Mg2+. (C) Effect of
K+ on ligation activity of LigTk.
Reactions were carried out at 80°C for 15 min at various
concentrations of K+. (D) Kinetic analysis of
LigTk toward the nick ligation. All
quantifications were performed as described in Materials and Methods.
|
|
Effects of temperature and enzyme concentration on DNA ligase
activity of LigTk.
We measured the DNA ligase
activity of LigTk at various temperatures. When
enzyme concentration was 20 nM (molar ratio of substrate to enzyme = 500:1), LigTk showed significant activity from
35 to 80°C, with an optimal temperature of 65°C (Fig.
6A). A drastic decrease in activity was
observed between 80 and 85°C. However, when enzyme concentration was
elevated to 200 nM (molar ratio of substrate to enzyme = 50:1),
the drastic decrease in activity at temperatures above 80°C could not
be observed (Fig. 6B). LigTk showed activity
from 30 to 100°C, and the optimal temperature shifted to 70 to
80°C. It should be stressed that in these reactions,
LigTk and DNA substrates were preincubated
separately and mixed after reaching the respective temperatures.

View larger version (111K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of temperature on DNA ligase activity of
LigTk at different enzyme concentrations. (A)
Denaturing 6% polyacrylamide-7 M urea gels after reaction at various
temperatures for 15 min with 20 nM enzyme. Temperatures are indicated
above each lane. (B) Same as panel A, but reactions were carried out
for 10 min with 200 nM enzyme.
|
|
Cofactor specificity of LigTk.
We have
previously reported biochemical investigations on a number of archaeal
enzymes from T. kodakaraensis KOD1 whose cofactor specificities differed from their eukaryotic or bacterial counterparts. Namely, aspartyl-tRNA synthetase utilized GTP and UTP as well as the
usual ATP (12), while glutamine synthetase was found to
utilize not only ATP but also GTP (32). We investigated the DNA ligase activity of LigTk using cofactors
other than ATP. LigTk could not utilize ADP as a
cofactor. To our surprise, we found that LigTk
was able to utilize NAD+ as a cofactor (Fig.
7A). Although the enzymatic activity was lower than when ATP was used, a significant amount of 70-mer product could be observed with 0.1 mM NAD+ after 120 min. We could
not detect such a product when no cofactor was added. We also detected
DNA ligase activity with NAD+ at concentrations of 1 and
0.01 mM (data not shown). As DNA ligases have been reported to have
strict cofactor specificity, we further examined the possibilities of
contaminant ATP in our NAD+ solution. In the experiments
above, we used NAD+ of the highest grade commercially
available (99+%; Sigma). Although the possibilities of enzyme activity
due to ATP contamination were low, we ensured the depletion of ATP by
treating the NAD+ solution with hexokinase (Sigma) and
D-glucose. We first examined the extent of ATP degradation
with hexokinase. ATP was incubated with glucose and hexokinase at
25°C for 2 h, and after removal of hexokinase, ligation
reactions were carried out. The 70-mer ligation product could not be
detected using the hexokinase-treated ATP (Fig. 7B, lane 2). This
indicated that the treatment with hexokinase was sufficient to degrade
any contaminant ATP. We therefore performed the same hexokinase
treatment with NAD+ prior to the ligation reaction. Using
the hexokinase-treated NAD+, LigTk
was still able to ligate the 30-mer and 40-mer, producing the 70-mer
product (Fig. 7B, lane 4). ATP-dependent T4 DNA ligase did not show any
activity when NAD+ solution with or without hexokinase
treatment was added to the reaction mixture (data not shown). The
results strongly indicate that LigTk, a
predominantly ATP-dependent DNA ligase, can also utilize
NAD+ as a cofactor.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 7.
NAD+-dependent DNA ligase activity of
LigTk. (A) Ligation reactions were carried out
at 80°C with 0.1 mM ATP, with 0.1 mM NAD+, without
cofactor, or with 0.1 mM ADP for 0, 15, and 120 min. (B) Ligation
reaction measurements using hexokinase-treated NAD+. All
ligation reactions were carried out at 80°C for 2 h. Lane 1, 0.1 mM ATP without hexokinase treatment was added to the ligation reaction
mixture; lane 2, 0.1 mM ATP treated with hexokinase for 2 h was
added to the ligation reaction mixture; lanes 3 and 4, 0.1 mM
NAD+ treated with hexokinase for 2 h was added to the
ligation reaction mixture. The mixture was applied to the gel prior to
the ligation reaction (lane 3) and after the ligation reaction (lane
4).
|
|
We further pursued the utilization of NAD
+ as a cofactor by
examining the adenylation activity of Lig
Tk.
[

-
32P]ATP and
[adenylate-
32P]NAD
+, both with
32P in the phosphate group of the AMP moieties, were used
to detect
the enzyme-AMP complex. The radiolabeled cofactors were
incubated
along with the enzyme for 2 h at 80°C. Although the
efficiency
of adenylation was much lower than in the case of ATP, we
found
that NAD
+ could also be utilized as an AMP donor for
adenylation of Lig
Tk (Fig.
8). This further strongly supports the
utilization of NAD
+ as a cofactor for DNA ligase activity
of Lig
Tk.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 8.
Adenylation of LigTk with ATP or
NAD+ as a cofactor. LigTk was
incubated at 80°C for 2 h with [ -32P]ATP or
[adenylate-32P]NAD+, both with
32P in the phosphate group of the AMP moieties. After
incubation, the proteins were applied to SDS-PAGE gels and detected by
autoradiography.
|
|
 |
DISCUSSION |
In this paper, we describe the biochemical characterization of a
DNA ligase from a hyperthermophilic archaeon. Determination of the
primary structure, expression of the ligTk gene,
purification of the recombinant protein, and evaluation of its
enzymatic properties have been performed. Through these studies, we
have clearly indicated that LigTk harbors DNA
ligase activity and that the activity is mainly dependent on ATP as a
cofactor. The biochemical characterization of
LigTk and Mth ligase (38),
along with the high similarity among these enzymes and other putative
archaeal DNA ligases, suggests that archaeal DNA ligases are
predominantly ATP dependent. However, at present, information
concerning archaeal DNA ligases is limited to those from thermophilic
organisms, and we have no structural or biochemical information on DNA
ligases from mesophilic archaea, such as halophiles.
Genome analyses of P. abyssi and M. jannaschii
(4) have indicated the presence of only one DNA ligase gene
in each organism. The genome of A. fulgidus (18)
additionally harbors a short putative open reading frame (939 bp
corresponding to 313 amino acid residues) slightly resembling a
truncated DNA ligase gene, but there is only a single gene with high
similarity to those of known DNA ligases. Judging from structural
comparison, there seems to be only a single DNA ligase in
hyperthermophilic archaea. In contrast, eukaryotic organisms have
multiple DNA ligases which function to seal nicks in specific cellular
events, such as DNA replication, DNA excision repair, and DNA
recombination. The archaeal DNA ligases would have to function in all
of these events.
Comparison of primary structures revealed that
LigTk corresponded to the C-terminal domain (703 residues) of human DNA ligase I. DNA ligase I, which is involved in
nick sealing during DNA replication, is often cleaved into two
fragments during enzyme purification (25, 44). The
C-terminal fragment alone displays DNA ligase activity in vitro. The
N-terminal region of 118 amino acid residues has been reported to
directly interact with the proliferating cell nuclear antigen (PCNA)
(23, 34). PCNA binds to DNA polymerase
during DNA
replication, and after completion of the Okazaki fragment, it is left
alone in this position after DNA polymerase
is detached. The
interaction between PCNA and the N-terminal region of DNA ligase I
explains why DNA ligase I is uniquely able to function in DNA
replication (23, 34). As LigTk
corresponds to the C-terminal domain of DNA ligase I, it is of interest
as to how the enzyme is recruited to the sites where it should function
in vivo. Interestingly, putative genes with similarity to the
eukaryotic PCNA gene have been identified in P. abyssi,
M. jannaschii, and A. fulgidus.
In this study, we have found two unique features in
LigTk. One is the ability to ligate DNA
fragments at temperatures up to 100°C, which is supposed to be well
above the calculated Tm values of the
oligonucleotides. This could clearly be observed at high enzyme
concentration (Fig. 6B). As LigTk showed no
activity when template DNA was depleted, annealing of the substrates, in other words, a double-stranded DNA substrate, is necessary before
the ligation reaction can occur. As we could detect a significant amount of 70-mer in the reaction at 100°C with
LigTk at high concentration, this suggests that
excess LigTk may somehow increase the population
of double-stranded DNA substrates. This may occur by binding to
double-stranded DNA substrates and lengthening their half-lives.
Further studies will be necessary to elucidate this mechanism.
The most unique and unexpected property of LigTk
is that the enzyme can utilize NAD+ as a cofactor.
Experiments with hexokinase to eliminate contaminant ATP strongly
confirm this unique property. Furthermore, we have also detected
adenylation of LigTk using NAD+.
Although specificity towards ATP is much higher, this is the first
observation of an ATP-dependent DNA ligase able to utilize NAD+. The Mth ligase did not show activity with
NAD+ as a cofactor (38). Comparison of primary
structure and phylogenetic analysis of LigTk
strongly indicate that the enzyme is an ATP-dependent DNA ligase. We
found no significant similarity between LigTk
and bacterial NAD+-dependent enzymes. At present, as we
cannot identify a primary structural basis for utilization of
NAD+, this unique cofactor specificity may be due to the
fact that we were able to measure activities at high temperature, at
which cofactor and/or substrate specificities may be less strict.
Nevertheless, 80°C is a temperature at which the native host cell
shows rapid growth, and the physiological relevance of this cofactor
specificity should be addressed in future studies. Three-dimensional
structural analysis should also provide the physical basis as to how
LigTk utilizes NAD+.
 |
ACKNOWLEDGMENTS |
This work was partly supported to T.I. by Japan Science and
Technology Corporation (JST) for Core Research for Evolutional Science
and Technology (CREST).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Synthetic Chemistry and Biological Chemistry, Graduate School of
Engineering, Kyoto University, Yoshida-Honmachi, Sakyo-ku, Kyoto
606-8501, Japan. Phone: 81-75-753-5568. Fax: 81-75-753-4703. E-mail:
imanaka{at}sbchem.kyoto-u.ac.jp.
 |
REFERENCES |
| 1.
|
Barker, D. G.,
A. L. Johnson, and L. H. Johnston.
1985.
An improved assay for DNA ligase reveals temperature-sensitive activity in cdc9 mutants of Saccharomyces cerevisiae.
Mol. Gen. Genet.
200:458-462[CrossRef][Medline].
|
| 2.
|
Barnes, D. E.,
L. H. Johnston,
K. Kodama,
A. E. Tomkinson,
D. D. Lasko, and T. Lindahl.
1990.
Human DNA ligase I cDNA: cloning and functional expression in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
87:6679-6683[Abstract/Free Full Text].
|
| 3.
|
Brannigan, J. A.,
S. R. Ashford,
A. J. Doherty,
D. J. Timson, and D. B. Wigley.
1999.
Nucleotide sequence, heterologous expression and novel purification of DNA ligase from Bacillus stearothermophilus.
Biochim. Biophys. Acta
1432:413-418[CrossRef][Medline].
|
| 4.
|
Bult, C. J.,
O. White,
G. J. Olsen,
L. Zhou,
R. D. Fleischmann,
G. G. Sutton,
J. A. Blake,
L. M. FitzGerald,
R. A. Clayton,
J. D. Gocayne,
A. R. Kerlavage,
B. A. Dougherty,
J. F. Tomb,
M. D. Adams,
C. I. Reich,
R. Overbeek,
E. F. Kirkness,
K. G. Weinstock,
J. M. Merrick,
A. Glodek,
J. L. Scott,
N. S. M. Geoghagen,
J. F. Weidman,
J. L. Fuhrman,
D. Nguyen,
T. R. Utterback,
J. M. Kelley,
J. D. Peterson,
P. W. Sadow,
M. C. Hanna,
M. D. Cotton,
K. M. Roberts,
M. A. Hurst,
B. P. Kaine,
M. Borodovsky,
H. P. Klenk,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1996.
Complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii.
Science
273:1058-1073[Abstract].
|
| 5.
|
Cardoso, M. C.,
C. Joseph,
H. P. Rahn,
R. Reusch,
B. Nadal-Ginard, and H. Leonhardt.
1997.
Mapping and use of a sequence that targets DNA ligase I to sites of DNA replication in vivo.
J. Cell Biol.
139:579-587[Abstract/Free Full Text].
|
| 6.
|
Deckert, G.,
P. V. Warren,
T. Gaasterland,
W. G. Young,
A. L. Lenox,
D. E. Graham,
R. Overbeek,
M. A. Snead,
M. Keller,
M. Aujay,
R. Huber,
R. A. Feldman,
J. M. Short,
G. J. Olsen, and R. V. Swanson.
1998.
The complete genome of the hyperthermophilic bacterium Aquifex aeolicus.
Nature
392:353-358[CrossRef][Medline].
|
| 7.
|
Doherty, A. J.,
S. R. Ashford,
H. S. Subramanya, and D. B. Wigley.
1996.
Bacteriophage T7 DNA ligase. Overexpression, purification, crystallization, and characterization.
J. Biol. Chem.
271:11083-11089[Abstract/Free Full Text].
|
| 8.
|
Doherty, A. J., and D. B. Wigley.
1999.
Functional domains of an ATP-dependent DNA ligase.
J. Mol. Biol.
285:63-71[CrossRef][Medline].
|
| 9.
|
Ezaki, S.,
N. Maeda,
T. Kishimoto,
H. Atomi, and T. Imanaka.
1999.
Presence of a structurally novel type ribulose-bisphosphate carboxylase/oxygenase in the hyperthermophilic archaeon, Pyrococcus kodakaraensis KOD1.
J. Biol. Chem.
274:5078-5082[Abstract/Free Full Text].
|
| 10.
|
Ezaki, S.,
K. Miyaoku,
K. Nishi,
T. Tanaka,
S. Fujiwara,
M. Takagi,
H. Atomi, and T. Imanaka.
1999.
Gene analysis and enzymatic properties of thermostable -glycosidase from Pyrococcus kodakaraensis KOD1.
J. Biosci. Bioeng.
88:130-135.
|
| 11.
|
Feldberg, R. S.,
H. Young,
L. F. Morrice, and H. M. Keir.
1972.
Some observations on the cofactor requirement for partially purified DNA ligase from Escherichia coli.
FEBS Lett.
27:345-349[CrossRef][Medline].
|
| 12.
|
Fujiwara, S.,
S. G. Lee,
M. Haruki,
S. Kanaya,
M. Takagi, and T. Imanaka.
1996.
Unusual enzyme characteristics of aspartyl-tRNA synthetase from hyperthermophilic archaeon Pyrococcus sp. KOD1.
FEBS Lett.
394:66-70[CrossRef][Medline].
|
| 13.
|
Hashimoto, H.,
T. Inoue,
M. Nishioka,
S. Fujiwara,
M. Takagi,
T. Imanaka, and Y. Kai.
1999.
Hyperthermostable protein structure maintained by intra and inter-helix ion-pairs in archaeal O6-methylguanine-DNA methyltransferase.
J. Mol. Biol.
292:707-716[CrossRef][Medline].
|
| 14.
|
Hashimoto, H.,
T. Matsumoto,
M. Nishioka,
T. Yuasa,
S. Takeuchi,
T. Inoue,
S. Fujiwara,
M. Takagi,
T. Imanaka, and Y. Kai.
1999.
Crystallographic studies on a family B DNA polymerase from hyperthermophilic archaeon Pyrococcus kodakaraensis strain KOD1.
J. Biochem. (Tokyo)
125:983-986[Abstract/Free Full Text].
|
| 15.
|
Ishino, Y.,
H. Shinagawa,
K. Makino,
S. Tsunasawa,
F. Sakiyama, and A. Nakata.
1986.
Nucleotide sequence of the lig gene and primary structure of DNA ligase of Escherichia coli.
Mol. Gen. Genet.
204:1-7[CrossRef][Medline].
|
| 16.
|
Jessberger, R., and P. Berg.
1991.
Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system.
Mol. Cell. Biol.
11:445-457[Abstract/Free Full Text].
|
| 17.
|
Johnson, A. P., and M. P. Fairman.
1997.
The identification and purification of a novel mammalian DNA ligase.
Mutat. Res.
383:205-212[Medline].
|
| 18.
|
Klenk, H. P.,
R. A. Clayton,
J. F. Tomb,
O. White,
K. E. Nelson,
K. A. Ketchum,
R. J. Dodson,
M. Gwinn,
E. K. Hickey,
J. D. Peterson,
D. L. Richardson,
A. R. Kerlavage,
D. E. Graham,
N. C. Kyrpides,
R. D. Fleischmann,
J. Quackenbush,
N. H. Lee,
G. G. Sutton,
S. Gill,
E. F. Kirkness,
B. A. Dougherty,
K. McKenney,
M. D. Adams,
B. Loftus,
S. Peterson,
C. I. Reich,
L. K. McNeil,
J. H. Badger,
A. Glodek,
L. Zhou,
R. Overbeek,
J. D. Gocayne,
J. F. Weidman,
L. McDonald,
T. Utterback,
M. D. Cotton,
T. Spriggs,
P. Artiach,
B. P. Kaine,
S. M. Sykes,
P. W. Sadow,
K. P. D'Andrea,
C. Bowman,
C. Fujii,
S. A. Garland,
T. M. Mason,
G. J. Olsen,
C. M. Fraser,
H. O. Smith,
C. R. Woese, and J. C. Venter.
1997.
The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus.
Nature
390:364-370[CrossRef][Medline].
|
| 19.
|
Kletzin, A.
1992.
Molecular characterisation of a DNA ligase gene of the extremely thermophilic archaeon Desulfurolobus ambivalens shows close phylogenetic relationship to eukaryotic ligases.
Nucleic Acids Res.
20:5389-5396[Abstract/Free Full Text].
|
| 20.
|
Knopf, K. W.
1977.
Simple isolation method and assay for T4 DNA ligase and characterization of the purified enzyme.
Eur. J. Biochem.
73:33-38[CrossRef][Medline].
|
| 21.
|
Leclere, M. M.,
M. Nishioka,
T. Yuasa,
S. Fujiwara,
M. Takagi, and T. Imanaka.
1998.
The O6-methylguanine-DNA methyltransferase from the hyperthermophilic archaeon Pyrococcus sp. KOD1: a thermostable repair enzyme.
Mol. Gen. Genet.
258:69-77[CrossRef][Medline].
|
| 22.
|
Lehman, I. R.
1974.
DNA ligase: structure, mechanism, and function.
Science
186:790-797[Abstract/Free Full Text].
|
| 23.
|
Levin, D. S.,
W. Bai,
N. Yao,
M. O'Donnell, and A. E. Tomkinson.
1997.
An interaction between DNA ligase I and proliferating cell nuclear antigen: implications for Okazaki fragment synthesis and joining.
Proc. Natl. Acad. Sci. USA
94:12863-12868[Abstract/Free Full Text].
|
| 24.
|
Li, J. J., and T. J. Kelly.
1984.
Simian virus 40 DNA replication in vitro.
Proc. Natl. Acad. Sci. USA
81:6973-6977[Abstract/Free Full Text].
|
| 25.
|
Lindahl, T., and D. E. Barnes.
1992.
Mammalian DNA ligases.
Annu. Rev. Biochem.
61:251-281[CrossRef][Medline].
|
| 26.
|
Maeda, N.,
K. Kitano,
T. Fukui,
S. Ezaki,
H. Atomi,
K. Miki, and T. Imanaka.
1999.
Ribulose bisphosphate carboxylase/oxygenase from the hyperthermophilic archaeon Pyrococcus kodakaraensis KOD1 is composed solely of large subunits and forms a pentagonal structure.
J. Mol. Biol.
293:57-66[CrossRef][Medline].
|
| 27.
|
Maniatis, T.,
E. F. Fritsch, and J. Sambrook.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 28.
|
Morikawa, M.,
Y. Izawa,
N. Rashid,
T. Hoaki, and T. Imanaka.
1994.
Purification and characterization of a thermostable thiol protease from a newly isolated hyperthermophilic Pyrococcus sp.
Appl. Environ. Microbiol.
60:4559-4566[Abstract/Free Full Text].
|
| 29.
|
Odell, M.,
S. M. Kerr, and G. L. Smith.
1996.
Ligation of double-stranded and single-stranded [oligo(dT)] DNA by vaccinia virus DNA ligase.
Virology
221:120-129[CrossRef][Medline].
|
| 30.
|
Parks, R. J.,
B. D. Lichty,
C. Karakis, and D. H. Evans.
1994.
Characterization of the Shope fibroma virus DNA ligase gene.
Virology
202:642-650[CrossRef][Medline].
|
| 31.
|
Prigent, C.,
D. D. Lasko,
K. Kodama,
J. R. Woodgett, and T. Lindahl.
1992.
Activation of mammalian DNA ligase I through phosphorylation by casein kinase II.
EMBO J.
11:2925-2933[Medline].
|
| 32.
|
Rahman, R. N. Z. A.,
B. Jongsareejit,
S. Fujiwara, and T. Imanaka.
1997.
Characterization of recombinant glutamine synthetase from the hyperthermophilic archaeon Pyrococcus sp. strain KOD1.
Appl. Environ. Microbiol.
63:2472-2476[Abstract/Free Full Text].
|
| 33.
|
Robins, P., and T. Lindahl.
1996.
DNA ligase IV from HeLa cell nuclei.
J. Biol. Chem.
271:24257-24261[Abstract/Free Full Text].
|
| 34.
|
Rossi, R.,
A. Villa,
C. Negri,
I. Scovassi,
G. Ciarrocchi,
G. Biamonti, and A. Montecucco.
1999.
The replication factory targeting sequence/PCNA-binding site is required in G1 to control the phosphorylation status of DNA ligase I.
EMBO J.
18:5745-5754[CrossRef][Medline].
|
| 35.
|
Schmitt, E.,
L. Moulinier,
S. Fujiwara,
T. Imanaka,
J. C. Thierry, and D. Moras.
1998.
Crystal structure of aspartyl-tRNA synthetase from Pyrococcus kodakaraensis KOD: archaeon specificity and catalytic mechanism of adenylate formation.
EMBO J.
17:5227-5237[CrossRef][Medline].
|
| 36.
|
Shuman, S.
1996.
Closing the gap on DNA ligase.
Structure
4:653-656[Medline].
|
| 37.
|
Smith, D. R.,
L. A. Doucette-Stamm,
C. Deloughery,
H. Lee,
J. Dubois,
T. Aldredge,
R. Bashirzadeh,
D. Blakely,
R. Cook,
K. Gilbert,
D. Harrison,
L. Hoang,
P. Keagle,
W. Lumm,
B. Pothier,
D. Qiu,
R. Spadafora,
R. Vicaire,
Y. Wang,
J. Wierzbowski,
R. Gibson,
N. Jiwani,
A. Caruso,
D. Bush,
H. Safer,
D. Patwell,
S. Prabhakar,
S. McDougall,
G. Shimer,
A. Goyal,
S. Pietrokovski,
G. M. Church,
C. J. Daniels,
J.-I. Mao,
P. Rice,
J. Nölling, and J. N. Reeve.
1997.
Complete genome sequence of Methanobacterium thermoautotrophicum H: functional analysis and comparative genomics.
J. Bacteriol.
179:7135-7155[Abstract/Free Full Text].
|
| 38.
|
Sriskanda, V.,
Z. Kelman,
J. Hurwitz, and S. Shuman.
2000.
Characterization of an ATP-dependent DNA ligase from the thermophilic archaeon Methanobacterium thermoautotrophicum.
Nucleic Acids Res.
28:2221-2228[Abstract/Free Full Text].
|
| 39.
|
Subramanya, H. S.,
A. J. Doherty,
S. R. Ashford, and D. B. Wigley.
1996.
Crystal structure of an ATP-dependent DNA ligase from bacteriophage T7.
Cell
85:607-615[CrossRef][Medline].
|
| 40.
|
Takagi, M.,
M. Nishioka,
H. Kakihara,
M. Kitabayashi,
H. Inoue,
B. Kawakami,
M. Oka, and T. Imanaka.
1997.
Characterization of DNA polymerase from Pyrococcus sp. strain KOD1 and its application to PCR.
Appl. Environ. Microbiol.
63:4504-4510[Abstract/Free Full Text].
|
| 41.
|
Takahashi, M.,
E. Yamaguchi, and T. Uchida.
1984.
Thermophilic DNA ligase. Purification and properties of the enzyme from Thermus thermophilus HB8.
J. Biol. Chem.
259:10041-10047[Abstract/Free Full Text].
|
| 42.
|
Thorbjarnardottir, S. H.,
Z. O. Jonsson,
O. S. Andresson,
J. K. Kristjansson,
G. Eggertsson, and A. Palsdottir.
1995.
Cloning and sequence analysis of the DNA ligase-encoding gene of Rhodothermus marinus, and overproduction, purification and characterization of two thermophilic DNA ligases.
Gene
161:1-6[CrossRef][Medline].
|
| 43.
|
Timson, D. J., and D. B. Wigley.
1999.
Functional domains of an NAD+-dependent DNA ligase.
J. Mol. Biol.
285:73-83[CrossRef][Medline].
|
| 44.
|
Tomkinson, A. E.,
D. D. Lasko,
G. Daly, and T. Lindahl.
1990.
Mammalian DNA ligases. Catalytic domain and size of DNA ligase I.
J. Biol. Chem.
265:12611-12617[Abstract/Free Full Text].
|
| 45.
|
Tomkinson, A. E., and Z. B. Mackey.
1998.
Structure and function of mammalian DNA ligases.
Mutat. Res.
407:1-9[Medline].
|
| 46.
|
Tomkinson, A. E.,
E. Roberts,
G. Daly,
N. F. Totty, and T. Lindahl.
1991.
Three distinct DNA ligases in mammalian cells.
J. Biol. Chem.
266:21728-21735[Abstract/Free Full Text].
|
| 47.
|
Tomkinson, A. E.,
N. F. Totty,
M. Ginsburg, and T. Lindahl.
1991.
Location of the active site for enzyme-adenylate formation in DNA ligases.
Proc. Natl. Acad. Sci. USA
88:400-404[Abstract/Free Full Text].
|
| 48.
|
Wood, R. D.,
P. Robins, and T. Lindahl.
1988.
Complementation of the xeroderma pigmentosum DNA repair defect in cell-free extracts.
Cell
53:97-106[CrossRef][Medline].
|
Journal of Bacteriology, November 2000, p. 6424-6433, Vol. 182, No. 22
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kiyonari, S., Takayama, K., Nishida, H., Ishino, Y.
(2006). Identification of a Novel Binding Motif in Pyrococcus furiosus DNA Ligase for the Functional Interaction with Proliferating Cell Nuclear Antigen. J. Biol. Chem.
281: 28023-28032
[Abstract]
[Full Text]
-
Keppetipola, N., Shuman, S.
(2005). Characterization of a Thermophilic ATP-Dependent DNA Ligase from the Euryarchaeon Pyrococcus horikoshii. J. Bacteriol.
187: 6902-6908
[Abstract]
[Full Text]
-
Fukuda, W., Fukui, T., Atomi, H., Imanaka, T.
(2004). First Characterization of an Archaeal GTP-Dependent Phosphoenolpyruvate Carboxykinase from the Hyperthermophilic Archaeon Thermococcus kodakaraensis KOD1. J. Bacteriol.
186: 4620-4627
[Abstract]
[Full Text]
-
Feng, L., Tumbula-Hansen, D., Toogood, H., Soll, D.
(2003). Expanding tRNA recognition of a tRNA synthetase by a single amino acid change. Proc. Natl. Acad. Sci. USA
100: 5676-5681
[Abstract]
[Full Text]
-
Rashid, N., Imanaka, H., Kanai, T., Fukui, T., Atomi, H., Imanaka, T.
(2002). A Novel Candidate for the True Fructose-1,6-bisphosphatase in Archaea. J. Biol. Chem.
277: 30649-30655
[Abstract]
[Full Text]
-
Fukui, T., Eguchi, T., Atomi, H., Imanaka, T.
(2002). A Membrane-Bound Archaeal Lon Protease Displays ATP-Independent Proteolytic Activity towards Unfolded Proteins and ATP-Dependent Activity for Folded Proteins. J. Bacteriol.
184: 3689-3698
[Abstract]
[Full Text]
-
Amo, T., Atomi, H., Imanaka, T.
(2002). Unique Presence of a Manganese Catalase in a Hyperthermophilic Archaeon, Pyrobaculum calidifontis VA1. J. Bacteriol.
184: 3305-3312
[Abstract]
[Full Text]