Previous Article | Next Article 
Journal of Bacteriology, December 2000, p. 6550-6556, Vol. 182, No. 23
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Role of Azotobacter vinelandii mucA and
mucC Gene Products in Alginate Production
Cinthia
Núñez,
Renato
León,
Josefina
Guzmán,
Guadalupe
Espín, and
Gloria
Soberón-Chávez*
Departamento de Microbiología
Molecular, Instituto de Biotecnología, Universidad Nacional
Autónoma de México, Cuernavaca, Morelos 62251, Mexico
Received 9 May 2000/Accepted 12 September 2000
 |
ABSTRACT |
Azotobacter vinelandii produces the exopolysaccharide
alginate, which is essential for its differentiation to
desiccation-resistant cysts. In different bacterial species, the
alternative sigma factor
E regulates the expression of
functions related to the extracytoplasmic compartments. In A. vinelandii and Pseudomonas aeruginosa, the
E factor (AlgU) is essential for alginate production. In
both bacteria, the activity of this sigma factor is regulated by the
product of the mucA, mucB, mucC,
and mucD genes. In this work, we studied the
transcriptional regulation of the A. vinelandii
algU-mucABCD gene cluster, as well as the role of the
mucA and mucC gene products in alginate
production. Our results show the existence of AlgU autoregulation and
show that both MucA and MucC play a negative role in alginate production.
 |
INTRODUCTION |
Azotobacter vinelandii is
a gram-negative soil bacterium which under adverse environmental
conditions undergoes a differentiation process leading to the formation
of desiccation-resistant cysts (37). The mature cysts are
surrounded by two capsule-like layers containing a high proportion of
the exopolysaccharide alginate (40). This exopolysaccharide
is essential for the encystment process, since nonmucoid strains fail
to encyst (6, 31, 34).
Considerable information about alginate biosynthesis and its regulation
is available based on the studies of Pseudomonas aeruginosa (4, 5, 11, 12, 16, 19, 27, 28, 42-46). The interest in this
bacterium is motivated by the role that alginate plays in the
pathogenesis of the lung of cystic fibrosis patients. Respiratory tract
infections with mucoid P. aeruginosa strains, which produce copious amounts of alginate, are the major contributing factor causing
high morbidity and mortality in cystic fibrosis (17). The
alginate biosynthetic pathways are very similar in A. vinelandii (38) and P. aeruginosa
(28).
In A. vinelandii, as in P. aeruginosa, the
algD gene, coding for the rate-limiting enzyme GDP-mannose
dehydrogenase, is located in a biosynthetic cluster which contains the
genes coding for the enzymes involved in alginate synthesis, with the
exception of algC, which codes for the second enzyme in this
biosynthetic route (28). In A. vinelandii, the
biosynthetic gene cluster is arranged in three operons, one of which
transcribes the algD gene alone (6, 24, 30),
while in the latter bacterium, this gene cluster is transcribed as a
single operon, whose transcription is started from a promoter upstream
of the algD gene (9). The alternative sigma
factor
E (also known as AlgU or AlgT) is responsible for
the transcription of the algD gene in P. aeruginosa (44), as well as in Pseudomonas syringae (21). In A. vinelandii,
algD is transcribed from three promoters, only one of which
is
E dependent (34), but algU
mutants are completely abrogated in alginate production (26,
34), presumably due to the
E dependence of other
genes involved in exopolysaccharide synthesis.
In different bacterial species, the alternative sigma factor
E regulates the expression of functions related to the
extracytoplasmic compartments (33). This sigma factor is
similar to the Escherichia coli and Salmonella
enterica serovar Typhimurium
E protein (3, 10,
20, 29, 39). In E. coli, the
E factor
is absolutely required for growth at high temperatures (13,
14). In E. coli, genes encoding the heat shock
proteins are transcribed by RNA polymerase holoenzyme containing the
alternative sigma factor
32, encoded by the
rpoH gene. At 30°C, the rpoH transcripts
originate from two promoters, p1 and p2, which are recognized by
70 RNA polymerase (13). At 42°C or higher
temperatures, almost all transcription of rpoH comes from
the p3 promoter, which is
E dependent (13,
14).
In P. aeruginosa and A. vinelandii, the
mucABCD genes are located downstream of the algU
gene, forming part of the same transcriptional unit (26,
43). It has been clearly shown elsewhere for P. aeruginosa that the AlgU activity is negatively regulated by the anti-sigma factor MucA (11, 12, 16, 19, 27, 43, 45) and, in
an indirect manner, by MucB (27) and also that the
mucD gene encodes a periplasmic protease which plays a
central role in AlgU activation (4). MucC has been shown to
play a role in AlgU regulation for P. aeruginosa, but its
mechanism has not been elucidated (5). For
Photobacterium strain SS9, a gene cluster carrying homologs
of algU, mucA, mucB, and
mucC has been described elsewhere (8). The
mucC homolog (ORF4) has been reported to code for a protein
which seems to participate in the control of adapted growth at cold
temperature and high pressure (8). In serovar Typhimurium,
the gene homologous to mucC has been shown to be involved in
biotin synthesis (3). It has been reported that alginate
production in P. syringae is also regulated by the AlgU-MucA
sigma factor-anti-sigma factor (21).
P. aeruginosa AlgU and E. coli
E
are interchangeable in the P. aeruginosa background
(46). The E. coli chromosome contains, downstream
of rpoE, two genes (rseA and rseB)
encoding proteins with regulatory functions similar to those of MucA
and MucB proteins (10). In A. vinelandii
(26), the genetic arrangement of algU-mucABCD is
the same as in P. aeruginosa (43), showing high
sequence similarity (26). We have previously reported that
the A. vinelandii and P. aeruginosa algU-mucABCD
gene products play similar regulatory roles in alginate biosynthesis
since they are functionally interchangeable (26). It is also
clear that in A. vinelandii AlgU is absolutely required for
cyst formation, independently of its role in alginate production
(34).
Overproduction of alginate by P. aeruginosa is an important
virulence determinant expressed by this organism in the lungs of cystic
fibrosis patients (17). Although the initial colonizing P. aeruginosa strains are nonmucoid, they undergo conversion
to a highly mucoid phenotype in later stages of the disease.
Loss-of-function mutations in either mucA or mucB
have been reported to convert P. aeruginosa to mucoidy, by
increasing AlgU activity (11, 12, 25). In contrast, A. vinelandii strains produce alginate even in the absence of
mutations in the mucABCD operon.
In this context, our aim in this work was to evaluate the effect of
mucA and mucC mutations on alginate production by
A. vinelandii strains producing different exopolysaccharide
levels. We show that the transcription of the A. vinelandii
algU gene is initiated from two AlgU-dependent promoters, one of
which presents a consensus sequence for the recognition of RNA
polymerase containing a
E subunit, and an apparently
D promoter, which seems to be regulated indirectly by
AlgU. It is also shown that the A. vinelandii AlgU sigma
factor is functional in an E. coli background, but with a
much lower apparent activity than that of the corresponding E. coli protein. We also show that in A. vinelandii the
MucA and MucC proteins negatively regulate alginate production.
 |
MATERIALS AND METHODS |
Microbiological methods.
Bacterial strains and plasmids used
in this work are shown in Table 1.
A. vinelandii strains were routinely grown on BS medium (22) at 30°C. Antibiotic concentrations used for
A. vinelandii and E. coli were as follows:
ampicillin, not used and 200 µg/ml; chloramphenicol, not used and 30 µg/ml; gentamicin, 1.5 and 10 µg/ml; kanamycin, 2 µg/ml and not
used; and tetracycline, 20 and 20 µg/ml, respectively.
Triparental or biparental
A. vinelandii matings were done as
reported previously (
6).
A. vinelandii
transformation was
done as reported by Bali et al. in 1992 (
2). Alginate production
was measured by the method
described previously (
23).

-Galactosidase activity was determined as reported by Miller
(
32); 1 U corresponds to 1 nmol of
O-nitrophenyl-

-
D-galactosidase
hydrolyzed per
min and per mg of protein. All measurements were
done in
triplicate.
Nucleic acid procedures.
DNA isolation, cloning, and
sequencing; Southern blotting; and nick translation procedures were
carried out as described previously (41). Primer extension
analysis of A. vinelandii algU was done with U1
oligonucleotide (5'-CAATTGCTGATCTTGCTCCTGG-3') located in
the 5' region of this gene. Primer extension of algD was
carried out as previously described (6), using an Amersham
primer extension kit as instructed by the manufacturer. The sequencing
reaction shown in the primer extension analysis was done with the
Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science, Inc.).
Construction of plasmids pLRA and pLRC.
The A. vinelandii mucA and mucC genes were amplified by PCR
using ATCC 9046 chromosomal DNA as a template as well as
oligonucleotides mucA- 5' GGCGAGCCTTCGATTTGCTG
and mucA-3' CTGCCGTTACGCTCGTAGA and
mucC-5' GTCCTGCCTGCCAACCTG and mucC-3'
GACTGTGGGGAGCATTCG, respectively. The resulting 1,301- and
1,324-nucleotide PCR products were cloned in pMOSBlue,
producing plasmids pLRA and pLRC, respectively (Table 1 and Fig.
1).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Physical map of the algU-mucABCD region of
A. vinelandii and of plasmids constructed in this study.
Arrows indicate the direction of transcription. Antibiotic resistance
cassettes, which are represented by inverted triangles, are not shown
to scale. Abbreviations: E, EcoRV; S, StyI; X,
XhoI.
|
|
Construction of polar and nonpolar mucA::Gm
and mucC::Tc mutations.
We have previously
reported, by Northern blot hybridization assays, that in A. vinelandii the insertion of
cassettes into genes with the
same orientation as the direction of transcription produces
nonpolar mutations which allow expression of the downstream genes in
the same operon, whereas the insertion of the cassette in the opossite
orientation produces a polar mutation (7, 35, 36). This is
also the case for the gentamicin cassette gene described previously
(1, 36) and used in the present study. Plasmid pLRA was used
to introduce into the unique XhoI site of mucA, a
0.8-kb XhoI fragment containing a gentamicin resistance cassette (1). Clone derivatives containing the gentamicin
cassette ligated in both orientations were selected, producing plasmids pLRA8, containing a mucA::Gm nonpolar mutation
(mucA), and pLRA4, containing a
mucA::Gm polar mutation to mucBCD
(resulting in a mucABCD mutation). Plasmid pLRC was cleaved
with StyI (releasing a 300-bp DNA fragment of the
ampC gene), blunt ended, and ligated to a 2.0-kb
SmaI fragment containing a
-tetracycline cassette. Clone
derivatives containing the
-tetracycline cassette ligated in both
orientations were selected, producing plasmids pLRC2, containing a
mucC::Tc nonpolar mutation (mucC), and
pLRC4, containing a mucC::Tc mutation polar to
mucD (producing a mucCD mutation). Plasmids
pLRA8, pLRA4, pLRC2, and pLRC4 (Fig. 1) were unable to replicate in
A. vinelandii and were used to introduce the
mucA, mucABCD, mucC, and
mucCD mutations into strains ATCC 9046, AEIV, and WI12.
Transformants were selected using the corresponding antibiotic and
confirmed by Southern blot analysis to carry the desired mutations
(Fig. 2).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the strategy followed to
construct mucA and mucC mutants. (A and B)
Insertional inactivation of the mucA (A) and mucC
(B) genes producing the respective polar and nonpolar mutations. (C)
Southern blot hybridization of total genomic DNA digested with
EcoRV endonuclease with plasmid pRLA4 as a probe. Lanes: 1, ATCC 9046; 2, JRA8 (mucA); 3, JRA4 (mucABCD); 4, MLC2 (mucC); 5, MLC4 (mucCD). Identical
hybridization patterns were found for strain AEIV and its corresponding
muc mutants (data not shown).
|
|
 |
RESULTS AND DISCUSSION |
Effect of mucA, mucABCD, and
mucC mutations on alginate production in two A. vinelandii strains.
To determine the role of MucA, MucB,
MucC, and MucD proteins in alginate production by A. vinelandii, we constructed derivatives of the wild-type strain
AEIV carrying mucA, mucABCD, and mucC mutations as described in Materials and Methods and found that the
three mutants present a significant increment of alginate production
(Table 2). These results reinforce our
previous findings (26), based on the complementation of
P. aeruginosa mucA mutants, that in A. vinelandii, as in P. aeruginosa, MucA and possibly MucB
and MucD products function as negative regulators of AlgU activity.
Thus, the disruption of the mucA, mucB, or
mucD gene results in an increase of this sigma factor
activity, as has been shown for E. coli (10) and
P. aeruginosa (27), increasing algD
transcription and possibly that of other alg genes and
ultimately alginate production. In A. vinelandii, however,
MucC seems to function directly as a negative regulator of AlgU
activity since mucC mutants have higher alginate production
(Table 2), while in P. aeruginosa MucC does not directly
affect AlgU activity (5). The mechanism of AlgU activity
regulation by MucC in A. vinelandii remains to be
determined.
The AEIV
mucABCD mutant (AEA4) presents the most drastic
phenotype as evaluated by alginate production on plates (Table
2).
However, when alginate production was quantitated on liquid cultures,
this mutant did not show the highest increase in alginate production
(Table
2). This lack of correlation is due to the high instability
of
the mutant due to the selection of spontaneous mutants with
a reduced
alginate production, possibly affecting AlgU expression.
This
instability is so high that after four subcultures the mutant
AEA4
completely loses its increased alginate production. It is
also apparent
that the higher the alginate production by any of
the
muc
mutants, the lower the growth rate of the strain (data
not
shown).
Strain ATCC 9046 is highly mucoid, due to the presence of a spontaneous
regulatory mutation, called
muc-1, which upregulates
AlgU
activity (
26). The effect of the mutations on the
muc genes
is different in the highly mucoid strain ATCC
9046, since neither
mucC nor
mucCD mutations
increased alginate production (Table
2). The different response of the
two studied strains is very
probably due to a high basal level of AlgU
activity in strain
ATCC 9046, caused by the
muc-1 mutation
(
26).
An increase of approximately twofold was observed in the ATCC 9046
mucABCD mutant strain JRA4, giving the
A. vinelandii strain
the highest specific alginate production, to our
knowledge. The
selection of spontaneous mutations that presented a
reduced level
of alginate production (2.5 mg/mg of protein) was
apparent in
mutant JRA4 as well as in mutant
AEA4.
The ATCC 9046
mucA nonpolar mutant (JRA8) showed a low, but
significant, increase of alginate production (Table
2). It is
apparent
from this result that in
A. vinelandii MucA by itself
plays
an important role in the negative regulation of AlgU activity,
even in
a strain with elevated basal AlgU activity (
26). The
difference in levels of alginate production between mutants JRA4
(
mucABCD) and JRA8 (
mucA) show that MucB, MucC,
and/or MucD affects
AlgU activity by a different signaling mechanism
than that of
the anti-sigma factor
MucA.
Even though mutant JRA8 presented a considerably lower increase in
alginate production than that of mutant JRA4, the former
mutant is also
unstable with respect to hyperproduction of alginate.
The instability
of these mutants suggests that the elevated AlgU
activity or the
increased alginate production might be deleterious
to
A. vinelandii.
Effect of mucA, mucABCD, and
mucC mutations on algD transcription.
Most
of the molecular genetics analysis of alginate production in A. vinelandii has been carried out in the highly mucoid strain ATCC
9046 (6, 7, 24, 26, 30, 31, 34, 35, 36). The detailed
analysis of the structure of the regulatory region of the AEIV
algD gene is currently being performed. At present, we have
only preliminary evidence suggesting that the regulatory elements
participating in AEIV algD transcriptional regulation are
the same as those involved in the regulation of this gene in strain
ATCC 9046 (6, 36) and that the main difference between the
strains seems to be the high AlgU activity in the latter strain due to
an uncharacterized muc-1 mutation (26). In order
to further characterize the effect of the inactivation of the
muc genes on the algD transcriptional regulation,
we focused our research on strain ATCC 9046 and its derivatives.
To evaluate the effect of the polar and nonpolar
mucA and
mucC mutations on
algD transcription, they were
transferred, as
described in Materials and Methods, to strain WI12, an
ATCC 9046
derivative which carries an
algD-lacZ
transcriptional fusion.
We have previously reported that in strain WI12
the transcription
of
algD increased during early exponential
phase and declines
in prestationary phase (
7). As shown in
Fig.
3,
mucA and
mucC mutations increased
algD transcription from
one- to twofold along
the entire growth curve, with a kinetics similar
to that observed
in the parental strain WI12, whereas the
mucABCD mutant shows
an approximately fourfold increase of
algD transcription during
the stationary phase of growth. A
deregulation of
algD transcription
along the entire growth
curve was observed in the WIA4 strain,
which carries a
mucABCD mutation, even though the maximum upregulation
of
algD transcription was observed during stationary phase
(Fig.
3C). The increased
algD expression in the ATCC 9046
mucC and
mucCD mutant background (mutants WIC2
and WIC4 [Fig.
3D and E]) may
indicate that in this highly mucoid
strain MucC also exerts a
direct negative role on AlgU activity, even
though this effect
is not so strong as to be reflected in the amount of
alginate
produced by the mutants.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 3.
Growth (open symbols) and -galactosidase activity
(closed symbols), on Burke's medium supplemented with 2% sucrose, of
strains. WI12 (parental strain) (A), WIA8 (mucA) (B), WIA4
(mucABCD) (C), WIC2 (mucC) (D), and WIC4
(mucCD) (E).
|
|
Mutant WIA4 (
mucABCD) presented the highest increase in
algD expression (Fig.
3C), in accordance with the highest
alginate
production being that of mutant JRA4 (
mucABCD). The
pronounced
increase in
algD expression for WIA4, in contrast
to the lower
increase observed in mutant WIA8 (Fig.
3B), further
supports the
involvement of MucB, MucC, and/or MucD in a signaling
cascade
that affects AlgU activity through a different route from that
of
MucA.
The
A. vinelandii ATCC 9046
algD gene is
transcribed from three promoters: p1, a
D promoter; p2,
an AlgU (
E)-dependent promoter; and a p3 promoter which
shows no recognized
consensus sequences (
6,
34,
35). It thus
seemed likely
that the absence of the Muc products in the
mucABCD mutant would
upregulate AlgU activity, which in turn
would increase
algD transcription
from the p2 promoter. To
verify this hypothesis, primer extension
analysis of the
algD gene was carried out on the
mucABCD mutant.
As shown in Fig.
4,
mucABCD
mutation increased
algD transcription
from its three
promoters and not only from the p2 AlgU-dependent
promoter. We have
previously reported that an
ampDE mutation in
the ATCC 9046 background resulted in an increased
algD initiation
of
transcription from its three promoters (
36) and that an ATCC
9046
gacS mutant presented a decreased transcription from
the
three
algD promoters (
7). These results,
together with the
data presented here, strongly suggest the existence
of a common
level of regulation of the three
algD promoters.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4.
Primer extension analysis of algD
transcription. Lanes correspond to RNA extracted from strain ATCC 9046 (lane 1) and JRA4 (lane 2). Each reaction contained as template 50 µg
of RNA isolated from bacterial cultures grown for 48 h in Burke's
medium supplemented with 2% sucrose.
|
|
Transcriptional regulation of the algU gene.
In
order to investigate the nature and regulation of the A. vinelandii sigma factor AlgU, primer extension analysis of the algU gene was carried out on strains AEIV and ATCC 9046. As
shown in Fig. 5B, in both strains there
is a putative transcriptional start site (p1) located 54 nucleotides
upstream of the ATG start codon and another putative promoter (p2)
starting transcription 62 nucleotides upstream of the translational
start site. As shown in Fig. 5C, the p1
10 and
35 DNA sequences
correspond very well to the
E-dependent promoter
consensus sequences. The
10 and
35 p2 sequences suggest that this
is a
D promoter (Fig. 5A).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 5.
Primer extension analysis of algU
transcription. (A) DNA sequence of the 5' region of algU. p1
and p2 mRNA initiation sites are indicated. The 10 and 35 regions
of the p2 promoter are underlined. (B) Primer extension analysis of the
algU gene. Lanes correspond to RNA extracted from the
following strains: ATCC 9046 (lane 1), JRA4 (mucABCD) (lane
2), SMU88 (algU) (lane 3), and AEIV (lane 4). (C) Sequence
alignment of several AlgU ( E)-dependent promoters.
Abbreviations: P.a., P. aeruginosa;
A.v., A. vinelandii.
|
|
To further characterize these promoters, primer extension analysis was
carried out using RNA derived from ATCC 9046
algU mutant
SMU88 (
34). As expected, the primer extension product
corresponding
to p1 was not observed in strain SMU88, confirming the
dependence
of this promoter on the AlgU sigma factor. Unexpectedly, the
p2
start site was also abrogated, suggesting that the transcription
from this promoter is also regulated by AlgU, but in an indirect
manner. These results thus show that
algU transcription is
autoregulated,
as it is in
P. aeruginosa (
42).
All genes which are activated
by autoregulation need a constitutive
promoter to maintain a basal
level of expression; we could not detect
the promoter responsible
for the basal expression of the
algU-mucABCD operon.
We reported previously that the ATCC 9046
algD p2 promoter
was AlgU dependent based on its lack of expression on an
algU mutant
(
34) and on the presence of sequences
in the

10 and

35 regions
showing a reduced similarity with the
E consensus sequences (
6). The
algD p2 promoter was the first
reported AlgU-dependent
promoter in
A. vinelandii, and so there
was no other
sequence for comparison and validation of the significance
of the
detected homology. The high sequence similarity of
algU p1
with
E-dependent promoters from different bacteria (Fig.
5C) strongly
suggests that the
algD p2 promoter is not
directly recognized
by
AlgU.
Initiation of
algU transcription in the ATCC 9046 background
seems to be much more frequent from the p1 promoter than from
the p2
initiation site, whereas in strain AEIV both initiation
sites show the
same intensity (Fig.
5B). These results suggest
that the
muc-1 mutation present in strain ATCC 9046 increases
AlgU
activity by increasing
algU transcription from p1, the
promoter
directly recognized by AlgU
itself.
The finding of AlgU autoregulation and the increased
algU
transcription from the p1 promoter in strain ATCC 9046 suggested
to us
that the different
muc mutants might show an increased level
of
algU transcription. However, we found that, in both
strains
studied, all the
muc mutants showed similar levels
of
algU transcription
(see Fig.
5B for an example). These
results further reinforce
our previous findings suggesting that, as in
P. aeruginosa mucA and
mucB (
27),
MucA, MucB, MucC, and MucD modulate AlgU activity
and not the
transcription of the
algU gene. In contrast, the
E. coli rseA mutants present a 12-fold increase in
algU
transcription
(
10).
Activation of rpoH p3 initiation of transcription in
E. coli by A. vinelandii AlgU.
In order to
test whether A. vinelandii AlgU was able to activate the
rpoH p3 promoter of E. coli, plasmid pJMSAT1,
which carries the ATCC 9046 A. vinelandii algU-mucA genes
(34), was transferred by transformation to E. coli strains CAG16037 (rpoH
p3::lacZ) and CAG22216
(rpoE::Cmr, rpoH
p3::lacZ), and the effect of a heat shock
treatment (30 to 42°C) was evaluated by measuring the kinetics of
-galactosidase expression (Table 3).
A. vinelandii AlgU restored from 12 to 20% of the
rpoH p3 transcription in E. coli (Table 3). This
reduced level of expression is sufficient to complement the CAG22216
ability to grow on plates at 42°C (data not shown).
We have thus shown that
A. vinelandii AlgU is able to
complement an
E. coli rpoE mutant for growth on plates at
42°C. This
result shows that the function of both proteins in
transcription
at high temperatures is conserved, at least partially.
However,
activity of
A. vinelandii AlgU in the
E. coli background accounts
for only around 15% of the detected
activity of the
E. coli
E factor in the
transcription from
rpoH p3 (Table
3). The rate-limiting
step
for this reduced AlgU activity, whether at the level of expression
or
the level of protein function, of the
A. vinelandii AlgU
activity
in the
E. coli background remains to be
determined.
We have previously reported evidence showing that in
A. vinelandii AlgU activity is regulated by the
muc gene
products in
a manner similar to that reported previously for
P. aeruginosa (
26). These data, together with the increase
in alginate production
and
algD expression in
mucA and
mucABCD mutants reported here,
suggest
that, in
A. vinelandii, AlgU activity is negatively
regulated
by MucA and possibly also by MucB and MucD. On the other
hand,
our results show that MucC is by itself a negative regulator of
alginate production in
A. vinelandii (Table
2),
contradicting
the previously reported results on the lack of a direct
effect
of MucC in
P. aeruginosa (
5). The
mechanism of AlgU regulation
by MucC in
A. vinelandii is
presently
unknown.
The disruption of any of the
muc genes did not affect
encystment frequencies or cyst morphology of the two strains studied,
AEIV and ATCC 9046 (data not shown). These data show that the
level of
alginate production does not correlate with the proportion
of cells
undergoing differentiation and suggest that AlgU activity
is not the
rate-limiting step in cyst formation. The same two
conclusions were
attained when cyst formation was evaluated on
strains with reduced
levels of AlgU expression (
34).
 |
ACKNOWLEDGMENTS |
We are grateful to Rebeca Nájera, Paul Gaytán, and
Eugenio López for expert technical assistance.
This work was supported by grants IN212096 DGAPA-PAPIIT, UNAM, and
CONACyT 27767.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Microbiología Molecular, Instituto de Biotecnología,
UNAM, Apdo Postal 510-3, Cuernavaca, Morelos 62251, Mexico. Phone: (52)
(73) 291634. Fax: (52) (73) 172388. E-mail:
gloria{at}ibt.unam.mx.
 |
REFERENCES |
| 1.
|
Alexeyev, M. F.,
I. Shokolenko, and T. P. Croughan.
1995.
Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis.
Gene
160:63-67[CrossRef][Medline].
|
| 2.
|
Bali, A.,
G. Blanco,
S. Hill, and C. Kennedy.
1992.
Excretion of ammonium by a nifL mutant of Azotobacter vinelandii fixing nitrogen.
Appl. Environ. Microbiol.
58:1711-1718[Abstract/Free Full Text].
|
| 3.
|
Beck, B. J.,
L. E. Connolly,
A. de las Peñas, and D. M. Downs.
1997.
Evidence that rseC, a gene in the rpoE cluster, has a role in thiamine synthesis in Salmonella typhimurium.
J. Bacteriol.
179:6504-6508[Abstract/Free Full Text].
|
| 4.
|
Boucher, J. C.,
J. Martínez-Salazar,
M. J. Schurr,
M. Mudd,
H. Yu, and V. Deretic.
1996.
Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease HtrA.
J. Bacteriol.
178:511-523[Abstract/Free Full Text].
|
| 5.
|
Boucher, J. C.,
M. J. Schurr,
H. Yu,
D. W. Rowen, and V. Deretic.
1997.
Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.
Microbiology
143:3473-3480[Abstract/Free Full Text].
|
| 6.
|
Campos, M.-E.,
J. M. Martínez-Salazar,
L. Lloret,
S. Moreno,
C. Núñez,
G. Espín, and G. Soberón-Chávez.
1996.
Characterization of the gene coding for GDP-mannose dehydrogenase (algD) from Azotobacter vinelandii.
J. Bacteriol.
178:1793-1799[Abstract/Free Full Text].
|
| 7.
|
Castañeda, M.,
J. Guzmán,
S. Moreno, and G. Espín.
2000.
GacS sensor kinase regulates alginate and poly- -hydroxybutyrate production in Azotobacter vinelandii.
J. Bacteriol.
182:2624-2628[Abstract/Free Full Text].
|
| 8.
|
Chi, E., and D. H. Bartlett.
1995.
Characterization of a locus important for high pressure adaptation from the barophilic deep-sea bacterium Photobacterium SS9.
Mol. Microbiol.
17:713-726[CrossRef][Medline].
|
| 9.
|
Chitnis, C. E., and D. E. Ohman.
1993.
Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.
Mol. Microbiol.
8:583-590[Medline].
|
| 10.
|
De las Peñas, A.,
L. Connolly, and C. A. Gross.
1997.
The sigma-E-mediated response to extracytoplasmic stress in Escherichia coli is transduced by RseA and RseB, two negative regulators of sigma-E.
Mol. Microbiol.
24:373-385[CrossRef][Medline].
|
| 11.
|
Deretic, V.,
D. W. Martin,
M. J. Schurr,
M. H. Mudd,
N. S. Hibler,
R. Curcic, and J. C. Boucher.
1993.
Conversion to mucoidy in Pseudomonas aeruginosa.
Bio/Technology
11:1133-1136[Medline].
|
| 12.
|
Deretic, V.,
M. J. Schurr,
J. C. Boucher, and D. W. Martin.
1994.
Conversion of Pseudomonas aeruginosa to mucoidy in cystic fibrosis: environmental stress and regulation of bacterial virulence by alternative sigma factors.
J. Bacteriol.
176:2773-2780[Free Full Text].
|
| 13.
|
Erickson, J. W.,
V. Vaughn,
W. A. Walter,
F. C. Neidhardt, and C. A. Gross.
1987.
Regulation of the promoters and transcripts of rpoH, the Escherichia coli heat shock regulatory gene.
Genes Dev.
1:419-432[Abstract/Free Full Text].
|
| 14.
|
Erickson, J. W., and C. A. Gross.
1989.
Identification of the E subunit of Escherichia coli RNA polymerase: a second alternate factor involved in high-temperature gene expression.
Genes Dev.
3:1462-1471[Abstract/Free Full Text].
|
| 15.
|
Fellay, R.,
J. Frey, and H. Krisch.
1987.
Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis.
Gene
52:147-154[CrossRef][Medline].
|
| 16.
|
Goldberg, J. B.,
W. L. Gorman,
J. L. Flynn, and D. E. Ohman.
1993.
A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species.
J. Bacteriol.
175:1303-1308[Abstract/Free Full Text].
|
| 17.
|
Govan, J. R. W., and V. Deretic.
1996.
Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.
Microbiol. Rev.
60:539-574[Abstract/Free Full Text].
|
| 18.
|
Hanahan, D.
1983.
Studies on transformation of E. coli.
J. Mol. Biol.
166:557-580[Medline].
|
| 19.
|
Hershberger, C. D.,
R. W. Ye,
M. R. Parsek,
Z.-D. Xie, and A. M. Chakrabarty.
1995.
The algT (algU) gene of Pseudomonas aeruginosa, a key regulator involved in alginate biosynthesis, encodes an alternative sigma factor ( E).
Proc. Natl. Acad. Sci. USA
92:7941-7945[Abstract/Free Full Text].
|
| 20.
|
Johnson, K.,
I. Charles,
G. Dougan,
D. Pickard,
P. O'Gaora,
G. Costa,
T. Ali,
I. Miller, and C. Hormaeche.
1991.
The role of stress response protein in Salmonella typhimurium virulence.
Mol. Microbiol.
5:401-407[Medline].
|
| 21.
|
Keith, L. M., and C. L. Bender.
1999.
AlgT ( 22) controls production and tolerance to environmental stress in Pseudomonas syringae.
J. Bacteriol.
181:7176-7184[Abstract/Free Full Text].
|
| 22.
|
Kennedy, C.,
R. Gamal,
R. Humphrey,
J. Ramos,
K. Brigle, and D. Dean.
1986.
The nifH, nifM and nifN genes of Azotobacter vinelandii: characterization by Tn5 mutagenesis and isolation from pLAFR1 gene banks.
Mol. Gen. Genet.
205:318-325[CrossRef].
|
| 23.
|
Knutson, C. A., and A. Jeanes.
1968.
A new modification of the carbazole reaction: application to heteropolysaccharides.
Anal. Biochem.
24:470-481[CrossRef][Medline].
|
| 24.
|
Lloret, L.,
R. Barreto,
M.-E. Campos,
S. Moreno,
J. M. Martínez-Salazar,
G. Espín,
R. León, and G. Soberón-Chávez.
1996.
Genetic analysis of the transcriptional arrangement of Azotobacter vinelandii alginate biosynthetic genes: identification of two independent promoters.
Mol. Microbiol.
21:449-457[CrossRef][Medline].
|
| 25.
|
Martin, D. W.,
M. J. Schurr,
M. H. Mudd,
J. R. W. Govan,
B. W. Holloway, and V. Deretic.
1993.
Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients.
Proc. Natl. Acad. Sci. USA
90:8377-8381[Abstract/Free Full Text].
|
| 26.
|
Martínez-Salazar, J.,
S. Moreno,
R. Nájera,
J. C. Boucher,
G. Espín,
G. Soberón-Chávez, and V. Deretic.
1996.
Characterization of the genes coding for the putative sigma factor AlgU and its regulators MucA, MucB, MucC, and MucD in Azotobacter vinelandii and evaluation of their roles in alginate biosynthesis.
J. Bacteriol.
178:1800-1808[Abstract/Free Full Text].
|
| 27.
|
Mathee, K.,
C. J. McPherson, and D. E. Ohman.
1997.
Posttranslational control of the algT (algU)-encoded 22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN).
J. Bacteriol.
179:3711-3720[Abstract/Free Full Text].
|
| 28.
|
May, T. B., and A. M. Chakrabarty.
1994.
Pseudomonas aeruginosa: genes and enzymes of alginate synthesis.
Trends Microbiol.
2:151-157[CrossRef][Medline].
|
| 29.
|
Mecsas, J.,
P. E. Rouviere,
J. W. Erickson,
T. J. Donohue, and C. A. Gross.
1993.
The activity of E, an Escherichia coli heat-inducible -factor, is modulated by expression of outer membrane proteins.
Genes Dev.
7:2618-2628[Abstract/Free Full Text].
|
| 30.
|
Mejía-Ruíz, H.,
J. Guzmán,
S. Moreno,
G. Soberón-Chávez, and G. Espín.
1997.
The Azotobacter vinelandii alg8 and alg44 genes are essential for alginate synthesis, and they constitute an algD independent operon.
Gene
199:271-277[CrossRef][Medline].
|
| 31.
|
Mejía-Ruíz, H.,
S. Moreno,
J. Guzmán,
R. Nájera,
R. León,
G. Soberón-Chávez, and G. Espín.
1997.
Isolation and characterization of an Azotobacter vinelandii algK mutant.
FEMS Microbiol. Lett.
156:101-106[Medline].
|
| 32.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 431-435.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 33.
|
Missiakas, D., and S. Raina.
1998.
The extracytoplasmic function sigma factors, role and regulation.
Mol. Microbiol.
28:1059-1066[CrossRef][Medline].
|
| 34.
|
Moreno, S.,
R. Nájera,
J. Guzmán,
G. Soberón-Chávez, and G. Espín.
1998.
Role of alternative factor AlgU in encystment of Azotobacter vinelandii.
J. Bacteriol.
180:2766-2769[Abstract/Free Full Text].
|
| 35.
|
Núñez, C.,
S. Moreno,
G. Soberón-Chávez, and G. Espín.
1999.
The Azotobacter vinelandii response regulator AlgR is essential for cyst formation.
J. Bacteriol.
181:141-148[Abstract/Free Full Text].
|
| 36.
|
Núñez, C.,
S. Moreno,
L. Cardenas,
G. Soberón-Chávez, and G. Espín.
2000.
Inactivation of the ampDE operon increases transcription of algD and affects morphology and encystment in Azotobacter vinelandii.
J. Bacteriol.
182:4829-4835[Abstract/Free Full Text].
|
| 37.
|
Page, W. J.
1983.
Formation of cyst-like structures by iron-limited Azotobacter vinelandii strain UW during prolonged storage.
Can. J. Microbiol.
29:1110-1118.
|
| 38.
|
Pindar, D. F., and C. Bucke.
1975.
The biosynthesis of alginic acid by Azotobacter vinelandii.
Biochem. J.
152:617-622[Medline].
|
| 39.
|
Rouviére, P. E.,
A. De Las Peñas,
J. Mecsas,
C. Z. Lu,
K. E. Rudd, and C. A. Gross.
1995.
rpoE, the gene encoding the second heat-shock sigma factor, E, in Escherichia coli.
EMBO J.
14:1032-1042[Medline].
|
| 40.
|
Sadoff, H. L.
1975.
Encystment and germination in Azotobacter vinelandii.
Bacteriol. Rev.
39:516-539[Free Full Text].
|
| 41.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd. ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 42.
|
Schurr, M. J.,
H. Yu,
J. C. Boucher,
N. S. Hibler, and V. Deretic.
1995.
Multiple promoters and induction by heat shock of the gene encoding the alternative sigma factor AlgU ( E) which controls mucoidy in cystic fibrosis isolates of Pseudomonas aeruginosa.
J. Bacteriol.
177:5670-5679[Abstract/Free Full Text].
|
| 43.
|
Schurr, M. J.,
H. Yu,
J. M. Martínez-Salazar,
J. C. Boucher, and V. Deretic.
1996.
Control of AlgU, a member of the E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis.
J. Bacteriol.
178:4997-5004[Abstract/Free Full Text].
|
| 44.
|
Wozniak, D. J., and D. E. Ohman.
1994.
Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of alginate gene expression which is modulated by algT.
J. Bacteriol.
176:6007-6014[Abstract/Free Full Text].
|
| 45.
|
Xie, Z.-D.,
C. D. Hershberger,
S. Shankar,
R. W. Ye, and A. M. Chakrabarty.
1996.
Sigma factor-anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA.
J. Bacteriol.
178:4990-4996[Abstract/Free Full Text].
|
| 46.
|
Yu, H.,
M. J. Schurr, and V. Deretic.
1995.
Functional equivalence of Escherichia coli E and Pseudomonas aeruginosa AlgU: E. coli rpoE restores mucoidy and reduces sensitivity to reactive oxygen intermediates in algU mutants of P. aeruginosa.
J. Bacteriol.
177:3259-3268[Abstract/Free Full Text].
|
Journal of Bacteriology, December 2000, p. 6550-6556, Vol. 182, No. 23
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ross, C. L., Thomason, K. S., Koehler, T. M.
(2009). An Extracytoplasmic Function Sigma Factor Controls {beta}-Lactamase Gene Expression in Bacillus anthracis and Other Bacillus cereus Group Species. J. Bacteriol.
191: 6683-6693
[Abstract]
[Full Text]
-
Nunez, C., Bogachev, A. V., Guzman, G., Tello, I., Guzman, J., Espin, G.
(2009). The Na+-translocating NADH : ubiquinone oxidoreductase of Azotobacter vinelandii negatively regulates alginate synthesis. Microbiology
155: 249-256
[Abstract]
[Full Text]
-
Leon, R., Espin, G.
(2008). flhDC, but not fleQ, regulates flagella biogenesis in Azotobacter vinelandii, and is under AlgU and CydR negative control. Microbiology
154: 1719-1728
[Abstract]
[Full Text]
-
Schenk, A., Berger, M., Keith, L. M., Bender, C. L., Muskhelishvili, G., Ullrich, M. S.
(2006). The algT Gene of Pseudomonas syringae pv. glycinea and New Insights into the Transcriptional Organization of the algT-muc Gene Cluster. J. Bacteriol.
188: 8013-8021
[Abstract]
[Full Text]
-
Gimmestad, M., Steigedal, M., Ertesvag, H., Moreno, S., Christensen, B. E., Espin, G., Valla, S.
(2006). Identification and Characterization of an Azotobacter vinelandii Type I Secretion System Responsible for Export of the AlgE-Type Mannuronan C-5-Epimerases.. J. Bacteriol.
188: 5551-5560
[Abstract]
[Full Text]
-
Castaneda, M., Sanchez, J., Moreno, S., Nunez, C., Espin, G.
(2001). The Global Regulators GacA and sigma S Form Part of a Cascade That Controls Alginate Production in Azotobacter vinelandii. J. Bacteriol.
183: 6787-6793
[Abstract]
[Full Text]
-
Sauer, K., Camper, A. K.
(2001). Characterization of Phenotypic Changes in Pseudomonas putida in Response to Surface-Associated Growth. J. Bacteriol.
183: 6579-6589
[Abstract]
[Full Text]