Previous Article | Next Article 
Journal of Bacteriology, December 2000, p. 6577-6583, Vol. 182, No. 23
Department of Microbiology, Eastman Dental
Institute for Oral Health Care Sciences, University College London,
London WC1X 8LD, United Kingdom
Received 5 June 2000/Accepted 5 September 2000
Tn5397 is a novel conjugative transposon, originally
isolated from Clostridium difficile. This element can
transfer between C. difficile strains and to and from
Bacillus subtilis. It encodes a conjugation system that is
very similar to that of Tn916. However, insertion and
excision of Tn5397 appears to be dependent on the product
of the element encoded gene tndX, a member of the large resolvase family of site-specific recombinases. To test the role of
tndX, the gene was cloned and the protein was expressed in Escherichia coli. The ability of TndX to catalyze the
insertion and excision of derivatives (minitransposons) of
Tn5397 representing the putative circular and integrated
forms, respectively, was investigated. TndX was required for both
insertion and excision. Mutagenesis studies showed that some of the
highly conserved amino acids at the N-terminal resolvase domain and the
C-terminal nonconserved region of TndX are essential for activity.
Analysis of the target site choices showed that the cloned
Tn5397 targets from C. difficile and B. subtilis were still hot spots for the minitransposon insertion in
E. coli.
Conjugative transposons are gene
transfer elements that can move from the genomes of donor cells to
those of recipients, sometimes across large phylogenetic distances.
They are one of the major vectors responsible for the spread of
antibiotic resistance among bacterial pathogens (for recent reviews,
see references 32, 37, and 39).
The most intensely studied of the conjugative transposons is
Tn916. This 18.3-kb element was originally isolated from the
chromosome of Enterococcus faecalis DS16, where it mediated tetracycline resistance via the tet(M) gene (11).
The complete DNA sequence of this element has been obtained
(10). Open reading frames have been identified that have the
potential to encode polypeptides with sequence similarity to proteins
known to be involved in conjugation (e.g., the antirestriction
protein Ard of plasmid Collb-P9 and the MbeA mobilization protein
of plasmid ColE1). A functional oriT site has also been
located (19), and there is evidence that this site is
involved in single-stranded DNA transfer to the recipient (35,
40).
Tn5397 is a 21-kb tetracycline resistance-encoding
conjugative transposon originally found in Clostridium
difficile (24, 25). Tn5397 was shown to be
transferred by a conjugation-like process from C. difficile
strain 630 to Bacillus subtilis strain CU2189 and back to
C. difficile, and between C. difficile strains (24). Furthermore, Tn5397 has also been shown to
be capable of transfer in a model oral biofilm community, indicating
that the element is likely to be able to transfer in natural
environments (33). Tn5397 is related to
Tn916; the central regions that are involved in conjugation
of these two elements are very similar (14, 24, 25).
However, Tn5397 can be distinguished from Tn916
in at least two important characteristics: first, Tn5397 contains a group II intron inserted into a gene almost identical to
orf14 from Tn916 (25), and second, the
DNA sequences of the ends of Tn5397 are completely different
from those of Tn916. Instead of having the int
and xis genes that have been shown to be required for
integration and excision of Tn916 (22, 30, 34, 43, 44), Tn5397 contains the gene tndX, which
encodes a putative protein not related to Int or Xis (2, 3, 9, 20,
27, 28, 36) but belonging to the large resolvase subgroup of
site-specific recombinases (46).
Members of the resolvase/invertase family, such as Tn3,
Recently we have shown that an intact tndX gene is required
for conjugative transposition of Tn5397 and for the
production of a circular form of the element (46). This
finding, together with DNA sequence analysis of the
transposon-chromosome junctions of integrated Tn5397, target
sites of Tn5397, and DNA sequence of the joint of the
circular form, allowed us to propose the following model for insertion
and excision of the element. Briefly, the element is excised from the
donor genome, generating a circular form with a GA dinucleotide at the
joint of the ends of the element. The original target site is
completely regenerated after Tn5397 excision and contains a
central GA dinucleotide. The element is then transferred to the
recipient cell by conjugation. In the recipient, it recognizes a target
sequence containing a GA dinucleotide and inserts, resulting in an
integrated copy of Tn5397 flanked by GA dinucleotides. We
hypothesized that TndX is responsible for catalyzing the excision and
insertion reactions. To test this, the tndX gene was cloned
and the protein was overexpressed in Escherichia coli. The
functions of this protein were tested by conducting excision and
insertion assays in E. coli using mini-transposons derived
from Tn5397. The roles of the highly conserved residues at
the N-terminal resolvase/invertase domain and the role of the C-terminal nonconserved region of this protein were investigated by
mutagenesis studies. The target site choices of the minitransposon in
E. coli were also analyzed.
Bacterial strains.
Bacterial strains used are listed in
Table 1. E. coli BLR(DE3) was
used as a host for overexpression of wild-type and mutant proteins.
E. coli XL-1 Blue was used as a host for transformations and
plasmid preparations. DNA from C. difficile 630 was used as template for amplification of tndX. DNAs from C. difficile CD37 and B. subtilis CU2189 were used as
templates for amplification of the Tn5397 targets.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The Large Resolvase TndX Is Required and Sufficient
for Integration and Excision of Derivatives of the Novel
Conjugative Transposon Tn5397
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
resolvase, and Mu invertase Gin, show significant amino acid
sequence similarity within their N-terminal regions (12, 16, 21, 41). They make staggered 2-bp cuts at a central dinucleotide within the crossover site, leaving recessed 5' ends. The hydroxyl group
of a conserved serine residue located near the N terminus of these
recombinases is the nucleophile responsible for the cleavage of the DNA
backbone at the dinucleotide (17, 23, 31). The members of
the large resolvase subgroup have the resolvase/invertase catalytic
domain in their N-terminal regions but are much larger and more diverse
in their C termini (8, 45). Their molecular masses are
between 50.7 and 82 kDa, while those of the typical members of the
resolvase/invertase family are only about 20 kDa. The large resolvases
are found associated with a range of genetic elements; for example,
CisA is required for excision of DNA in spore development
(38), XisF is involved in heterocyst development (5), 
C31 integrase is required for integration and
excision of bacteriophage genomes (45), and TnpX is required
for excision of the Clostridium perfringens transposon
Tn4451 (8). Analysis of the amino acid sequence
of TndX from Tn5397 revealed that it contains a 61.5-kDa
putative polypeptide and is most closely related to TnpX, with 37%
identity and 61% similarity over the full length of the proteins
(46).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
TABLE 1.
Bacterial strains and plasmids used in this study
Construction of plasmids. The plasmids used are listed in Table 1 and were constructed as follows. pET-TndX was constructed by cloning the tndX gene (46) into a pET19 vector (Novagen) via XhoI and BamHI sites. The tndX gene was amplified by PCR using P1 (5' GCCTCGAGTTGTTAAAACAGCAAGC 3') and P2 (5' GCGGATCCCTATCAATGAGACACTGC 3') as primers. This amplification does not include the tndX ribosome binding site, and the gene is under the control of the vector translational signals. Pairs of complementary primers were designed to generate single amino acid substitutions within TndX as follows: P3 (5' GTTGCATTATACTCTGCGCTTTCACGAGATGATG 3') and P4 (5' CATCATCTCGTGAAAGCGCAGAGTATAATGCAAC 3') for pET-TndX(R17-A), P5 (5' CATTATACTCTCGCCTTGCGCGAGATGATGGGTTG 3') and P6 (5' CAACCCATCATCTCGCGCAAGGCGAGAGTATAATG 3') for pET-TndX(S19-A), and P7 (5' GTCACGTCTAGGAGCGAACAATGCACTATTC 3') and P8 (5' GAATAGTGCATTGTTCGCTCCTAGACGTGAC 3') for pET-TndX(R93-A). The negative-strand primers were used together with P1 to amplify the left-hand part of the mutated TndX, while the positive-strand primers were used together with P2 to amplify the right-hand part. P1 and P2 were then used to join the left- and right-hand segments of the DNA coding for the proteins, using equal molar amounts of the corresponding left- and right-hand PCR products as templates. These products were cloned into pET19 as previously described for tndX. DNA sequencing verified that no changes, other than the desired mutation, were introduced by these manipulations (data not shown). pET-TndX(N261) was constructed by using primers P1 and P9 (5' GCGGGATCCCTAAGATACCATGTGTCCTAG 3') to amplify the region encoding the N-terminal 261 amino acids of TndX and then cloning the PCR product into pET19 as described above; again, the construct was verified by DNA sequencing. To make miniTn5397A, the catP gene was amplified from pJIR62 (1) using primers P10 (5' CCTCTGCTTGTTCAGTTTCCGGGAGTGCAGTCGAAGTGGGC 3') and P11 (5' CGTTCCCCACCCAATAGACCGGTCTTTGTACTAACCTGTGG 3'). The left and right ends of Tn5397 was amplified using P12 (5' GCGGGATCCGCATATTACGCATCTCATTA 3') and P13 (5' GCCCACTTCGACTGCACTCCCGGAAACTGAACAAGCAGAGG 3') as a pair and P14 (5' CCACAGGTTAGTACAAAGACCGGTCTATTGGGTGGGGAACG 3') and P15 (5' GCGGGATCCGAAAACTGCTTGGATTCAG 3') as a pair, respectively. Since primers P10 and P13 and primers P11 and P14 are complementary to each other, these three PCR products were joined by subsequent PCRs to produce mini-Tn5397A. pSU-mini-Tn5397A was constructed by cloning mini-Tn5397A into pSU39 (4) via the BamHI site. Plasmids pET-CDatt and pET-TndX-CDatt were constructed by cloning the Tn5397 target site from C. difficile CD37 (including about 200 bp on each side of the insertion point) into pET19 and pET-TndX respectively, via the BamHI site. For pET-BSatt and pET-TndX-BSatt, the Tn5397 target site found in B. subtilis BS2 was amplified by PCR using P22 (5' GCGGGATCCCTTCCCGCGCGAATATCG 3') and P21 (5' GCGGGATCCGAAAACGGATGGGAATACG 3') as primers and genomic DNA from B. subtilis CU2189 as template; this product (including about 200 bp on each side of the insertion point) was cloned into pET19 and pET-TndX, respectively, via the BamHI site. pSU-mini-Tn5397B was made by cloning the joint region of the circular form of Tn5397 (amplified by PCR using primers P16 [5' ACCGGCGGATCCACGTGTATCAAGCAGAGGGAATCGGTAAA 3'] and P17 [5' AAAGGCGGATCCACAACCAGCAGGAAAACA 3']) into pSU39 via the BamHI site.
Protein expression and purification. TndX and each of its derivatives were expressed in E. coli BLR(DE3) cells as a fusion to the C terminus of a 10-histidine tag and purified by using TALON resin (Clontech). The protein expression and purification procedures from the manufacturers (Novagen and Clontech) were followed with some modifications. Briefly, to check protein expression, the cell pellet from 1 ml of culture was completely dissolved in denaturing lysis buffer (20 mM Tris-HCl [pH 8.0], 100 mM NaCl, 8 M urea), purified with TALON resin, eluted with 100 mM EDTA, and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
Excision and insertion assays.
In the excision assay,
pSU-mini-Tn5397A, together with pET19 or with pET-TndX, was
introduced into E. coli BLR(DE3) cells by transformation.
Protein expression was induced by adding
isopropyl-
-D-thiogalactopyranoside (IPTG) to a final
concentration of 1 mM to the cell culture (optical density at 550 nm = 0.5), and the mixture was left for about 16 h before the
cells were harvested. The samples were analyzed by SDS-PAGE to confirm
the expression of TndX. Plasmid DNA was prepared (Qiagen) from these
cells, and PCRs were conducted to analyze the excision products with
the plasmid DNA as templates. Primers P18
(ACGTGTATCAAGCAGAGGGAATCGGTAAA) and P19
(CCACTTGATATGAAAAATCAAATGGCTC) were used to detect the
formation of the circular form of the transposon. Primers P12 and P15
were used to detect the regenerated target site. These PCR products
were analyzed by agarose gel electrophoresis and by DNA sequencing
using Big Dye mix (Applied Biosystems) and an ABI PRISM 310 genetic
analyzer (Applied Biosystems). In the insertion assay,
pSU-mini-Tn5397B, together with pET-CDatt or pET-TndX-CDatt, was introduced into E. coli
BLR(DE3) cells and TndX expression was induced. PCRs were conducted to
detect the insertion of mini-Tn5397B into the target site.
Primers P19 and P15 were used for the left transposon end-host genome
junction, and P12 and P18 were used for the right. These PCR products
were analyzed by agarose gel electrophoresis and DNA sequencing.
| |
RESULTS AND DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
Expression of TndX in E. coli.
The tndX gene
is 1,599 bp and encodes a putative protein of 61.5 kDa (46).
To confirm the presence of this protein and to obtain sufficient
quantities for functional studies, tndX was amplified by PCR
from genomic DNA of a Tn5397-bearing C. difficile strain 630 (Table 1) and cloned into pET19 to make pET-TndX. DNA
sequencing of this construct confirmed that tndX was in the correct reading frame and that no mutations had been created as a
result of the amplification and cloning procedures (data not shown).
TndX was then expressed in E. coli BLR(DE3) cells as a fusion to the C terminus of a 10-histidine tag. This protein was purified under denaturing conditions (see Materials and Methods) and
analyzed by SDS-PAGE. A protein of about the expected size, 61.5 kDa,
was detected from cells carrying pET-TndX but not from those carrying
pET19 (Fig. 1).
|
TndX can catalyze excision and insertion of
mini-Tn5397s in E. coli.
To determine whether
the overexpressed TndX was functional, independent assays were designed
to test the two crucial steps of transposition, excision and insertion,
upon expression of TndX in E. coli. Since the 21-kb
Tn5397 was too large to be manipulated easily, two
minitransposons were constructed. Mini-Tn5397A represents the linear parental transposon, and mini-Tn5397B represents
the circular form of the transposon. These were used in the excision and insertion assays, respectively (Fig.
2A and 3A).
In mini-Tn5397A, the central region of Tn5397 was
replaced by a chloramphenicol acetyltransferase gene (catP)
(42) while each side retained a fragment containing about
250 bp of element end sequence plus about 200 bp of C. difficile flanking genomic sequence. The 1.7-kb mini-Tn5397A was cloned into pSU39 to make
pSU-mini-Tn5397A (Fig. 2A). To test for excision of
mini-Tn5397A, pSU-mini-Tn5397A, together with
pET-TndX or pET19, was introduced into E. coli BLR(DE3)
cells before TndX expression was induced. The production of TndX was confirmed by SDS-PAGE after induction (data not shown). Plasmid DNA was
prepared from the cells and used as templates in PCRs to detect the
presence of the circular form of the minitransposon and the empty
target site. The circular form was detected by PCR using primers P18
and P19 to amplify the joint of the two ends of the element (Fig. 2A).
A product of about the expected size, 215 bp, was obtained in cells
containing pET-TndX but not in those containing pET19 (Fig. 2B, left,
lanes 1 and 2). DNA sequence analysis of this PCR product showed that
it contained the ends of the element joined by a GA dinucleotide (data
not shown). This joint was identical to that of the circular form of
Tn5397 in C. difficile (46). To detect
the empty target site remaining after mini-Tn5397A excision,
primers P12 and P15 were used to amplify the target site by PCR. A PCR
product of about the expected size, 438 bp, which represented the
regenerated target site, was obtained only when TndX was expressed. The
other PCR product, of about 1.7 kb, representing
mini-Tn5397A integrated into its target site, was obtained
in samples with and without the presence of TndX (Fig. 2B, right, lanes
1 and 2). DNA-sequencing analysis of the smaller PCR product showed
that it was a regenerated target site identical to that in the
C. difficile genome. The above data show that TndX
overexpressed in E. coli catalyzes the excision of
mini-Tn5397A, formation of a circular molecule, and
regeneration of the target site. This is the same as the behavior of
Tn5397 on excision in C. difficile
(46).
|
|
C31, could mediate only
integration and not excision in both in vitro assays and in E. coli.
Point mutations of key amino acids and deletion of the C-terminal
extension all abolish the activity of TndX.
TndX is homologous to
other members of the resolvase/invertase family at its N terminus but
has an unique extended C terminus (46). To investigate the
role of some of the highly conserved residues in the N terminus of TndX
(13, 15, 26) on excision and insertion of Tn5397,
arginine 17, serine 19, and arginine 93 were changed to alanine by
site-directed mutagenesis. A C-terminal deletion which retained the
N-terminal 261 amino acids containing the complete resolvase/invertase
domain of TndX was also created to see whether this domain alone is
functional. Each of the mutated genes was cloned into the expression
vector pET-19 as described for TndX, and the mutations were confirmed
by DNA sequence analysis. The expression of each of these proteins was
induced and confirmed by SDS-PAGE (data not shown). Assays were then
carried out to analyze the ability of each of the mutated TndX proteins
to catalyze excision and insertion of mini-Tn5397A and
mini-Tn5397B, respectively, in E. coli. Neither
joined element ends nor empty target sites were detected by PCR when
each of these four mutant TndX derivatives was used in the excision
assay (Fig. 2B, lanes 3 to 6), indicating that the element was not
excised, so that the two ends could not be joined to generate a
circular minitransposon. For the insertion assay, the target site of
Tn5397 in C. difficile was cloned into the
plasmids containing the mutant tndX genes, i.e., into
pET-TndX(R17-A), pET-TndX(S19-A), pET-TndX(R93-A), and pET-TndX(N261)
to generate pET-TndX(R17-A)-CDatt,
pET-TndX(S19-A)-CDatt,
pET-TndX(R93-A)-CDatt and
pET-TndX(N261)-CDatt, respectively. In this assay, no
transposon-target sequence junctions were detected by PCR when each of
the four mutated proteins were used (Fig. 3B, lanes 3 to 6), suggesting the transposon could not recognize its target and insert in the presence of each of these mutated proteins. These results showed that
arginine 17, serine 19, and arginine 93 of TndX were essential for the
resolvase/invertase domain of TndX to catalyze excision and insertion
reactions. The related large resolvases TnpX and the C31 integrase
were also subject to site-directed mutagenesis of amino acids in
comparable sites; it was found that these mutations abolish the
activity of these two proteins (8, 45). Taken together,
these data provide good evidence that the conserved amino acids are
absolutely required for integration; our data also indicate that they
are required for excision.
Target site choices of mini-Tn5397B in E. coli. Tn5397 was shown to insert into one specific target sequence in C. difficile but could enter different targets in the B. subtilis genome (46). For all the targets analyzed, no consensus sequences could be deduced apart from the central GA dinucleotide core (46). To determine the preference of mini-Tn5397B insertion between the original targets and other GA-containing sequences nearby in E. coli, the Tn5397 targets identified from C. difficile 630 and B. subtilis BS2 were amplified by PCR from genomic DNA of C. difficile CD37 and B. subtilis CU2189. The 400-bp DNA fragments containing one of the target sites from C. difficile CD37 and from B. subtilis BS2 were cloned into pET-TndX to make pET-TndX-CDatt and pET-TndX-BSatt, respectively (Table 1). Either pET-TndX-CDatt or pET-TndX-BSatt, together with pSU-mini-Tn5397B, was transformed into E. coli BLR(DE3) cells. Expression of the tndX gene was induced by ITPG. It was anticipated that TndX would catalyze the insertion of mini-Tn5397B into the target site on pET-TndX-CDatt or pET-TndX-BSatt, resulting in fusion of the two plasmids. However, there could be a mixture of plasmids, i.e., pET-TndX-CDatt (or pET-TndX-BSatt), pSU-mini-Tn5397B, and fused plasmids (some of the latter may have fused at different sites, depending on which targets are recognized by TndX). This would make the subsequent PCR experiment difficult to interpret (see below). Therefore, plasmids were extracted from the cells after induction and the plasmid mixture was used to transform E. coli XL-1 Blue. Transformants were selected on Luria-Bertani plates containing ampicillin and kanamycin. Each colony should contain a single type of fused plasmid with mini-Tn5397B inserted in its target. Plasmids were extracted from single colonies and used as templates in PCRs. A pair of primers, one reading out from the element end, P19, and the other reading toward the cloned target site from the vector, P20, were used (Fig. 3A). A total of 40 transformants containing inserted mini-Tn5397B for each cloned target site were analyzed. All 40 samples for the C. difficile 630 target gave the same-sized PCR products, as did the other 40 samples for the B. subtilis BS2 target. Further analysis of these PCR products by DNA sequencing showed that they all represented the minitransposon inserted into the GA dinucleotide of the cloned C. difficile or B. subtilis target site (data not shown). These results indicate that only the original target is used in these experiments. To rule out the possibility that all the transformants we analyzed in these experiments were siblings, we repeated the experiment and obtained identical results. No other sites were chosen as targets, although there were another 22 GA dinucleotides located in the region between the P20 primer and the central GA dinucleotide of the cloned target site. This data showed that TndX, the only Tn5397-encoded protein, determines the target site specificity of the minitransposon in E. coli.
We have demonstrated that in E. coli the mini-Tn5397 transposon had the same target preference as did the native element in B. subtilis or C. difficile. Other GA dinucleotides in the target region were not chosen as insertion sites. In some of the B. subtilis insertion sites, the central GA is flanked by imperfect inverted repeats. Moreover, the insertion site in C. difficile is similar to the ends of the transposon (46). Homology between the transposon ends and target sites has also been found in the nonconjugative clostridial transposon Tn4451 (8).Concluding remarks. In summary, we have demonstrated that minitransposons containing the ends of Tn5397 can transpose in E. coli. TndX is the only Tn5397-encoded protein required for excision and insertion of these elements. This showed for the first time that a member of the large-resolvase subgroup of the resolvase/invertase family of site-specific recombinase can mediate the insertion and excision of a conjugative transposon. The simple requirements for the transposition of this element indicate that it is a promising candidate to be modified to create a useful vector for gram-positive and gram-negative bacteria.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful to Adam Roberts, Paul Stapleton, and Julian Rood for helpful discussions and for careful reading of the manuscript.
This work was funded by Wellcome Trust grant 50927/JM.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Eastman Dental Institute for Oral Health Care Sciences, University College London, 256 Gray's Inn Rd., London WC1X 8LD, United Kingdom. Phone: 44 (0)20 7915 1223. Fax: 44 (0)20 7915 1127. E-mail: p.mullany{at}eastman.ucl.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References
|
|---|
| 1. | Abraham, L. J., A. K. Wales, and J. I. Rood. 1985. World-wide distribution of the conjugative Clostridium perfringens tetracycline resistance plasmid, pCW3. Plasmid 14:37-46[CrossRef][Medline]. |
| 2. |
Abremski, K. E., and R. H. Hoess.
1992.
Evidence for a second conserved arginine residue in the integrase family of recombination proteins.
Protein Eng.
5:87-91 |
| 3. | Argos, P., A. Landy, K. Abremski, J. B. Egan, E. Haggard-Ljunquist, R. H. Hoess, et al. 1986. The integrase family of site specific recombinases: regional similarities and global diversity. EMBO J. 5:433-440[Medline]. |
| 4. | Bartolome, B., Y. Jubete, E. Martinez, and F. de la Cruz. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75-78[CrossRef][Medline]. |
| 5. |
Carrasco, C. D.,
K. S. Ramaswamy,
T. S. Ramasubramanian, and J. W. Golden.
1993.
Anabaena xisF gene encodes a developmentally regulated site specific recombinase.
Genes Dev.
8:74-83 |
| 6. |
Christie, P. J.,
R. Z. Korman,
S. A. Zahler,
J. C. Adsit, and G. M. Dunny.
1987.
Two conjugation systems associated with Streptococcus faecalis plasmid pCF10: identification of a conjugative transposon that transfers between S. faecalis and Bacillus subtilis.
J. Bacteriol.
169:2529-2536 |
| 7. |
Christiansen, B.,
L. Brøndsted,
F. K. Vogensen, and K. Hammer.
1996.
A resolvase-like protein is required for the site-specific integration of the temperate lactococcal bacteriophage TP901-1.
J. Bacteriol.
178:5164-5173 |
| 8. |
Crellin, P. K., and J. I. Rood.
1997.
The resolvase/invertase domain of the site specific recombinase TnpX is functional and recognises a target sequence that resembles the junction of the circular form of the Clostridium perfringens transposon Tn4451.
J. Bacteriol.
179:5148-5156 |
| 9. |
Evan, B. R.,
J. W. Chen,
R. L. Parsons,
T. K. Bauer,
D. B. Teplow, and M. Jayaram.
1990.
Identification of the active site tyrosine of Flp recombinase.
J. Biol. Chem.
265:18504-18510 |
| 10. | Flannagan, S. E., L. A. Zitzow, Y. A. Su, and D. B. Clewell. 1994. Nucleotide sequence of the 18 kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32:350-354[CrossRef][Medline]. |
| 11. |
Franke, A. E., and D. B. Clewell.
1981.
Evidence for a chromosome borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of conjugal transfer in the absence of a plasmid.
J. Bacteriol.
145:494-502 |
| 12. | Glasgow, A. C., K. T. Hughes, and M. I. Simon. 1989. Bacterial DNA inversion systems, p. 637-659. In D. E. Berg, and M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. |
| 13. | Guo, F., D. N. Gopaul, and G. D. van Duyne. 1997. Structure of Cre recombinase complexed with DNA in a site specific recombination synapse. Nature 389:40-46[CrossRef][Medline]. |
| 14. |
Hachler, H.,
F. H. Kayser, and B. Berger-Bachi.
1987.
Homology of a transferable tetracycline resistance determinant of Clostridium difficile with Streptococcus (Enterococcus) faecalis transposon Tn916.
Antimicrob. Agents Chemother.
31:1033-1038 |
| 15. | Halfter, P., T. Pripfl, and T. A. Bickle. 1989. A mutational analysis of the bacteriophage P1 cin recombinase gene: intragenic complementation. Mol. Gen. Genet. 215:245-249[CrossRef][Medline]. |
| 16. | Hatfull, G. F., and N. D. F. Grindley. 1988. Resolvase and DNA invertases: a family of enzymes active in sit-specific recombination, p. 357-396. In R. Kucherlapai, and G. Smith (ed.), Genetic recombination. American Society for Microbiology, Washington, D.C. |
| 17. |
Hatfull, G. F., and N. D. F. Grindley.
1986.
Analysis of resolvase mutants in vitro: evidence for an interaction between serine-10 of resolvase and sit I of res.
Proc. Natl. Acad. Sci. USA
83:5429-5433 |
| 18. |
Ito, T.,
Y. Katayama, and K. Hiramatsu.
1999.
Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315.
Antimicrob. Agents Chemother.
43:1449-1458 |
| 19. |
Jaworski, D. D., and D. B. Clewell.
1995.
A functional origin of transfer (oriT) on the conjugative transposon Tn916.
J. Bacteriol.
177:6644-6651 |
| 20. | Landy, A. 1989. Dynamic, structural, and regulatory aspects of lambda site specific recombination. Annu. Rev. Biochem. 58:913-949[Medline]. |
| 21. |
Leschziner, A. E.,
M. R. Boocock, and N. D. F. Grindley.
1995.
The tyrosine-6 hydroxyl of resolvase is not required for the DNA cleavage and rejoining reactions.
Mol. Microbiol.
15:865-870[CrossRef][Medline].
|
| 22. | Marra, D., and J. R. Scott. 1999. Regulation of excision of the conjugative transposon Tn916. Mol. Microbiol. 31:609-621[CrossRef][Medline]. |
| 23. | Mazzarelli, J. M., M. R. Ermacora, R. O. Fox, and N. D. F. Grindley. 1993. Mapping interactions between the catalytic domain of resolvase and its DNA substrate using cystein-coupled EDTA-iron. Biochemistry 32:2979-2986[CrossRef][Medline]. |
| 24. |
Mullany, P.,
M. Wilks,
I. Lamb,
C. Clayton,
B. Wren, and S. Tabaqchali.
1990.
Genetic analysis of a tetracycline resistance determinant from Clostridium difficile and its conjugal transfer to and from Bacillus subtilis.
J. Gen. Microbiol.
136:1343-1349 |
| 25. | Mullany, P., M. Pallen, M. Wilks, and S. Tabaqchali. 1996. A group II intron in a conjugative transposon from the Gram-positive bacterium, Clostridium difficile. Gene 174:145-150[CrossRef][Medline]. |
| 26. |
Newman, B. J., and N. D. F. Grindley.
1984.
Mutants of the resolvase: a genetic analysis of the recombination function.
Cell
38:463-469[CrossRef][Medline].
|
| 27. | Nunes-Duby, S. E., M. A. Azaro, and A. Landy. 1995. Swapping DNA strands and sensing homology without branch migration in lambda sit-specific recombination. Curr. Biol. 5:139-148[CrossRef][Medline]. |
| 28. |
Pargellis, C. A.,
S. E. Nunes-Duby,
L. Moitoso de Vargas, and A. Landy.
1988.
Suicide recombination substrates yield covalent  integrase-DNA complexes and lead to identification of the active site tyrosine.
J. Biol. Chem.
263:7678-7685 |
| 29. |
Popham, D. L., and P. Stragier.
1992.
Binding of the Bacillus subtilis spoIVCA product to the recombination sites of the element interrupting the sigma K-encoding gene.
Proc. Natl. Acad. Sci. USA
89:5991-5995 |
| 30. | Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1989. Molecular characterisation of two proteins involved in the excision of the conjugative transposon Tn1545: homologies with other site specific recombinases. EMBO J. 8:2425-2433[Medline]. |
| 31. |
Reed, R. R., and C. D. Moser.
1984.
Resolvase-mediated recombination intermediates contain a serine residue covalently linked to DNA.
Cold Spring Harbor Symp. Quant. Biol.
49:245-249 |
| 32. |
Rice, L. B.
1998.
Tn916 family of conjugative transposons and dissemination of antimicrobial resistance determinants.
Antimicrob. Agents Chemother.
42:1871-1877 |
| 33. | Roberts, A. P., J. Pratten, M. Wilson, and P. Mullany. 1999. Transfer of a conjugative transposon, Tn5397, in a model oral biofilm. FEMS Microbiol. Lett. 177:63-66[CrossRef][Medline]. |
| 34. |
Rudy, C. K.,
J. R. Scott, and G. Churchward.
1997.
DNA binding by the Xis protein of the conjugative transposon Tn916.
Nucleic Acids Res.
25:4061-4066 |
| 35. |
Rudy, C. K., and J. R. Scott.
1994.
Length of the coupling sequence of Tn916.
J. Bacteriol.
176:3386-3388 |
| 36. |
Sadowski, P.
1986.
Site-specific recombinases: changing partners and doing the twist.
J. Bacteriol.
165:341-347 |
| 37. |
Salyers, A. A.,
N. B. Shoemaker,
A. M. Stevens, and L. Lhing-Yew.
1995.
Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.
Microbiol. Rev.
59:579-590 |
| 38. |
Sato, T.,
Y. Samori, and Y. Kobayashi.
1990.
The cisA cistron of Bacillus subtilis sporulation gene spoIVC encodes a protein homologous to a site specific recombinase.
J. Bacteriol.
172:1092-1098 |
| 39. | Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[CrossRef][Medline]. |
| 40. | Scott, J. R., F. Bringel, D. Marra, G. Van Alstine, and C. K. Rudy. 1994. Conjugative transposition of Tn916: preferred targets and evidence for conjugative transfer of a single strand and for a double-stranded circular intermediate. Mol. Microbiol. 11:1099-1108[CrossRef][Medline]. |
| 41. | Stark, W. M., M. R. Boocock, and D. J. Sherratt. 1992. Catalysis by site specific recombinases. Trends Genet. 8:432-439[Medline]. |
| 42. | Steffen, C., and H. Matzura. 1989. Nucleotide sequence analysis and expression studies of a chloramphenicol-acetyltransferase-coding gene from Clostridium perfringens. Gene 75:349-354[CrossRef][Medline]. |
| 43. |
Stores, M. J.,
C. Poyart-Salmeron,
P. Trieu-Cuot, and P. Courvalin.
1991.
Conjugative transposition of Tn916 requires the excisive and integrative activities of the transposon-encoded integrase.
J. Bacteriol.
173:4347-4352 |
| 44. | Su, Y. A., and D. B. Clewell. 1993. Characterisation of the left 4 kb of conjugative transposon Tn916: determinants involved in excision. Plasmid 30:234-250[CrossRef][Medline]. |
| 45. |
Thorpe, H. M., and M. C. M. Smith.
1998.
In vitro site specific integration of bacteriophage DNA catalysed by a recombinase of the resolvase/invertase family.
Proc. Natl. Acad. Sci. USA
95:5505-5510 |
| 46. |
Wang, H.,
A. P. Roberts,
D. Lyras,
J. I. Rood,
M. Wilks, and P. Mullany.
2000.
Characterization of the ends and target sites of the novel Tn916-like conjugative transposon Tn5397 from Clostridium difficile: demonstration that excision and circularization is mediated by TndX, a member of the large resolvase family.
J. Bacteriol.
182:3775-3783 |
Journal of Bacteriology, December 2000, p. 6577-6583, Vol. 182, No. 23
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rowley, P. A., Smith, M. C. A., Younger, E., Smith, M. C. M.
(2008). A motif in the C-terminal domain of {phi}C31 integrase controls the directionality of recombination. Nucleic Acids Res
36: 3879-3891
[Abstract] [Full Text] -
Gupta, M., Till, R., Smith, M. C. M.
(2007). Sequences in attB that affect the ability of {phi}C31 integrase to synapse and to activate DNA cleavage. Nucleic Acids Res
35: 3407-3419
[Abstract] [Full Text] -
Wang, H., Smith, M. C. M., Mullany, P.
(2006). The Conjugative Transposon Tn5397 Has a Strong Preference for Integration into Its Clostridium difficile Target Site. J. Bacteriol.
188: 4871-4878
[Abstract] [Full Text] -
Smith, M. C. A., Till, R., Brady, K., Soultanas, P., Thorpe, H., Smith, M. C. M.
(2004). Synapsis and DNA cleavage in {phi}C31 integrase-mediated site-specific recombination. Nucleic Acids Res
32: 2607-2617
[Abstract] [Full Text] -
Coyne, M. J., Weinacht, K. G., Krinos, C. M., Comstock, L. E.
(2003). Mpi recombinase globally modulates the surface architecture of a human commensal bacterium. Proc. Natl. Acad. Sci. USA
100: 10446-10451
[Abstract] [Full Text] -
Beaber, J. W., Hochhut, B., Waldor, M. K.
(2002). Genomic and Functional Analyses of SXT, an Integrating Antibiotic Resistance Gene Transfer Element Derived from Vibrio cholerae. J. Bacteriol.
184: 4259-4269
[Abstract] [Full Text] -
Roberts, A. P., Johanesen, P. A., Lyras, D., Mullany, P., Rood, J. I.
(2001). Comparison of Tn5397 from Clostridium difficile, Tn916 from Enterococcus faecalis and the CW459tet(M) element from Clostridium perfringens shows that they have similar conjugation regions but different insertion and excision modules. Microbiology
147: 1243-1251
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»