Previous Article | Next Article 
Journal of Bacteriology, December 2000, p. 6687-6693, Vol. 182, No. 23
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Inorganic Polyphosphate in Vibrio
cholerae: Genetic, Biochemical, and Physiologic Features
Nobuo
Ogawa,
Chi-Meng
Tzeng,
Cresson D.
Fraley, and
Arthur
Kornberg*
Department of Biochemistry, Stanford
University School of Medicine, Stanford, California 94305-5307
Received 12 May 2000/Accepted 8 September 2000
 |
ABSTRACT |
Vibrio cholerae O1, biotype El Tor, accumulates
inorganic polyphosphate (poly P) principally as large clusters of
granules. Poly P kinase (PPK), the enzyme that synthesizes poly P from
ATP, is encoded by the ppk gene, which has been cloned from
V. cholerae, overexpressed, and knocked out by
insertion-deletion mutagenesis. The predicted amino acid sequence of
PPK is 701 residues (81.6 kDa), with 64% identity to that of
Escherichia coli, which it resembles biochemically. As in
E. coli, ppk is part of an operon with
ppx, the gene that encodes exopolyphosphatase (PPX).
However, unlike in E. coli, PPX activity was not detected
in cell extracts of wild-type V. cholerae. The
ppk null mutant of V. cholerae has diminished
adaptation to high concentrations of calcium in the medium as well as
motility and abiotic surface attachment.
 |
INTRODUCTION |
Inorganic polyphosphate poly P is a
linear polymer of up to hundreds of orthophosphate (Pi)
residues linked by high-energy phosphoanhydride bonds. Among known
functions, poly P can serve as a substitute for ATP in kinase
reactions, a Pi reservoir, and a chelator of divalent
metals (9). Poly P is ubiquitous in nature, having been
found in all organisms examined (15), yet little is known
about its physiological roles (14).
Several poly P-metabolizing enzymes have been purified, and the genes
encoding them have been cloned (14, 28). The enzyme primarily responsible for poly P synthesis in Escherichia
coli is poly P kinase (PPK), which catalyzes the polymerization of the
phosphate of ATP into a poly P chain (1). Poly P can be hydrolyzed to Pi by an exopolyphosphatase (PPX)
(3). In E. coli, the encoding genes,
ppk and ppx, respectively, form an operon. The
inability to accumulate poly P upon deletion of this operon or upon the
overproduction of PPX has produced several striking phenotypes in
E. coli (6, 20, 25): decreased long-term survival
in stationary phase; increased sensitivity to oxidative, osmotic, and
thermal stresses; and defects in adaptive growth in minimal medium
after a shift from rich medium. These phenotypes are likely due to the
decreased expression of the rpoS gene, which encodes the
principal stationary-phase sigma factor,
S, or RpoS
(25). These and related results (4) suggest that poly P is an effector signal for responses to acute stringencies and
adaptations in the stationary phase.
Recently available genome sequences have revealed that PPK is highly
conserved in many bacterial species, including some important pathogens
(26). This also implies that PPK and/or poly P has fundamental physiological roles in bacteria. The ppk
knockout mutant of Pseudomonas aeruginosa PAO1 shows a
dramatic deficiency in motility, both flagellar and pilus mediated, an
inability to form biofilms, and a loss of virulence (22, 23,
24). ppk null mutants of several other pathogens and
of E. coli also exhibit reduced motility and reduced abiotic
surface attachment (22, 24).
Vibrio spp. are among the most common microorganisms in
environmental surface waters, such as lakes and rivers. Vibrio
cholerae O1 is an enteropathogenic gram-negative bacterium that
causes severe diarrheal disease. An rpoS mutant of V. cholerae (29) revealed that RpoS is required for
V. cholerae persistence in a medium devised to simulate
natural aquatic habitats. A gene highly homologous to E. coli
ppk was found in the V. cholerae database of The
Institute for Genomic Research (TIGR) (26). The essential
role of poly P for the stationary-phase survival of E. coli
and the possibility of a similar role in V. cholerae prompted us to study its PPK and to examine the phenotype of a ppk knockout mutant.
V. cholerae O1, biotype El Tor, accumulates much higher
levels of poly P than E. coli under normal growth
conditions. High accumulations of poly P are stored as granules
following a shift from a defined medium lacking Pi to one
with an excess (20 mM). The ppk null mutant is defective in
motility and abiotic surface attachment and fails to adapt to high
concentrations of calcium.
 |
MATERIALS AND METHODS |
Strains and plasmids.
E. coli strains MG1655
(
F
) and CF5802 (MG1655
ppk
ppx::Kan [17]) were the wild-type
and mutant strains, respectively. Recombinant plasmids based on
pBluescript II KS(+) and SK(+) (Stratagene, La Jolla, Calif.) were
prepared from DH5
transformants. Suicide plasmids based on pKNG101
(11) were replicated in E. coli strain S17-1(
pir) (29); pFZY1 (13) was used as a
low-copy-number vector. The 92A1552-Rifr wild-type strain
of V. cholerae O1 (El Tor, Inaba [29]) and the cosmid library of its genomic DNA were provided by F. Yildiz, Department of Microbiology and Immunology, Stanford University.
Media and growth conditions.
A MOPS
(morpholinepropanesulfonic acid)-buffered minimal medium
(21) was used to impose Pi-limiting conditions
for the growth of V. cholerae. Media were supplemented with
ampicillin (100 µg/ml), kanamycin (150 µg/ml), or streptomycin (100 µg/ml) to select for antibiotic-resistant transformants of V. cholerae.
Plasmid construction.
The V. cholerae PPK
sequence was obtained by a BLAST search of the TIGR genome sequence
database using the E. coli sequence. To obtain the
ppk region of V. cholerae, two PCR primers were designed: VCPPKFOR1, CCTTCTAGACAACTCTATGACACTAAAGGCAC,
and VC PPKREV1,
CCTGTCGACTCTGCCGATGAGATAAAGAC.
VCPPKFOR1 contains an XbaI site, and VCPPKREV1
contains a SalI site, each located at the 5' end
(underlined). These primers yielded a 1.95-kb PCR product using genomic
DNA prepared from the wild-type V. cholerae strain 92A1552-Rifr as a template. This fragment begins at
position
106 relative to the A in the start codon at +1 and ends at
position +1829. After digestion with both XbaI and
SalI, this PCR product was cloned into XbaI- and
SalI-digested pBluescript II KS(+); the resulting plasmid
was designated pVCK1.
The cosmid pVCK20 was obtained by colony hybridization from a V. cholerae genome library using the 1.95-kb PCR fragment as a probe;
pVCK20 contained an insert of more than 40 kb in which the
ppk homologous region was limited to a 2.5-kb
NcoI-BglII fragment (pVCK35 [Fig.
1A]).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
The ppk ppx operon in V. cholerae
and recombinant plasmids. (A) The large box represents the cloned and
sequenced 4-kb NcoI-PstI chromosomal fragment
containing the operon. ORFs are indicated by arrows. The lines under
the box indicate the portions of the ppk ppx region inserted
in the plasmids indicated to the left. The nonunique EcoRI
and EcoRV restriction sites in the 4-kb
NcoI-PstI fragment are denoted by subscripts. (B)
Putative pho box sequence in the ppk promoter
region. (C) Sequence overlap between the ppk and
ppx ORFs. The center sequence is the nucleotide sequence of
the ppk ppx ORF junction, and the top and bottom sequences
are the deduced amino acid sequences for PPK and PPX, respectively. (D)
Putative transcriptional terminator sequence in the region downstream
of ppx. The pair of sequences indicated by the arrows have
the potential to form a stem-loop structure. The underlined nucleotides
are the indicated start and stop codons.
|
|
Plasmids containing the cloned
V. cholerae ppk gene were
constructed as follows. A 6.5-kb
HindIII-
PstI
fragment containing
ppk prepared from pVCK20 was inserted
into similarly restricted
pBluescript II SK(+). The resulting plasmid,
pVCK27, was digested
with
HindIII and
NcoI,
and the 7-kb fragment was isolated. After
the ends were filled in, this
fragment was self-ligated. The resulting
plasmid, pVCK31 (Fig.
1A),
contains the 4-kb
NcoI-
PstI fragment
in
pBluescript II SK(+). A smaller plasmid, pVCK35 (Fig.
1A),
was
constructed by digestion of pVCK31 with
BglII and
BamHI, followed
by self-ligation of the resulting longer
fragment; pVCK35 harbors
the 2.5-kb
NcoI-
BglII
fragment in pBluescript II SK(+).
A low-copy-number plasmid containing the
V. cholerae ppk ppx
loci, pVCK37, was constructed as follows. pVCK31 was digested
with
BamHI and
SalI, and the fragment with the 4-kb
NcoI-
PstI
ppk ppx region was isolated.
The
BamHI-
SalI fragment of about
4 kb was
inserted into a similarly restricted low-copy-number
vector, pFZY1,
resulting in plasmid
pVCK37.
Construction of the V. cholerae ppk knockout
mutant.
To make the deletion-insertion mutation allele of
ppk, a 1.2-kb EcoRV (site 1)-EcoRI
(site 1) region of pVCK1 (Fig. 1A) was replaced with a 1.3-kb
HincII-EcoRI fragment containing the kanamycin cassette from pVCK4, which was constructed by insertion of a 1.3-kb HincII-HincII fragment with the cassette from
pUC4K (Amersham Pharmacia Biotech, Inc., Piscataway, N.J.) into the
EcoRV site of pBluescript II KS(+). From the resulting
plasmid, pVCK7, the 2.1-kb XbaI-SalI
ppk::Kan fragment was transferred into the suicide vector pKNG101, and the resulting plasmid was designated pVCK13 (Fig.
1A).
pVCK13-integrated transformants (single-crossover recombinants) of the
V. cholerae wild-type strain 92A1552-Rif
r which
exhibited both kanamycin and streptomycin resistance phenotypes
were
obtained. After two successive overnight cultivations of
the integrants
in Luria broth (LB) supplemented with 5% sucrose,
the
ppk
knockout mutants (double-crossover recombinants) were
obtained as
kanamycin-resistant but streptomycin-sensitive colonies.
The
chromosomal mutations were confirmed by Southern blot analysis,
and one
of the resultant recombinants, KVC3, was selected as the
ppk
knockout mutant of
V. cholerae.
Biochemical assays.
Cell extracts from V. cholerae were prepared as from E. coli (16),
modified only by a 2-min sonication after lysozyme treatment. PPK and
PPX activities were assayed as described previously (1, 17).
Poly P levels were determined by the nonradioactive method (4). The cloned DNA fragment was sequenced by the PAN Facility.
Electron microscopy.
Strains were cultivated as described in
the legend to Fig. 3D. Cells were harvested at zero time and 2 h
after the addition of Pi and were washed three times with
0.9% sodium chloride (zero time) or phosphate-buffered saline (2 h)
solution. For negative staining, the samples were placed on a
carbon-coated grid and stained with 1% uranyl acetate. Thin-section
samples were prepared by N. Ghori, Department of Microbiology and
Immunology, Stanford University.
Surface attachment assay.
Cells (2 µl) cultured overnight
in LB were inoculated into 100 µl of LB in 96-well polyvinyl chloride
plates (Falcon 3911 Microtester III flexible assay plate; Becton
Dickinson, Oxnard, Calif.) and incubated at 30°C without shaking for
24 h. After the medium was removed, each well was rinsed with
sterile water, 100 µl of 1% crystal violet solution was added, and
the plate was incubated for 15 min at room temperature. The wells were
thoroughly washed with water and air dried. The adherent crystal violet
was extracted with 200 µl of 95% ethanol, diluted in 95% ethanol, and measured at 595 nm in a microplate spectrophotometer (model 550;
Bio-Rad Laboratories, Hercules, Calif.).
Pi uptake assay.
Cells were grown in a MOPS
medium with 0.1 mM Pi overnight, collected, washed with a
Pi-free MOPS medium, and resuspended in 50 ml of the
Pi-free medium to an optical density at 600 nm (OD600) of 0.1. The cultures were shaken for 2 h at
37°C and were readjusted to an OD600 of 0.1 by dilution
with the Pi-free MOPS medium.
K2HPO4 (0.1 mM) with
[32PO4]Pi (1 µCi/ml)
was added to the shaking cultures, and samples (0.1 ml) were taken at
intervals and immediately filtered through an HA filter (3.5-mm
diameter; Millipore). The cells trapped on the filter were washed with
10 ml of Pi-free MOPS medium without glucose, amino acids,
or vitamins. The radioactivity on the membrane filter was measured in a
liquid scintillation counter; the values of Pi uptake in
the cells are indicated as counts per minute per milliliter per
OD600 unit.
Purification of V. cholerae PPK.
E. coli
strain CF5802 transformed with pVCK31 was used as the starting material
(4.2 × 108 U in 610 mg of protein). The purification
was performed essentially as described previously (2),
modified only by the addition of a phenyl Sepharose column (Amersham
Pharmacia Biotech, Inc.) as the final step (yielding 4.6 × 106 U in 0.12 mg of protein).
Nucleotide sequence accession number.
The GenBank accession
number for the sequence reported here is AF083928.
 |
RESULTS |
Poly P accumulation.
When E. coli was grown in rich
medium (LB) under normal conditions (37°C with aeration), poly P
levels did not exceed 1 nmol (in Pi residues) per mg of
total cell protein at any stage (21). The highest levels of
transient poly P accumulation, about 25 nmol/mg of protein, occur when
E. coli cells are exposed to specific stresses
(4). However, V. cholerae strain
92A1552-Rifr, even when grown in LB, accumulated poly P to
levels of more than 50 nmol/mg (Fig. 2A)
during logarithmic growth, while in stationary-phase cells the levels
were low (~1 nmol/mg). In MOPS minimal salts medium, V. cholerae accumulates more than 20 nmol of poly P/mg in stationary
phase, far exceeding the <1-nmol/mg levels for E. coli
(21). Thus, V. cholerae accumulates significantly higher levels of poly P than E. coli at all stages: during
growth in rich media and during stationary phase in minimal media.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 2.
Poly P accumulations in V. cholerae. (A)
Following overnight culture in LB, the wild-type strain
92A1552-Rifr was subcultured into fresh LB at a 1:100
dilution and grown at 37°C with aeration. (B and C) Following
overnight culture in MOPS medium with 0.1 mM Pi, the
wild-type strain was subcultured in MOPS medium with 0.1 (squares), 0.5 (circles), or 2 (triangles) mM Pi. Solid symbols, growth
(A540); open symbols, poly P. (D) Following
overnight culture in MOPS with 0.1 mM Pi, the wild-type
(squares) and KVC3 (ppk mutant [circles]) strains were
harvested and washed with MOPS buffer. The cells were transferred to
Pi-free MOPS and cultivated for 1 h at 37°C with
aeration. Potassium phosphate buffer (pH 7.4) was then added to a final
concentration of 20 mM Pi at zero hour. Solid symbols,
growth (A600); open symbols, poly P.
|
|
To determine whether the high level of poly P accumulation in
V. cholerae relative to that in
E. coli is due to a higher
level
of PPK, we measured PPK activity in
V. cholerae and
found that
the membrane fraction activity (Table
1) was quite similar to
that of
E. coli MG1655. PPK activity levels were virtually the
same in
logarithmic- and stationary-phase cells (data not shown).
Thus, poly P
accumulation levels do not reflect the levels of
PPK activity, which is
also true in
E. coli (
21). In contrast
to
E. coli, no detectable activity of PPX was observed in
V. cholerae (Table
1). Since a measurable level of PPX
activity was detected
in an
E. coli
ppk
ppx strain
bearing a plasmid with the
V. cholerae ppk ppx operon (see
below),
V. cholerae PPX should be expressed.
The
undetectable level of native PPX activity may explain in part
why
V. cholerae accumulates large amounts of poly P. The rapid
degradation of poly P shown in Fig.
1A, in the absence of significant
PPX activity, may be due to the reverse reaction of PPK
(
27),
in which poly P is converted to ATP. A
Klebsiella aerogenes ppx mutant strain demonstrated profiles
for poly P accumulation and
degradation similar to those of the
parental wild-type strain
(A. Kuroda, personal communication).
Poly P overplus.
The influence of Pi concentration
on poly P accumulation was determined in cells grown in a defined
medium (MOPS) (Fig. 2B and C). Poly P levels were below the detection
limit (<0.5 nmol/mg) when cultivated with 0.1 mM Pi
overnight (Fig. 2C, 0 h). However, >100 nmol/mg accumulated after
4 h in log phase with 0.1, 0.5, or 2 mM Pi. Cultures
with 0.5 or 2 mM Pi maintained poly P levels of >100
nmol/mg for up to 9 h, i.e., after entering stationary phase.
However, poly P levels in the 0.1 mM Pi culture decreased gradually along with the decrease in growth rate (Fig. 2B and C, 5 to
9 h). Given the similarity in the growth curves for the 0.5 and 2 mM Pi cultures, the slow growth of the 0.1 mM
Pi culture is likely due to Pi depletion. Thus,
poly P levels in V. cholerae depend on the Pi
concentration in the medium.
When cells were shifted from a MOPS medium with no P
i added
to the same medium with 20 mM P
i, dramatic accumulations of
poly
P occurred immediately after the upshift (Fig.
2D). Within 1 h,
poly P accumulated to >300 nmol/mg and to near 400 nmol/mg after
2 h without any concomitant growth. With the resumption of growth,
the poly P level decreased to 250 nmol/mg and remained there for
at
least five more hours. Similarly, large poly P accumulations
have been
reported in
Aerobacter aerogenes as the "poly P
overplus"
phenomenon (
9).
These massive levels of poly P were observed by electron microscopy as
numerous bodies of relatively high electron density
(Fig.
3). About 1 in 30 cells contained bodies
20 to 40 nm in
diameter (Fig.
3B), while the others had smaller bodies,
about
5 nm in diameter (Fig.
3A). Such granules were not found in
wild-type
cells grown in P
i-free medium or in
ppk mutant cells (see below)
grown in P
i-rich
medium for 2 h (Fig.
3C and D). Inasmuch as these
bodies were
correlated with the dmassive accumulations of poly
P, they are presumed
to be poly P. Similar granules observed in
Myxococcus
xanthus (
9) and
Helicobacter pylori are
somewhat
localized at the flagellar pole and in association with the
inner
membrane as well as being dispersed in the cytoplasm
(
5). As
determined by thin-section electron microscopy (Fig.
3E), the
granules in
V. cholerae are distributed in the
cytoplasm but not
localized along the inner membrane.

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 3.
Electron micrographs of V. cholerae strains.
The bacteria were harvested at 0 and 2 h after the addition of
Pi, as for Fig. 2D. Bars, 0.5 µm. Negatively stained
samples were prepared from the wild-type culture after 0 (C) and 2 (A
and B) h of incubation and from KCV3 (the ppk mutant) after
2 h of incubation (D). Thin-section samples were prepared from the
wild type (E) and KVC3 (F) after 2 h of incubation.
Magnifications, ×28,000 (A, C, E, and F), ×35,000 (D), and ×45,000
(B).
|
|
The ppk gene.
The region in the TIGR V. cholerae genome database surrounding a sequence homologous to that
of E. coli ppk was cloned from a V. cholerae genome library by colony hybridization using a PCR fragment of the region as a probe (see Materials and Methods). The
E. coli
ppk
ppx knockout strain CF5802, transformed
with pVCK35 containing the V. cholerae ppk homolog (Fig.
1A), exhibited high levels of PPK activity (38,000 U/mg), demonstrating
that this region did in fact contain the V. cholerae ppk
gene; this was confirmed subsequently by sequencing. The deduced amino
acid sequence of V. cholerae PPK is 701 amino acid residues
long, with a calculated molecular mass of 81.6 kDa; it is 64%
identical and 83% similar (in conserved residues) to that of E. coli. Sequencing also revealed a ppx homolog downstream
of ppk in V. cholerae, as in E. coli,
although with a two-cistron overlap. A transformant of the E. coli
ppk
ppx mutant strain CF5802 harboring pVCK31, which
contains both the ppk and ppx homologs (Fig. 1A),
gave low but significant levels of PPX activity (540 U/mg). Its deduced amino acid sequence is 500 amino acid residues in length, with a
calculated molecular mass of 56.4 kDa, and is 51% identical and 70%
similar (in conserved residues) to E. coli PPX.
Upstream of the
ppk open reading frame (ORF) (Fig.
1B) lies
a putative promoter region which contains a probable
pho box
sequence
with 15 of the 18 consensus base pairs at positions

84 to

67
from the A in the
ppk start codon (Fig.
1B). In
E. coli,
pho boxes
are the binding sites of the
two-component system regulator protein
PhoB. Homologs of
phoB and
phoR (the cognate sensor) are found
in
the
V. cholerae genome database, suggesting that
transcription
of the
ppk ppx operon may be regulated by this
system. Putative
pho boxes are also present in the
ppk promoter regions of
E. coli,
K. aerogenes (
12), and
Acinetobacter sp. strain
ADP1 (
8).
A pair of 17-bp inverted-repeat sequences (from
positions 24 to
40 and 43 to 59 from the
ppx stop codon)
appear to constitute
a rho-independent transcriptional terminator site
downstream of
the
ppx ORF (Fig.
1D). These features imply
that
ppk and
ppx form
an operon, as in
E. coli and other gram-negative bacteria. The
E. coli
ppk
ppx transformant with a high copy number of the
V. cholerae ppk ppx operon [CF5802(pVCK31)] expressed
690,000
U of PPK and 540 U of PPX activity per mg. We have shown
previously
that the
E. coli wild type transformed with a
high copy number
of the
E. coli ppk ppx operon exhibited
630,000 U of PPK and 50,000
U of PPX activity per mg (
2,
3).
Thus,
V. cholerae PPK was
expressed in an
E. coli
host cell at levels similar to those of
E. coli PPK from the
E. coli operon, but
V. cholerae PPX was expressed
about 100-fold less than
E. coli PPX. Unlike in
E. coli, there
is a 20-bp overlap between the
ppk and
ppx ORFs in the
V. cholerae operon (Fig.
1C),
which may interfere with translation of the
ppx ORF from the
ppk-ppx mRNA, accounting for the undetectable
level of PPX
activity (Table
1).
Null mutant of ppk.
In a ppk knockout mutant
in V. cholerae (KVC3) (see Materials and Methods), the
levels of PPK activity and poly P accumulation were undetectable (Table
1 and Fig. 2D), in contrast to the parental strain,
92A1552-Rifr, which accumulated more than 300 nmol of poly
P per mg when shifted from a Pi-free to a 20 mM
Pi defined medium. We tested KVC3 for the reported
phenotypes of the E. coli ppk mutant strain CA10 (5,
18, 20). No phenotypes were observed for long-term survival in
synthetic medium (for 30 days at 30°C), sensitivity to heat (at 45 and 55°C) and hydrogen peroxide (in 10, 3, and 1 mM), adaptive growth
following a shift from rich medium to minimal medium, or long-term (10 days at 30°C) survival in artificial seawater (29).
With regard to adaptive growth in a nutrient downshift (Fig.
4), the
E. coli wild-type
strain MG1655 transformed with the
plasmid vector (pFZY1) grew in a
minimal medium after a 2-h lag
following downshift from a rich medium
(LB) whereas the
E. coli
ppk
ppx mutant CF5802
harboring pFZY1 was unable to grow even
22 h after the downshift.
However, CF5802 bearing the
V. cholerae ppk plasmid pVCK37
grew in minimal medium after the downshift
with only a 4-h lag, after
which the growth rate and final OD
were similar to that of the wild
type. Thus, the
V. cholerae ppk complements the
E. coli
ppk mutation in response to this stress
condition.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 4.
V. cholerae ppk complements the adaptive
growth defect in an E. coli ppk mutant. E. coli
strains MG1655(pFYZ1) (squares), CF5802(pFYZ1) (open circles), and
CF5802(pVCK37) (solid circles) were grown in 2×YT medium supplemented
with 50 µg of ampicillin/ml to an A600 of 0.5. The cells were harvested and washed twice with MOPS medium devoid of
nutrients and resuspended in MOPS medium with 2 mM Pi and
0.4% glucose at zero hour.
|
|
A
P. aeruginosa PAO1
ppk mutant shows no defects
in adaptive responses but is severely impaired in motility and surface
attachment
(
22,
23,
24), and the
V. cholerae ppk
mutant was found to
be deficient in these features as well
(
23). The swim area of
the
ppk mutant was 57%
that of the wild type on 0.3% agar plates
(Table
2). The
ppk mutant also
exhibited a significantly lower
ability for surface attachment (Table
2). Deficiencies in motility
and surface attachment have also been
observed in
ppk mutants
of
E. coli,
K. pneumoniae, and
Salmonella spp.
(
22).
In view of the capacity of poly P to function as a chelator of divalent
metals (
9), the calcium sensitivity of the
V. cholerae ppk mutant was tested (Fig.
5). The
growth lag time of the wild-type
strain (92A1552-Rif
r) in
LB containing 200 mM CaCl
2 was 5 h, more than 4 h
longer
than in the absence of CaCl
2 (Fig.
2A). The lag time
of the
ppk mutant KVC3 was significantly longer, at 7 h. When complemented
with the high-copy-number plasmid pVCK31 harboring
the
ppk gene,
the lag time was shortened to 3 h. As
both the wild type and the
ppk mutant of
V. cholerae had the same lag time when grown in
LB in the presence of
400 mM NaCl (data not shown), these results
imply that the
ppk gene is involved in an adaptation to excess
levels of
calcium but not chloride or osmolality.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Growth adaptation to an excess amount of calcium.
V. cholerae strains 92A1552-Rifr(pBluescript II)
(squares), KVC3(pBluescript II) (open circles), and KVC3(pVCK31) (solid
circles) were grown in LB medium supplemented with 10 mM
KH2PO4 and 50 µg of ampicillin/ml overnight.
The cells were inoculated in LB supplemented with 200 mM
CaCl2 and shaken at 37°C.
|
|
Another phenotype of the
ppk mutant was observed with regard
to P
i uptake (Fig.
6). After
growth in a P
i-free medium for 2
h, wild-type cells
displayed a linear (nonsaturable) P
i uptake
for up to 25 min when incubated in 0.1 mM P
i (the P
i-limited
condition)
(Fig.
2B and C). The
ppk mutant had unique
saturable profiles
for P
i uptake. It showed a rate of
uptake similar to that of the
wild type from 0 to 3 min, but the uptake
after 5 min was minimal
and the rate was decreased significantly. These
data suggest that
ppk is required for the continual
high-rate uptake of P
i under
low-P
i conditions.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 6.
Pi uptake of V. cholerae.
Pi uptake activities of 92A1552-Rifr (squares)
and KVC3 (circles) were tested as described in Materials and Methods.
|
|
Characterization of PPK.
PPK was purified from a transformant
of the E. coli CF5802 strain (
ppk
ppx::Kan) bearing the V. cholerae ppk ppx
operon on a high-copy-number vector, pVCK31. Homogeneity of the
purified protein was verified as a single band on a Coomassie-stained
sodium dodecyl sulfate-polyacrylamide gel (data not shown) with a
molecular mass estimated at 87 kDa, compared to the calculated mass of
81.6 kDa. Comparison of the PPK retention time to those of reference proteins in a high-performance liquid chromatography gel filtration column showed a molecular mass of 310 kDa (data not shown), indicating that V. cholerae PPK is a homotetramer like E. coli PPK (1). The final fraction has a specific
activity of 40 × 106 U/mg, slightly higher than that
of E. coli PPK (29 × 106 U/mg)
(1).
The optimal reaction conditions for
V. cholerae PPK are
almost the same as those for
E. coli PPK, e.g., a pH optimum
of 7.2
in HEPES buffer and 4 mM Mg
2+, and 40 mM ammonium
sulfate increases activity twofold. Autophosphorylated
PPK was observed
in a reaction with [

-
32P]ATP. Like the
E. coli enzyme (
16), the
V. cholerae enzyme
can
catalyze the synthesis of ATP from ADP and poly P and can
catalyze the
synthesis of GTP and ppppG (linear guanosine 5'-tetraphosphate)
from
GDP and poly P. Significant differences in the kinetic parameters
for
the PPKs of
V. cholerae and
E. coli are shown by
the 40-fold
decrease in the
V. cholerae Km value
for ATP for the forward (poly
P synthesis) reaction (Table
3). The
kcat/
Km ratio for the ATP
synthesis reaction of
V. cholerae PPK is more than 10 times
higher
than that for
E. coli. On the other hand, the
kcat/
Kms ratios
for the
GTP and ppppG synthesis reactions of
V. cholerae PPK are
5 and 20 times lower, respectively, than those for
E. coli.
These
data suggest that the
V. cholerae PPK is more specific
for the
generation of ATP than GTP or ppppG.
 |
DISCUSSION |
Accumulations of poly P in V. cholerae are remarkable
for being so great and sustained compared to those in E. coli. The levels in excess of 50 nmol/mg of protein during
exponential growth in a rich medium (Fig. 2A) and 150 nmol/mg in
stationary phase in a defined medium (Fig. 2C) are roughly 100 times
those in E. coli. Yet the PPK activities in extracts are
nearly the same (Table 1). Some of the reason may lie in the
undetectable levels of PPX activity in extracts of V. cholerae (Table 1). In that organism, as in E. coli
(3), an operon contains the ppk as well as the ppx gene (Fig. 1). Unlike in E. coli, where the
ppx gene is separated by 7 bp from the upstream
ppk gene, the amino terminus-encoding region of
ppx in V. cholerae overlaps the carboxy
terminus-encoding region of ppk by 20 bp (Fig. 1C). The
E. coli transformant with the V. cholerae ppx
gene on a high-copy-number plasmid did express PPX activity. How these
genes and possibly others are regulated pre- and posttranscriptionally
remains to be determined.
When cells are switched from a Pi starvation medium to one
with adequate Pi, there is a massive accumulation of poly P
(Fig. 2D), as observed in A. aerogenes (9) and
designated the poly P overplus phenomenon. The accumulation of poly P
is evident as electron-dense granules up to 40 nm in diameter with an
ordered matrix structure as in crystal complexes (Fig. 3B). The
granules appear to be largely cytoplasmic (Fig. 3E), unlike some of the granules in H. pylori, which have polar and
membrane-oriented locations (5). The dynamic accumulation
and removal of poly P and its mobilization at a molecular level, as
well as the nature of the granules and their cellular locations, need
to be clarified.
V. cholerae PPK resembles that of E. coli in size
and in its multiple activities: processive poly P synthesis from ATP,
nucleoside diphosphate kinase action on ADP and GDP by donor poly P,
pyrophosphoral transfer to GDP to form ppppG, and autophosphorylation
by ATP. The most notable differences are in the kinetic parameters
(Table 3), e.g., a Km for ATP of 0.2 mM for
V. cholerae PPK compared to 2.0 mM for E. coli
PPK. Also, kinetic parameters for ATP, GTP, and ppppG synthesis
reactions indicate that V. cholerae PPK is more specific for
the generation of ATP than for GTP or ppppG compared to E. coli PPK. These enzyme characteristics are similar to those of
H. pylori PPK purified as a recombinant protein
(27; C.-M. Tzeng and A. Kornberg, unpublished data).
The strong PPK sequence homologies of 20 or more bacterial species
include a number of the major pathogens (26), V. cholerae among them. In view of the striking dependence of
E. coli on PPK for a variety of adaptive responses in the
stationary phase and the expression of virulence factors in the
stationary phases of some pathogens (7), the phenotypes of
null mutants of ppk in these pathogens have been sought.
Furthermore, there is the attractive possibility that PPK might prove a
novel target for an antimicrobial drug with a broad spectrum and
minimal side effects, inasmuch as PPK has not been found in animal species.
Among the pathogenic features of the PPK null mutants, a decrease in
motility (commonly associated with a loss of virulence [19]) and weakened attachment to abiotic surfaces (a
frequent correlate of poor biofilm formation) have been observed in
several pathogens. Particularly striking are mutants of P. aeruginosa (22, 23, 24) which are defective in quorum
sensing and have also lost their virulence in mouse models. The
V. cholerae ppk mutant also had diminished attachment to an
abiotic surface (Table 2), with the activity decreased by 68% compared
to that of the wild type. Although this was not a dramatic reduction as
with P. aeruginosa (22, 24), it could be
emphasized by using the rugose colony variant of V. cholerae
O1 (30), which prefers to form biofilm, compared to the
smooth colony variant which was used in this study.
The failure to adapt to stress and the lack of survival in stationary
phase observed in the E. coli ppk mutant (6) have not been apparent in the V. cholerae mutant. In addition to
decreased motility and decreased attachment to abiotic surfaces (Table
2), other defects have been observed. One is a delayed adaptation to
high calcium levels in the medium (Fig. 5); complementation of the
mutant with the ppk gene more than corrects for the extended lag in growth. It is plausible that a large amount of poly P can trap
excess calcium in the cell and maintain the calcium level at a low
enough level to permit growth. Another defect of the ppk
mutant is an abnormal rate of uptake of Pi from the medium (Fig. 6). Whereas the initial rate resembled that of the wild type, the
subsequent rate was considerably reduced. Not enough is known about
Pi uptake in V. cholerae to identify which
system might be affected by the lack of PPK function. Interestingly, budding-yeast mutants deficient in poly P accumulation also showed a
similar saturable curve for Pi uptake (18a).
The phenotypic tests of the V. cholerae ppk mutant were
patterned on those performed on bacterial species which differ sharply from V. cholerae in their physiologic features, commensal
interactions, and host invasiveness (10). In view of the
unique aspects of the aquatic ecology of V. cholerae, much
needs to be studied to evaluate what effect the lack of PPK and poly P
might have on its survival and pathogenesis.
 |
ACKNOWLEDGMENTS |
We thank F. H. Yildiz and G. Schoolnik in the Department of
Microbiology and Immunology for providing strains, plasmids, the gene
library, and technical advice, N. Ghori in the same department for
electron microscopy, S. Handy in the Department of Chemistry for
high-performance liquid chromatography analyses, N. Rao in our
laboratory for performing surface attachment assays, and L. Bertsch for
help with the manuscript.
This work was supported by a grant from the National Institute of
General Medical Sciences.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biochemistry, Beckman Center, Stanford University School of Medicine, Stanford, CA 94305-5307. Phone: (650) 723-6167. Fax: (650) 723-6783. E-mail: akornber{at}cmgm.stanford.edu.
Present address: Institute of BioAgricultural Science, Academia
Sinica, Nankang, Taiwan.
 |
REFERENCES |
| 1.
|
Ahn, K., and A. Kornberg.
1990.
Polyphosphate kinase from Escherichia coli. Purification and demonstration of a phosphoenzyme intermediate.
J. Biol. Chem.
265:11734-11739[Abstract/Free Full Text].
|
| 2.
|
Akiyama, M.,
E. Crooke, and A. Kornberg.
1992.
The polyphosphate kinase gene of Escherichia coli. Isolation and sequence of the ppk gene and membrane location of the protein.
J. Biol. Chem.
267:22556-22561[Abstract/Free Full Text].
|
| 3.
|
Akiyama, M.,
E. Crooke, and A. Kornberg.
1993.
An exopolyphosphatase of Escherichia coli. The enzyme and its ppx gene in a polyphosphate operon.
J. Biol. Chem.
268:633-639[Abstract/Free Full Text].
|
| 4.
|
Ault-Riché, D.,
C. D. Fraley,
C.-M. Tzeng, and A. Kornberg.
1998.
Novel assay reveals multiple pathways regulating stress-induced accumulation of inorganic polyphosphate in Escherichia coli.
J. Bacteriol.
180:1841-1847[Abstract/Free Full Text].
|
| 5.
|
Bode, G.,
F. Mauch,
H. Ditschuneit, and P. Malfertheiner.
1993.
Identification of structures containing polyphosphate in Helicobacter pylori.
J. Gen. Microbiol.
139:3029-3033[Abstract/Free Full Text].
|
| 6.
|
Crooke, E.,
M. Akiyama,
N. N. Rao, and A. Kornberg.
1994.
Genetically altered levels of inorganic polyphosphate in Escherichia coli.
J. Biol. Chem.
269:6290-6295[Abstract/Free Full Text].
|
| 7.
|
Fang, F. C.,
S. J. Libby,
N. A. Buchmeier,
P. C. Loewen,
J. Switala,
J. Harwood, and D. G. Guiney.
1992.
The alternative sigma factor katF (rpoS) regulates Salmonella virulence.
Proc. Natl. Acad. Sci. USA
89:11978-11982[Abstract/Free Full Text].
|
| 8.
|
Geissdörfer, W.,
A. Ratajczak, and W. Hillen.
1998.
Transcription of ppk from Acinetobacter sp. strain ADP1, encoding a putative polyphosphate kinase, is induced by phosphate starvation.
Appl. Environ. Microbiol.
64:896-901[Abstract/Free Full Text].
|
| 9.
|
Harold, F. M.
1966.
Inorganic polyphosphates in biology: structure, metabolism, and function.
Bacteriol. Rev.
30:772-794[Free Full Text].
|
| 10.
|
Islam, M. S.,
B. S. Drasar, and R. B. Sack.
1994.
The aquatic flora and fauna as reservoirs of Vibrio cholerae: a review.
J. Diarrhoeal Dis. Res.
12:87-96[Medline].
|
| 11.
|
Kaniga, K.,
I. Delor, and G. R. Cornelis.
1991.
A wide-host-range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica.
Gene
109:137-141[CrossRef][Medline].
|
| 12.
|
Kato, J.,
T. Yamamoto,
K. Yamada, and H. Ohtake.
1993.
Cloning, sequence and characterization of the polyphosphate kinase-encoding gene (ppk) of Klebsiella aerogenes.
Gene
137:237-242[CrossRef][Medline].
|
| 13.
|
Koop, A. H.,
M. E. Hartley, and S. Bourgeois.
1987.
A low-copy-number vector utilizing beta-galactosidase for the analysis of gene control elements.
Gene
52:245-256[CrossRef][Medline].
|
| 14.
|
Kornberg, A.
1999.
Inorganic polyphosphate: a molecule of many functions.
Prog. Mol. Subcell. Biol.
23:1-18[Medline].
|
| 15.
|
Kulaev, I. S. (ed.).
1979.
The biochemistry of inorganic polyphosphates.
John Wiley & Sons, Inc., New York, N.Y.
|
| 16.
|
Kuroda, A., and A. Kornberg.
1997.
Polyphosphate kinase as a nucleoside diphosphate kinase in Escherichia coli and Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
94:439-442[Abstract/Free Full Text].
|
| 17.
|
Kuroda, A.,
H. Murphy,
M. Cashel, and A. Kornberg.
1997.
Guanosine tetra- and pentaphosphate promote accumulation of inorganic polyphosphate in Escherichia coli.
J. Biol. Chem.
272:21240-21243[Abstract/Free Full Text].
|
| 18.
|
Kuroda, A.,
S. Tanaka,
T. Ikeda,
J. Kato,
N. Takiguchi, and H. Ohtake.
1999.
Inorganic polyphosphate kinase is required to stimulate protein degradation and for adaptation to amino acid starvation in Escherichia coli.
Proc. Natl. Acad. Sci. USA
96:14264-14269[Abstract/Free Full Text].
|
| 18a.
| Ogawa, N., J. DeRisi, and P. O. Brown. New
components of a system for phosphate acquisition and polyphosphate
metabolism of Saccharomyces cerevisiae revealed by genomic
expression analysis. Mol. Biol. Cell, in press.
|
| 19.
|
Ottemann, K. M., and J. F. Miller.
1997.
Roles for motility in bacterial-host interactions.
Mol. Microbiol.
24:1109-1117[CrossRef][Medline].
|
| 20.
|
Rao, N. N., and A. Kornberg.
1996.
Inorganic polyphosphate supports resistance and survival of stationary-phase Escherichia coli.
J. Bacteriol.
178:1394-1400[Abstract/Free Full Text].
|
| 21.
|
Rao, N. N.,
S. Liu, and A. Kornberg.
1998.
Inorganic polyphosphate in Escherichia coli: the phosphate regulon and the stringent response.
J. Bacteriol.
180:2186-2193[Abstract/Free Full Text].
|
| 22.
|
Rashid, M. H., and A. Kornberg.
2000.
Inorganic polyphosphate is needed for swimming, swarming and twitching motilities of Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
97:4885-4890[Abstract/Free Full Text].
|
| 23.
|
Rashid, M. H.,
N. N. Rao, and A. Kornberg.
2000.
Inorganic polyphosphate is required for motility of bacterial pathogens.
J. Bacteriol.
182:225-227[Abstract/Free Full Text].
|
| 24.
|
Rashid, M. H.,
K. Rumbaugh,
L. Passador,
D. G. Davies,
A. N. Hamood,
B. H. Iglewski, and A. Kornberg.
2000.
Polyphosphate kinase is essential for biofilm development, quorum sensing, and virulence of Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. USA
97:9636-9641[Abstract/Free Full Text].
|
| 25.
|
Shiba, T.,
K. Tsutsumi,
H. Yano,
Y. Ihara,
A. Kameda,
K. Tanaka,
H. Takahashi,
M. Munekata,
N. N. Rao, and A. Kornberg.
1997.
Inorganic polyphosphate and the induction of rpoS expression.
Proc. Natl. Acad. Sci. USA
94:11210-11215[Abstract/Free Full Text].
|
| 26.
|
Tzeng, C.-M., and A. Kornberg.
1998.
Polyphosphate kinase is highly conserved in many bacterial pathogens.
Mol. Microbiol.
29:381-382[CrossRef][Medline].
|
| 27.
|
Tzeng, C.-M., and A. Kornberg.
2000.
The multiple activities of polyphosphate kinase of Escherichia coli and their subunit structure determined by radiation target analysis.
J. Biol. Chem.
275:3977-3983[Abstract/Free Full Text].
|
| 28.
|
Wood, H. G., and J. E. Clark.
1988.
Biological aspects of inorganic polyphosphates.
Annu. Rev. Biochem.
57:235-260[CrossRef][Medline].
|
| 29.
|
Yildiz, F. H., and G. K. Schoolnik.
1998.
Role of rpoS in stress survival and virulence of Vibrio cholerae.
J. Bacteriol.
180:773-784[Abstract/Free Full Text].
|
| 30.
|
Yildiz, F. H., and G. K. Schoolnik.
1999.
Vibrio cholerae O1 El Tor: identification of a gene cluster required for the rugose colony type, exopolysaccharide production, chlorine, and biofilm formation.
Proc. Natl. Acad. Sci. USA
96:4028-4033[Abstract/Free Full Text].
|
Journal of Bacteriology, December 2000, p. 6687-6693, Vol. 182, No. 23
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gangaiah, D., Kassem, I. I., Liu, Z., Rajashekara, G.
(2009). Importance of Polyphosphate Kinase 1 for Campylobacter jejuni Viable-but-Nonculturable Cell Formation, Natural Transformation, and Antimicrobial Resistance. Appl. Environ. Microbiol.
75: 7838-7849
[Abstract]
[Full Text]
-
Silby, M. W., Nicoll, J. S., Levy, S. B.
(2009). Requirement of Polyphosphate by Pseudomonas fluorescens Pf0-1 for Competitive Fitness and Heat Tolerance in Laboratory Media and Sterile Soil. Appl. Environ. Microbiol.
75: 3872-3881
[Abstract]
[Full Text]
-
Seufferheld, M. J., Alvarez, H. M., Farias, M. E.
(2008). Role of Polyphosphates in Microbial Adaptation to Extreme Environments. Appl. Environ. Microbiol.
74: 5867-5874
[Full Text]
-
Candon, H. L., Allan, B. J., Fraley, C. D., Gaynor, E. C.
(2007). Polyphosphate Kinase 1 Is a Pathogenesis Determinant in Campylobacter jejuni. J. Bacteriol.
189: 8099-8108
[Abstract]
[Full Text]
-
Lindner, S. N., Vidaurre, D., Willbold, S., Schoberth, S. M., Wendisch, V. F.
(2007). NCgl2620 Encodes a Class II Polyphosphate Kinase in Corynebacterium glutamicum. Appl. Environ. Microbiol.
73: 5026-5033
[Abstract]
[Full Text]
-
Jahid, I. K., Silva, A. J., Benitez, J. A.
(2006). Polyphosphate Stores Enhance the Ability of Vibrio cholerae To Overcome Environmental Stresses in a Low-Phosphate Environment. Appl. Environ. Microbiol.
72: 7043-7049
[Abstract]
[Full Text]
-
Remonsellez, F., Orell, A., Jerez, C. A.
(2006). Copper tolerance of the thermoacidophilic archaeon Sulfolobus metallicus: possible role of polyphosphate metabolism. Microbiology
152: 59-66
[Abstract]
[Full Text]
-
Tan, S., Fraley, C. D., Zhang, M., Dailidiene, D., Kornberg, A., Berg, D. E.
(2005). Diverse Phenotypes Resulting from Polyphosphate Kinase Gene (ppk1) Inactivation in Different Strains of Helicobacter pylori. J. Bacteriol.
187: 7687-7695
[Abstract]
[Full Text]
-
Shi, X., Rao, N. N., Kornberg, A.
(2004). Inorganic polyphosphate in Bacillus cereus: Motility, biofilm formation, and sporulation. Proc. Natl. Acad. Sci. USA
101: 17061-17065
[Abstract]
[Full Text]
-
Pinson, B., Merle, M., Franconi, J.-M., Daignan-Fornier, B.
(2004). Low Affinity Orthophosphate Carriers Regulate PHO Gene Expression Independently of Internal Orthophosphate Concentration in Saccharomyces cerevisiae. J. Biol. Chem.
279: 35273-35280
[Abstract]
[Full Text]
-
Itoh, H., Shiba, T.
(2004). Polyphosphate Synthetic Activity of Polyphosphate:AMP Phosphotransferase in Acinetobacter johnsonii 210A. J. Bacteriol.
186: 5178-5181
[Abstract]
[Full Text]
-
Cole, S. P., Harwood, J., Lee, R., She, R., Guiney, D. G.
(2004). Characterization of Monospecies Biofilm Formation by Helicobacter pylori. J. Bacteriol.
186: 3124-3132
[Abstract]
[Full Text]
-
Chavez, F. P., Lunsdorf, H., Jerez, C. A.
(2004). Growth of Polychlorinated-Biphenyl-Degrading Bacteria in the Presence of Biphenyl and Chlorobiphenyls Generates Oxidative Stress and Massive Accumulation of Inorganic Polyphosphate. Appl. Environ. Microbiol.
70: 3064-3072
[Abstract]
[Full Text]
-
Zhang, H., Ishige, K., Kornberg, A.
(2002). A polyphosphate kinase (PPK2) widely conserved in bacteria. Proc. Natl. Acad. Sci. USA
99: 16678-16683
[Abstract]
[Full Text]
-
Ishige, K., Zhang, H., Kornberg, A.
(2002). Polyphosphate kinase (PPK2), a potent, polyphosphate-driven generator of GTP. Proc. Natl. Acad. Sci. USA
99: 16684-16688
[Abstract]
[Full Text]
-
Kim, K.-S., Rao, N. N., Fraley, C. D., Kornberg, A.
(2002). Inorganic polyphosphate is essential for long-term survival and virulence factors in Shigella and Salmonella spp.. Proc. Natl. Acad. Sci. USA
99: 7675-7680
[Abstract]
[Full Text]