Previous Article | Next Article 
Journal of Bacteriology, December 2000, p. 6950-6957, Vol. 182, No. 24
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
The 4-Oxalomesaconate Hydratase Gene, Involved in the
Protocatechuate 4,5-Cleavage Pathway, Is Essential to Vanillate and
Syringate Degradation in Sphingomonas paucimobilis
SYK-6
Hirofumi
Hara,1
Eiji
Masai,1,*
Yoshihiro
Katayama,2 and
Masao
Fukuda1
Department of Bioengineering, Nagaoka
University of Technology, Nagaoka, Niigata
940-2188,1 and Graduate School of
Bio-Applications and Systems Engineering, Tokyo University of
Agriculture and Technology, Fuchu, Tokyo
183-8509,2 Japan
Received 26 June 2000/Accepted 21 September 2000
 |
ABSTRACT |
Sphingomonas paucimobilis SYK-6 is able to grow on
various dimeric lignin compounds, which are converted to vanillate and syringate by the actions of unique lignin degradation enzymes in this
strain. Vanillate and syringate are degraded by the
O-demethylase and converted into protocatechuate (PCA) and
3-O-methylgallate (3MGA), respectively. PCA is further
degraded via the PCA 4,5-cleavage pathway, while the results suggested
that 3MGA is degraded through another pathway in which PCA
4,5-dioxygenase is not involved. In a 10.5-kb EcoRI
fragment carrying the genes for PCA 4,5-dioxygenase (ligAB), 2-pyrone-4,6-dicarboxylate hydrolase
(ligI), and a portion of
4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase
(ligC), we found the ligJ gene encoding
4-oxalomesaconate (OMA) hydratase, which catalyzes the conversion of
OMA into 4-carboxy-4-hydroxy-2-oxoadipate. The ligJ gene is
transcribed in the same direction as ligABC genes and
consists of an 1,023-bp open reading frame encoding a polypeptide with
a molecular mass of 38,008 Da, which is located 73-bp upstream from
ligA. The ligJ gene product (LigJ), expressed
in Escherichia coli, was purified to near homogeneity and
was estimated to be a homodimer (69.5 kDa) by gel filtration
chromatography. The isoelectric point was determined to be 4.9, and the
optimal temperature is 30°C. The Km for OMA
and the Vmax were determined to be 138 µM and
440 U/mg, respectively. LigJ activity was inhibited by the addition of
thiol reagents, suggesting that some cysteine residue is part of the
catalytic site. The ligJ gene disruption in SYK-6 caused
the growth defect on and the accumulation of common metabolites from
both vanillate and syringate, indicating that the ligJ gene is essential to the degradation of these two compounds. These results
indicated that syringate is converted into OMA via 3MGA, and it enters
the PCA 4,5-cleavage pathway.
 |
INTRODUCTION |
Lignin is the most abundant aromatic
compound on the earth, and its mineralization is a fundamental step in
the terrestrial carbon cycle. It is expected that lignin can be used as
biomass by converting it to valuable materials. Bacterial enzyme
systems for lignin degradation and modification are of great use for
this purpose. Sphingomonas paucimobilis SYK-6 is able to
grow on various dimeric lignin compounds, including
-aryl ether,
biphenyl, and diarylpropane, as sole carbon and energy sources
(18). We have characterized the enzymes and genes involved
in
-aryl ether cleavage (16, 17) and biphenyl degradation
(23, 24), which include essential and late limiting steps of
lignin degradation, respectively. These unique specific lignin
degradation enzymes in SYK-6 would be suitable tools for conversion of
lignin to useful intermediate metabolites.
Vanillate and syringate are important intermediate metabolites from
lignin, having guaiacyl and syringyl moieties, respectively. In SYK-6,
vanillate and syringate are converted to protocatechuate (PCA) and
3-O-methylgallate (3MGA), respectively, by the
O-demethylase encoded by ligH (21).
PCA is a key intermediate metabolite among various aromatic degradation
pathways. Three kinds of dioxygenases are involved in the aromatic ring
cleavage of PCA: PCA 3,4-dioxygenase (5, 6, 37), PCA
4,5-dioxygenase (22, 31), and PCA 2,3-dioxygenase
(35). In the case of SYK-6, PCA is metabolized through the
PCA 4,5-cleavage pathway (Fig. 1), which was enzymatically characterized in 1980s by Kersten et al. (8) and
Maruyama and colleagues (11-15). PCA is initially transformed to
4-carboxy-2-hydroxymuconate-6-semialdehyde (CHMS) by PCA
4,5-dioxygenase (LigAB). CHMS is nonenzymatically converted to an
intramolecular hemiacetal form and then oxidized by CHMS dehydrogenase
(11, 15). The resulting intermediate, 2-pyrone-4,6-dicarboxylate (PDC), is hydrolyzed by PDC hydrolase to
yield the keto form and enol form (4-carboxy-2-hydroxymuconate) of
4-oxalomesaconate (OMA), which are in equilibrium (8, 12, 19). OMA is converted to 4-carboxy-4-hydroxy-2-oxoadipate (CHA) by OMA hydratase (13). Finally, CHA is cleaved by CHA
aldolase to produce pyruvate and oxaloacetate (14, 32). We
previously characterized the PCA 4,5-dioxygenase gene
(ligAB) (22, 31) and PDC hydrolase gene
(ligI) (19); recently, the CHMS dehydrogenase gene (ligC) was also characterized (E. Masai, K. Momose, H. Hara, S. Nishikawa, Y. Katayama, and M. Fukuda, submitted for
publication). However, the PCA 4,5-cleavage pathway has not been
genetically characterized in detail.
On the other hand, the pathway for 3MGA degradation is ambiguous. PCA
4,5-dioxygenase was reported to catalyze the ring cleavage of 3MGA to
form PDC, and metabolism of 3MGA through the PCA 4,5-cleavage pathway
was suggested (8). However, two mutant strains of SYK-6, in
which the ligAB and ligI genes were insertionally
inactivated could grow on syringate but not on vanillate (19; H. Aoshima, E. Masai, S. Nishikawa, Y. Katayama, and M. Fukuda, Abstr. 8th Int. Symp. Microb. Ecol., abstr. 93, 1998). These results indicated that 3MGA generated from syringate is predominantly metabolized via a
pathway other than the PCA 4,5-cleavage pathway.
In this study, we characterized the OMA hydratase gene and the
enzymatic properties of the gene product to obtain detailed genetic
information on the PCA 4,5-cleavage pathway and insight into the
metabolism of syringate in SYK-6. We also present evidence that the OMA
hydratase gene is essential to the metabolism of both vanillate and
syringate and that OMA is the common intermediate metabolite of
vanillate and syringate.
 |
MATERIALS AND METHODS |
Strains and plasmids.
The strains and plasmids used in this
study are listed in Table 1. S. paucimobilis SYK-6 was grown at 30°C in W minimal salt medium
(23) containing 0.2% (wt/vol) vanillate or syringate or in
Luria-Bertani (LB) medium (Bacto Tryptone, 10 g/liter; yeast extract, 5 g/liter; NaCl, 5 g/liter).
Preparation of substrate.
PDC was prepared from PCA by using
cells of Pseudomonas putida PpY1100 harboring pVAD4, which
conferred transformation activity from PCA to PDC as described earlier
(19). To obtain OMA, 1 mmol of PDC was hydrolyzed by 0.057 N
NaOH at room temperature for 3 h and then neutralized with 0.5 N
HCl by the method of Maruyama (12). In a previous study, we
identified the trimethylsilyl (TMS) derivatives of two isomeric enol
forms of OMA (19). In this study, the OMA preparation was
derivatized with methoxyamine hydrochloride to identify the keto form
of OMA because
-keto acids are difficult to analyze by gas
chromatography-mass spectrometry (GC-MS). Methoxyamine hydrochloride
(final concentration, 10 mg/ml) was added to 200 µM OMA solution. The
resultant solution was alkalinized (pH 11 to 12) and kept at 60°C for
1 h (34). This solution was acidified by 2 N HCl, and
the derivatized OMA was extracted with ethyl acetate. The extract was
dried in vacuo and trimethylsilylated. The gas chromatogram of the
sample showed two peaks with retention times of 29.5 min (compound I)
and 30.2 min (compound II). The mass spectrum of compound I
corresponded to that of the enol form OMA (19). On the other
hand, the mass spectrum of compound II showed the major fragments at
m/z 447, 432, 416, and 330, which seemed to correspond to
the molecular ions of methoxime-TMS derivatives of the keto form OMA
(M), M-CH3, M-OCH3, and M-COOTMS, respectively. Thus, the OMA preparation contains the two isomeric enol forms and the
keto form as shown in Fig. 1.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
The proposed degradation pathway of vanillate and
syringate via the PCA 4,5-cleavage pathway in S. paucimobilis SYK-6. LigA and LigB, the small and large subunits of
PCA 4,5-dioxygenase (4,5-PCD) (22); LigH, a gene product
essential for vanillate and syringate O-demethylations (21);
LigC, CHMS dehydrogenase (Masai et al., submitted); LigI, PDC hydrolase
(19); LigJ, OMA hydratase (this study). The PCA 4,5-cleavage
pathway is illustrated according to findings from previous studies
(11-15, 19, 22). The degradation pathway for syringate
indicated by a dashed line was suggested on the basis of the results
obtained in this and a previous (4) study.
|
|
Vanillate, syringate, and other chemicals were purchased from Tokyo
Kasei Kogyo Co. (Tokyo, Japan) or Wako Pure Chemical Industries
(Osaka,
Japan).
DNA manipulations and nucleotide sequencing.
DNA
manipulations were carried out essentially as described elsewhere
(1, 25). A Kilosequence kit (Takara Shuzo Co., Ltd., Kyoto,
Japan) was used to construct a series of deletion derivatives, whose
nucleotide sequences were determined by the dideoxy termination method
with an ALFexpress DNA sequencer (Pharmacia Biotech, Milwaukee, Wis.).
A Sanger reaction (
26) was carried out by using a
Thermosequenase fluorescent labeled primer cycle sequencing kit with
7-deaza-dGTP
(Amersham Pharmacia Biotech, Little Chalfont, United
Kingdom).
Sequence analysis and homology alignment were carried out
with
the GeneWorks programs (IntelliGenetics, Inc., Mountain View,
Calif.). The DDBJ database was used for searching homologous proteins.
Southern hybridization analysis of SYK-6 and its OMA hydratase
gene
(
ligJ) insertion mutants were performed with the DIG system
(Boehringer Mannheim Biochemicals, Indianapolis, Ind.) according
to the
procedure recommended by the
manufacturer.
Subcloning of ligJ gene.
To overexpress the
ligJ gene, the ligJ coding region in pHN139F was
amplified by PCR using the Ex Taq polymerase (Takara Shuzo), pHN139F as a template, and primers ligJF and ligJR. Primers ligJF (forward; GAGACGATCACGAGAGGTAACC) and ligJR (reverse;
GAAATCACGGGAAACAAAGC) were designed from the pHN139F
ligJ coding sequence.
The 1.1-kb PCR product was inserted into pT7-blue(R) (
3).
Then the
EcoRI-
HindIII fragment of the
resulting plasmid was
ligated to pET21(+) to generate
pETJ.
Enzyme assay.
Using the method of Maruyama (13),
OMA hydratase activity was spectrophotometrically determined by
measuring the decrease in the absorbance at 265 nm
(
265 = 2.6 × 103 M
1
cm
1; pH 8.0) with a DU-7500 spectrophotometer (Beckman,
Fullerton, Calif.). The enzyme reaction was carried out at 30°C in a
cuvette. The 1-ml reaction mixture contained 200 µM OMA and the
enzyme in 0.1 M Tris-acetate buffer (pH 8.0). The OMA preparation
contained the keto form and enol form (4-carboxy-2-hydroxymuconate),
which are in equilibrium. One unit of enzyme activity was defined as the amount that degrades 1 µmol of substrate per min at 30°C. Specific activity was expressed as units per milligram of protein. Km and Vmax values were
obtained from Hanes-Woolf plots and expressed as means from at least
three independent experiments.
Enzyme purification.
Enzyme purification was performed
according to the method described below by using a BioCAD700E apparatus
(PerSeptive Biosystems, Framingham, Mass.).
(i) Preparation of cell extract. Cells were grown in 100 ml
of 2×YT medium (Bacto Tryptone, 20 g/liter; yeast extract,
10 g/liter;
NaCl, 5 g/liter) containing 100 mg of ampicillin/liter.
Expression of
ligJ was induced for 12 h at 30°C by the addition
of
isopropyl-

-
D-thiogalactopyranoside (final concentration,
1
mM). Cells were harvested by centrifugation and resuspended in
20 mM
Tris-HCl buffer (pH 8.0) (buffer A). The cells were broken
by two
passages through a French pressure cell. The cell lysate
was
centrifuged at 15,000 ×
g for 15 min. Streptomycin
(final
concentration, 1%) was added to the supernatant, which was
recentrifuged
at 15,000 ×
g for 15 min to remove
nucleic acids. The supernatant
was recovered and then centrifuged again
at 170,000 ×
g for 60
min at 4°C. The crude extract
was obtained after concentration
by ultrafiltration using a Minicon B15
(Amicon, Beverly, Mass.).
(ii) POROS PI anion-exchange chromatography.
The crude
extract was applied to a POROS PI (polyethyleneimine) column (7.5 by
100 mm; PerSeptive Biosystems) previously equilibrated with buffer A. The enzyme was eluted with 88 ml of linear gradient of 0 to 0.5 M NaCl.
The OMA hydratase was eluted at approximately 0.34 M.
(iii) POROS HQ anion-exchange chromatography.
The fractions
containing OMA hydratase activity eluted from a PI column were pooled,
desalted, and concentrated by ultrafiltration using a Minicon B15. The
resulting solution was applied to a POROS HQ (quaternized PI) column
(4.6 by 100 mm; PerSeptive Biosystems) previously equilibrated with
buffer A. The enzyme was eluted with 33 ml of a linear gradient of 0 to
0.5 M NaCl. The fractions containing OMA hydratase activity that eluted
at approximately 0.28 M were pooled.
(iv) POROS PE hydrophobic interaction chromatography.
The
fractions containing OMA hydratase activity eluted from a HQ column
were pooled, desalted, and concentrated. Ammonium sulfate was added to
the enzyme solution to a final concentration of 2 M. After
centrifugation at 15,000 × g for 10 min, the
supernatant was recovered and applied to a POROS PE column (4.6 by 100 mm; PerSeptive Biosystems) equilibrated with buffer B (buffer A
containing 2 M ammonium sulfate). The enzyme was eluted with 25 ml of a
linear gradient of 2.0 to 0 M ammonium sulfate. The fractions
containing OMA hydratase activity that eluted at approximately 1.1 M
were pooled, desalted, and concentrated as described above. Glycerol was added to a final concentration of 10%, and the purified enzyme was
stored at
80°C until use.
Analytical method.
The protein concentration was determined
by the method of Bradford (2). The purity of the enzyme
preparation was examined by sodium dodecyl sulfate-12% polyacrylamide
gel electrophoresis (SDS-PAGE) (10). The molecular mass of
the native enzyme was determined by Superdex 200 HR10/30 (Pharmacia
Biotech) gel filtration column chromatography using a BioCAD700E
apparatus. Elution was performed with 50 mM potassium phosphate buffer
(pH 7.0) containing 0.15 M NaCl at a flow rate of 0.8 ml/min. The
molecular weight was estimated on the basis of calibration curve of
reference proteins.
To determine the N-terminal amino acid sequence, a cell extract of
Escherichia coli BL21(DE3) harboring pETJ was subjected
to
SDS-PAGE and electroblotted onto a polyvinylidene difluoride
membrane
(Bio-Rad, Hercules, Calif.). The area at 35 kDa was cut
out and
analyzed on a PPSQ-21 protein sequencer (Shimadzu, Kyoto,
Japan). The
isoelectric point of LigJ was determined by isoelectric
point focusing
on an Ampholine PAG plate (pH 3.5 to 9.5; Pharmacia
Biotech) using a
model Multiphor II electrophoresis system (Pharmacia
Biotech).
The substrate and the reaction products were detected and identified by
GC-MS using model 5971A with an Ultra-2 capillary
column (50 m by 0.2 mm; Hewlett-Packard Co., Palo Alto, Calif.)
and electrospray ionization
(ESI)-MS using HP1100 series LC-MSD
(Hewlett-Packard Co.). The
analytical conditions for GC-MS were
the same as described previously
(
19). In ESI-MS analysis, mass
spectra were obtained by
negative-mode ESI, with a needle voltage
of

3.5 kV and a source
temperature at 350°C. The sample was injected
into the flow system;
the water/methanol ratio was 90:10 (vol/vol),
and the flow rate was 0.2 ml/min.
Identification of the reaction product.
OMA was incubated
with purified LigJ (0.5 µg) in 0.1 M Tris-acetate buffer (pH 8.0) for
10 min. The reaction mixture was acidified and extracted with ethyl
acetate, and then the extract was trimethylsilylated. The resultant TMS
derivatives are analyzed by GC-MS as described above.
In the case of ESI-MS analysis, the reaction mixture was diluted to
1/10 with 10 mM Tris-acetate buffer (pH 8.0), and 5 µl
of the mixture
was injected into the flow
system.
Insertional inactivation of the ligJ gene.
The
1.7-kb SmaI-XbaI fragment carrying a portion of
ligJ was cloned into pBluescript II KS(+) to generate
pSXB17. pSXB17 was digested with Eco47III, and the 500-bp
fragment in the middle of ligJ was deleted. The 1.2-kb
PstI fragment containing the kanamycin resistance
(Kmr) gene from pUC4K (33) was inserted into
this Eco47III site. The resultant plasmid, pSXB17K, was
digested with EcoRI and KpnI, and the insert
containing the inactivated ligJ gene was cloned into
pK19mobsacB (27) to generate pLJD.
pLJD was introduced into SYK-6 cells by electroporation as described
previously (
19). Km
r transformants were selected
on an LB agar plate containing 50
mg of kanamycin/liter. They were
cultured for 12 h in LB liquid
medium containing 50 mg of
kanamycin/liter and 10% sucrose. The
candidates for mutants were
isolated on an LB agar plate containing
10% sucrose and kanamycin.
Southern hybridization analyses of
the
SalI digests of total
DNA prepared from the candidates for
mutants were carried out with the
1.2-kb
SalI-
XbaI and 1.2-kb
PstI
fragment probes containing a portion of
ligJ and the
Km
r gene,
respectively.
Nucleotide sequence accession number.
The nucleotide
sequence reported in this paper was deposited in the DDBJ, EMBL, and
GenBank nucleotide sequence databases under accession no. AB035121.
 |
RESULTS |
Nucleotide sequence of the OMA hydratase gene.
We have already
isolated the SYK-6 10.5-kb EcoRI fragment carrying
ligAB (22), ligI (19), and
a part of ligC (18; Masai et al., submitted). We examined
the OMA hydratase activity on this fragment to see whether the OMA
hydratase gene is located in it. The OMA hydratase activity was
observed in E. coli JM109 harboring pHN139F, which contained
this 10.5-kb EcoRI fragment (Fig.
2). In the deletion analysis, the DNA
region that conferred OMA hydratase activity was limited to the 2.7-kb
SalI-XhoI fragment, which spanned the most of the
insert of pSS30F and pSS30R. The ligAB gene was included in
this 2.7-kb fragment as indicated in Fig. 2. Therefore, the OMA
hydratase gene seemed to be located upstream from the ligA
gene. Based on the difference of the activity between pSS30F and
pSS30R, the direction of transcription of OMA hydratase gene was
suggested to be the same as that of ligAB. The deletion
derivatives of pSS30F were constructed, and the nucleotide sequence of
the region except for the ligAB gene, whose sequence had
been established previously (22), was determined. The only open reading frame (ORF) found was 73 bp upstream from ligA
and designated ligJ. The start codon of ligJ
could not be deduced because the 5' end of the ligJ sequence
has three consecutive ATG codons. The ligJ gene spans bp
1017 to 1023 and has a putative ribosome binding sequence upstream.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
Deletion analysis of the 10.5-kb EcoRI
fragment and lig gene organization. The OMA hydratase
activity of cells containing each subclone is presented on the right.
Arrows indicate the direction of transcription from the lac
promoters. The ligI, ligJ, ligA, ligB, and ligC
genes are indicated by filled arrows; a partly filled arrow represents
the part of the ORF of the lignostilbene , -dioxygenase homolog
(lsdA). Each plasmid was introduced in E. coli
JM109. E, EcoRI; P, PstI;
Sl, SalI; Sm, SmaI;
X, XhoI; Xb, XbaI.
|
|
Expression of ligJ in E. coli.
The
ligJ gene was amplified by PCR and subcloning in pET21(+) to
generate plasmid pETJ as described in Materials and Methods. The
ligJ gene was expressed in E. coli BL21(DE3)
harboring plasmid pETJ with the aid of its T7 promoter. OMA hydratase
activity of the cell extract of E. coli BL21(DE3) harboring
pETJ was 24.3 U/mg, indicating the high level of expression of
ligJ. In SDS-PAGE analysis, the molecular mass of a subunit
of the ligJ product (LigJ) was estimated to be 35 kDa (Fig.
3, lane 3), this 35-kDa protein was
subjected to the N-terminal amino acid sequencing. The sequence of the
first 15 residues was determined to
be Met-Met-Met-Ile-Ile-Asp-Xaa-His-Gly-Xaa-Tyr-Thr-Val-Leu-Pro, which corresponded to the deduced amino acid sequence of
ligJ translated from the first ATG of the three consecutive
ATG codons. Therefore, the ligJ gene was estimated to be an
ORF of 1,023 bp, encoding 341 amino acid residues. The molecular mass
deduced from the amino acid sequence of LigJ
(Mr, 38,008) is close to the value estimated by
SDS-PAGE (35 kDa). A homology search with the deduced amino acid
sequence of ligJ in the SwissProt and DAD databases showed
identity only with LigY (37%), which is a hydrolase for the
meta-cleavage compound
2,2',3-trihydroxy-3'-methoxy-5,5'-dicarboxybiphenyl, (OH-DDVA),
involved in the catabolism of the lignin-related biphenyl by S. paucimobilis SYK-6 (24).

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 3.
SDS-PAGE analysis of protein fractions. Proteins were
separated on an SDS-12% polyacrylamide gel and stained with Coomassie
brilliant blue. Lanes: 1, molecular weight markers; 2, crude extract of
E. coli BL21(DE3) harboring pET21(+) (10 µg of protein);
3, crude extract of E. coli BL21 (DE3) harboring pETJ (10 µg of protein); 4, PI fraction (5 µg of protein); 5, HQ fraction (3 µg of protein); 6, PE fraction (2 µg of protein). Molecular masses
are given on the left.
|
|
Purification of OMA hydratase.
LigJ protein expressed in
E. coli BL21(DE3) harboring pETJ was purified to near
homogeneity (Fig. 3) by a series of column chromatographyies with PI,
HQ, and PE (Table 2 and Fig. 3). LigJ was
purified approximately 13-fold, with a recovery of 20%.
Identification of the reaction product.
To identify the
reaction product of OMA catalyzed by the purified LigJ, the reaction
mixture was analyzed by ESI-MS. Figure 4A
shows the mass spectrum of the substrate. The major fragment at
m/z 201 in Fig. 4A was estimated to be the deprotonated
molecular ion ([M-H]
) of OMA (where M is a molecular
ion of OMA). In the mass spectrum of the reaction mixture shown in Fig.
4B, the fragment at m/z at 201 of OMA decreased to 65% of
its initial intensity, and the new major fragment at m/z 219 corresponding to [M-H]
of CHA (where M is the molecular
ion of CHA) was observed. Thus, the results strongly suggested that OMA
was converted to CHA by incorporation of a water molecule.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
Identification of the reaction product from OMA
catalyzed by LigJ. (A) Negative-ion ESI-MS spectrum of OMA. The peak at
m/z 201 was assigned to the deprotonated molecular ion
[M-H] of OMA. (B) Negative-ion ESI-MS spectrum of the
reaction product generated from OMA catalyzed by purified LigJ. The
peak at m/z 201 derived from OMA reduced, and the generation
of the product peak at m/z 219 was observed.
|
|
Enzyme properties.
Gel filtration column chromatography using
Superdex 200 indicated that the molecular mass of the native LigJ was
69.5 kDa. This result suggested that LigJ is a homodimer. The
isoelectric point of LigJ was determined by isoelectric focusing gel
electrophoresis to be 4.9. The optimal temperature for LigJ hydratase
activity on OMA was determined to be 30°C; the optimal pH was not
determined since OMA was unstable in at high pH. The
Km for OMA and the Vmax were determined to be 138 µM and 440 U/mg, respectively.
The influence of thiols and thiol reagents on LigJ was also examined.
Purified LigJ (0.5 µg) was preincubated with 1 mM cysteine,
reduced
glutathione, and dithiothreitol individually at 30°C for
10 min, and
the remaining activities were determined. OMA hydratase
activity was
activated to 147, 135, and 120% in the presence of
cysteine, reduced
glutathione, and dithiothreitol, respectively.
On the other hand, the
addition of 1 mM HgCl
2 completely inhibited
the activity.
These results suggested that some cysteine residue
in LigJ is involved
in the enzyme
reaction.
Disruption of the ligJ gene in S. paucimobilis SYK-6.
The ligJ gene was disrupted
to investigate its role in the catabolism of vanillate and syringate by
SYK-6. Gene inactivation was carried out using the ligJ
disruption plasmid pLJD, which was constructed by replacing the
internal segment of ligJ inserted in pK19mobsacB
by a Kmr gene. The ligJ insertional mutation was
confirmed by Southern hybridization analysis using the 1.2-kb
SalI-XbaI fragment carrying a portion of
ligJ and the 1.2-kb PstI fragment carrying the
Kmr gene as probes (Fig. 5).
The mutant strain DLJ obtained completely lost the ability to grow on
both vanillate and syringate.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 5.
The ligJ disruption in S. paucimobilis SYK-6. (A) Schematic representation of the
insertional inactivation of ligJ by the Kmr
gene. Thick arrows indicate orientations of transcription of the
ligJ and Kmr genes. (B) Southern hybridization
analysis of the ligJ insertion mutant (DLJ). Lanes 1 and 3, total DNA of SYK-6 digested with SalI; lanes 2 and 4, total
DNA of DLJ digested with SalI. The 1.2-kb
SalI-XbaI fragment carrying a portion of
ligJ (lanes 1 and 2) and the 1.2-kb PstI fragment
of the Kmr gene (lanes 3 and 4) were used as probes.
|
|
Vanillate and syringate (0.2 %) were independently incubated with
whole cells of strain DLJ in W minimal medium. The metabolites
produced
from vanillate and syringate were examined and determined
by GC-MS and
ESI-MS. As shown in the gas chromatogram (Fig.
6),
vanillate and syringate, detected
with retention times of 21.2
and 25.2 min, respectively, disappeared
completely, and accumulation
of the enol form of OMA, PDC, and product
I with a retention time
of 30.5 min was observed in both cultures. The
major fragments
at
m/z 475 and
m/z 373 were
identified in the mass spectrum of
the TMS derivative of the enol form
OMA as reported previously
(Fig.
6D) (
19). These
fragments agree with M-CH
3 and M-COOTMS,
respectively, where M is a molecular ion of TMS-OMA. Similarly,
the
fragments at
m/z 477 and
m/z 375 of product I are
thought
to be M-CH
3, and M-COOTMS, respectively (Fig.
6C).
On the other
hand, ESI-MS analysis indicated the accumulation of the
ions at
m/z 183 and 201 in the metabolites from vanillate
and syringate,
which corresponded to the deprotonated molecular ions of
PDC and
OMA, respectively. In addition to these ions, another ion at
m/z 203 accumulated from both vanillate and syringate. Thus,
this
ion seemed to be the deprotonated molecular ion of product I.
A
ligJ inactivated mutant, DLJ should have accumulated a
significant
amount of OMA. However, the amount of OMA accumulated was
smaller
than expected. In our previous study, we found that the keto
form
of OMA, which is an

-keto acid, could not be detected by GC-MS
in the condition that we used (
19). Thus, product I did not
correspond to the keto form of OMA. Possibly, product I was generated
from OMA by an unknown reaction in SYK-6. To examine this hypothesis,
OMA was incubated with the DLJ cell extract prepared from cells
grown
in LB. The reaction was carried out in 0.1 M Tris-acetate
buffer (pH
8.0) containing 100 µg DLJ cell extract, 1 mM NADPH,
200 µM OMA,
and 1 mM ZnSO
4 at 30°C. Zn
2+ was added to
inhibit the reverse reaction of the PDC hydrolase,
which catalyzes the
conversion of OMA to PDC (
19). The reaction
product after 10 min of incubation was analyzed by ESI-MS and
GC-MS. In the ESI-MS
analysis, the peak at
m/z 201 derived from
OMA was converted
to the peak at
m/z 203 only in the presence
of NADPH (Fig.
7). GC-MS analysis showed the generation
of the
product with the same retention time (30.5 min) as product I.
Although the ion at
m/z 477 observed with product I was not
detected,
the relative intensities of the mass fragments at
m/z 375, 285,
147, and 73 were identical to those of product
I (data not shown).
These results strongly suggested that product I was
produced from
accumulated OMA possibly by the addition of two hydrogen
atoms
catalyzed by an unknown NADPH-dependent reductase in SYK-6 and
that the accumulation of product I represents the accumulation
of OMA.
Thus, the results indicate that
ligJ encodes OMA hydratase,
which is essential for catabolism of both vanillate and syringate.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Identification of accumulated products from
vanillate and syringate by DLJ. (A and B) Gas chromatograms of TMS
derivatives of the accumulated products from vanillate and syringate,
respectively. In both cultures, PDC, the enol form of OMA, and the
unidentified product I were observed. (C and D) Mass spectra of the TMS
derivatives of product I and the enol form of OMA, respectively.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 7.
Conversion of OMA by DLJ cell extract. OMA was converted
to the product of which [M-H] is m/z 203 only in the presence of NADPH.
|
|
 |
DISCUSSION |
The OMA hydratase gene, designated as ligJ, encoding a
protein of 38,008 Da (341 amino acids), was characterized in this
study. LigJ showed no similarity to the functionally related
2-hydroxypent-2,4-dienoate hydratases of catechol (9, 28)
and biphenyl (20) degradation pathways. However, LigJ showed
37% identity only with the OH-DDVA meta-cleavage compound
hydrolase (LigY) involved in the degradation of 5,5'-dehydrodivanillate
(DDVA) by S. paucimobilis SYK-6. LigY showed no similarity
to other aromatic compound hydrolases involved in benzene, toluene,
xylene, and biphenyl degradation and did not contain a lipase box
(Gly-Xaa-Ser-Gly motif), which constitutes an active site in serine
hydrolases. Alignment of the deduced amino acid sequences of
ligJ and ligY is shown in Fig.
8. Similarity is distributed throughout
the whole sequence; striking identity is found in their amino-terminal
sequences, Met-Ile-Ile-Asp-Cys-His-Gly-His. It is interesting that
these two proteins in the successive degradation pathway are highly
similar. LigJ and LigY seem to evolve from the same ancestral origin.
The structural similarity between the LigJ substrate (OMA) and the
organic acid moiety of the LigY substrate might have contributed to the
evolution of these proteins.

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 8.
Alignment of amino acid sequences between LigJ and LigY
of S. paucimobilis SYK-6. A BLAST search indicated that the
most similar protein whose function has been clarified is the OH-DDVA
meta-cleavage compound hydrolase (LigY) of S. paucimobilis SYK-6 (24). Identical and similar amino
acids are indicated by asterisks and colons, respectively.
|
|
Only the OMA hydratase of P. ochraceae had been
characterized. The OMA hydratases of both S. paucimobilis
SYK-6 and P. ochraceae are dimeric proteins, and their
subunit molecular masses and pIs are very similar. Various thiols and
thiol reagents affected the activities of both enzymes. However, their
kinetic parameters are considerably different. The
Km and Vmax values of
SYK-6 OMA hydratase are approximately 10 and 3.7 times higher than
those of the P. ochraceae enzyme, respectively, indicating
that the P. ochraceae enzyme has significantly higher
affinity toward OMA than SYK-6 enzyme.
The production of CHA from OMA catalyzed by OMA hydratase was suggested
by Maruyama (13). Kersten et al. suggested that OMA is in equilibrium among the two isomeric enol forms and keto form.
Both enol forms of OMA (4-carboxy-2-hydroxymuconate) were easily
detected as TMS derivatives by GC-MS; however, the keto form of OMA
could be detected only when it was modified to the methoxime form as
described in Materials and Methods. In the case of CHA, it could not be
detected by GC-MS even in its methoxime form. Therefore, we used ESI-MS
to detect these compounds and demonstrate the production of CHA from
OMA by LigJ. It is difficult to specify which form of OMA is the real
substrate; however, considering the chemical structure of the LigJ
reaction product, CHA, the keto form is the most likely candidate.
The ligJ gene of SYK-6 was inactivated by gene replacement
to clarify the catabolic role of the ligJ gene. In a
previous study, each disruption of ligB, ligC,
and ligI did not affect syringate metabolism, while these
mutants could not grow on vanillate (19; Aoshima et al., Abstr. 8th
Int. Symp. Microb. Ecol., 1998; Masai et al., submitted). On the other
hand, the ligJ insertion mutant DLJ could not grow on
vanillate and syringate. Thus, it appears that the syringate catabolic
pathway adjoined the PCA 4,5-cleavage pathway at the LigJ reaction
step. DLJ accumulated the enol form of OMA, PDC, and the unknown
product I from vanillate and syringate (Fig. 6). Accumulation of PDC
seemed to be a result of the reverse reaction of PDC hydrolase, which
converts OMA to PDC (19). Product I was suggested to be
generated from OMA probably by addition of two atoms of hydrogen by
NADPH-dependent reductase in DLJ cells. Product I is estimated to be
4-hydroxybut-1-ene-1,2,4-tricarboxylate. Taken together, the results
suggest that the ligJ gene is essential for both vanillate
and syringate degradation and that the syringate degradation pathway
joins to the PCA 4,5-cleavage pathway at OMA.
Donnelly and Dagley reported that P. putida TMC degrades
3MGA to oxaloacetate and pyruvate via OMA, with the release of methanol (4). They proposed the involvement of a 3MGA dioxygenase and an esterase in the transformation of 3MGA to OMA. Characterization of a
putative 3MGA dioxygenase and an esterase is necessary for a better
understanding of syringate catabolism in S. paucimobilis SYK-6.
 |
ACKNOWLEDGMENTS |
H.H. was financially supported by research fellowship 2068 from
the Japan Society for the Promotion of Science for Young Scientists. This work was supported in part by Grant-in-Aid for Encouragement of
Young Scientists 11760057 from the Ministry of Education, Science, Sports and Culture, Japan.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bioengineering, Nagaoka University of Technology, Kamitomioka, Nagaoka, Niigata 940-2188, Japan. Phone: 81-258-47-9428. Fax: 81-258-47-9450. E-mail: emasai{at}vos.nagaokaut.ac.jp.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1990.
Current protocols in molecular biology.
John Wiley & Sons, Inc., New York, N.Y.
|
| 2.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 3.
|
Brownstein, M. J.,
J. D. Carpten, and J. R. Smith.
1996.
Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping.
BioTechniques
20:1004-1010[Medline].
|
| 4.
|
Donnelly, M. I., and S. Dagley.
1981.
Bacterial degradation of 3,4,5-trimethoxycinnamic acid with production of methanol.
J. Bacteriol.
147:471-476[Abstract/Free Full Text].
|
| 5.
|
Frazee, R. W.,
D. M. Livingston,
D. C. LaPorte, and J. D. Lipscomb.
1993.
Cloning, sequencing, and expression of the Pseudomonas putida protocatechuate 3,4-dioxygenase genes.
J. Bacteriol.
175:6194-6202[Abstract/Free Full Text].
|
| 6.
|
Hartnett, C.,
E. L. Neidle,
K. L. Ngai, and L. N. Ornston.
1990.
DNA sequences of genes encoding Acinetobacter calcoaceticus protocatechuate 3,4-dioxygenase: evidence indicating shuffling of genes and of DNA sequences within genes during their evolutionary divergence.
J. Bacteriol.
172:956-966[Abstract/Free Full Text].
|
| 7.
|
Katayama, Y.,
S. Nishikawa,
M. Nakamura,
K. Yano,
M. Yamasaki,
N. Morohoshi, and T. Haraguchi.
1987.
Cloning and expression of Pseudomonas paucimobilis SYK-6 genes involved in the degradation of vanillate and protocatechuate in P. putida.
Mokuzai Gakkaishi
33:77-79.
|
| 8.
|
Kersten, P. J.,
S. Dagley,
J. W. Whittaker,
D. M. Arciero, and J. D. Lipscomb.
1982.
2-Pyrone-4,6-dicarboxylic acid, a catabolite of gallic acids in Pseudomonas species.
J. Bacteriol.
152:1154-1162[Abstract/Free Full Text].
|
| 9.
|
Kukor, J. J., and R. H. Olsen.
1991.
Genetic organization and regulation of a meta cleavage pathway for catechols produced from catabolism of toluene, benzene, phenol, and cresols by Pseudomonas pickettii PKO1.
J. Bacteriol.
173:4587-4594[Abstract/Free Full Text].
|
| 10.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[CrossRef][Medline].
|
| 11.
|
Maruyama, K.
1979.
Isolation and identification of the reaction product of -hydroxy- -carboxymuconic- -semialdehyde dehydrogenase.
J. Biochem.
86:1671-1677[Abstract/Free Full Text].
|
| 12.
|
Maruyama, K.
1983.
Purification and properties of 2-pyrone-4,6-dicarboxylate hydrolase.
J. Biochem.
93:557-565[Abstract/Free Full Text].
|
| 13.
|
Maruyama, K.
1985.
Purification and properties of -oxalomesaconate hydratase from Pseudomonas ochraceae grown with phthalate.
Biochem. Biophys. Res. Commun.
128:271-277[CrossRef][Medline].
|
| 14.
|
Maruyama, K.
1990.
Purification and properties of 4-hydroxy-4-methyl-2-oxo-glutarate aldolase from Pseudomonas ochraceae grown on phthalate.
J. Biochem.
108:327-333[Abstract/Free Full Text].
|
| 15.
|
Maruyama, K.,
N. Ariga,
M. Tsuda, and K. Deguchi.
1978.
Purification and properties of -hydroxy- -carboxymuconic- -semialdehyde dehydrogenase.
J. Biochem.
83:1125-1134[Abstract/Free Full Text].
|
| 16.
|
Masai, E.,
Y. Katayama,
S. Kawai,
S. Nishikawa,
M. Yamasaki, and N. Morohoshi.
1991.
Cloning and sequencing of the gene for Pseudomonas paucimobilis enzyme that cleaves -aryl ether.
J. Bacteriol.
173:7950-7955[Abstract/Free Full Text].
|
| 17.
|
Masai, E.,
Y. Katayama,
S. Kubota,
S. Kawai,
M. Yamasaki, and N. Morohoshi.
1993.
A bacterial enzyme degrading the model lignin compound -etherase is a member of the glutathione-S-transferase superfamily.
FEBS Lett.
323:135-140[CrossRef][Medline].
|
| 18.
|
Masai, E.,
Y. Katayama,
S. Nishikawa, and M. Fukuda.
1999.
Characterization of Sphingomonas paucimobilis SYK-6 genes involved in degradation of lignin-related compounds.
J. Ind. Microbiol. Biotech.
23:364-373[CrossRef][Medline].
|
| 19.
|
Masai, E.,
S. Shinohara,
H. Hara,
S. Nishikawa,
Y. Katayama, and M. Fukada.
1999.
Genetic and biochemical characterization of 2-pyrone-4,6-dicarboxylic acid hydrolase involved in the protocatechuate 4,5-cleavage pathway of Sphingomonas paucimobilis SYK-6.
J. Bacteriol.
181:55-62[Abstract/Free Full Text].
|
| 20.
|
Masai, E.,
S. Sugiyama,
N. Iwashita,
S. Shimizu,
J. E. Hauschild,
T. Hatta,
K. Kimbara,
K. Yano, and M. Fukuda.
1997.
The bphDEF meta-cleavage pathway genes involved in biphenyl/polychlorinated biphenyl degradation are located on a linear plasmid and separated from the initial bphACB genes in Rhodococcus sp. strain RHA1.
Gene
187:141-149[CrossRef][Medline].
|
| 21.
|
Nishikawa, S.,
T. Sonoki,
T. Kasahara,
T. Obi,
S. Kubota,
S. Kawai,
N. Morohoshi, and Y. Katayama.
1998.
Cloning and sequencing of Sphingomonas (Pseudomonas) paucimobilis gene essential for the O demethylation of vanillate and syringate.
Appl. Environ. Microbiol.
64:836-842[Abstract/Free Full Text].
|
| 22.
|
Noda, Y.,
S. Nishikawa,
K. Shiozuka,
H. Kadokura,
H. Nakajima,
K. Yoda,
Y. Katayama,
N. Morohoshi,
T. Haraguchi, and M. Yamasaki.
1990.
Molecular cloning of the protocatechuate 4,5-dioxygenase gene of Pseudomonas paucimobilis.
J. Bacteriol.
172:2704-2709[Abstract/Free Full Text].
|
| 23.
|
Peng, X.,
T. Egashira,
K. Hanashiro,
E. Masai,
S. Nishikawa,
Y. Katayama,
K. Kimbara, and M. Fukuda.
1998.
Cloning of a Sphingomonas paucimobilis SYK-6 gene encoding a novel oxygenase that cleaves lignin-related biphenyl and characterization of the enzyme.
Appl. Environ. Microbiol.
64:2520-2527[Abstract/Free Full Text].
|
| 24.
|
Peng, X.,
E. Masai,
Y. Katayama, and M. Fukuda.
1999.
Characterization of the meta-cleavage compound hydrolase gene involved in degradation of lignin-related biphenyl structure by Sphingomonas paucimobilis SYK-6.
Appl. Environ. Microbiol.
65:2789-2793[Abstract/Free Full Text].
|
| 25.
|
Sambook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 26.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 27.
|
Schäfer, A.,
A. Tauch,
W. Jäger,
J. Kalinowski,
G. Thierbach, and A. Pühler.
1994.
Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.
Gene
145:69-73[CrossRef][Medline].
|
| 28.
|
Shingler, V.,
J. Powlowski, and U. Marklund.
1992.
Nucleotide sequence and functional analysis of the complete phenol/3,4-dimethylphenol catabolic pathway of Pseudomonas sp. strain CF600.
J. Bacteriol.
174:711-724[Abstract/Free Full Text].
|
| 29.
|
Short, J. M.,
J. M. Fernandez,
J. A. Sorge, and W. Huse.
1988.
ZAP: a bacteriophage expression vector with in vivo excision properties.
Nucleic Acids Res.
16:7583-7600[Abstract/Free Full Text].
|
| 30.
|
Studier, F. W., and B. A. Moffatt.
1986.
Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes.
J. Mol. Biol.
189:113-130[CrossRef][Medline].
|
| 31.
|
Sugimoto, K.,
T. Senda,
H. Aoshima,
E. Masai,
M. Fukuda, and Y. Mitsui.
1999.
Crystal structure of an aromatic-ring-opening dioxygenase LigAB which is a protocatechuate 4,5-dioxygenase.
Struct. Fold. Des.
15:953-965.
|
| 32.
|
Tack, B. F.,
P. J. Chapman, and S. Dagley.
1972.
Purification and properties of 4-hydroxy-4-methyl-2-oxoglutarate aldolase.
J. Biol. Chem.
247:6444-6449[Abstract/Free Full Text].
|
| 33.
|
Vieira, J., and J. Messing.
1982.
The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primer.
Gene
19:259-268[CrossRef][Medline].
|
| 34.
|
Williams, V. P.,
D. K. Ching, and S. D. Cederbaum.
1979.
Adsorption of organic acids from amniotic fluid and urine onto silica gel before analysis by gas chromatography and combined gas chromatography/mass spectrometry.
Clin. Chem.
25:1814-1820[Abstract/Free Full Text].
|
| 35.
|
Wolgel, S. A.,
J. E. Dege,
P. E. Perkins-Olson,
C. H. Jaurez-Garcia,
R. L. Crawford,
E. Münck, and J. D. Lipscomb.
1993.
Purification and characterization of protocatechuate 2,3-dioxygenase from Bacillus macerans: a new extradiol catecholic dioxygenase.
J. Bacteriol.
175:4414-4426[Abstract/Free Full Text].
|
| 36.
|
Yanisch-Perron, C.,
J. Vieira, and J. Messing.
1985.
Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13 mp 18 and pUC19 vectors.
Gene
33:103-119[CrossRef][Medline].
|
| 37.
|
Zylstra, G. J.,
R. H. Olsen, and D. P. Ballou.
1989.
Genetic organization and sequence of the Pseudomonas cepacia genes for the alpha and beta subunits of protocatechuate 3,4-dioxygenase.
J. Bacteriol.
171:5915-5921[Abstract/Free Full Text].
|
Journal of Bacteriology, December 2000, p. 6950-6957, Vol. 182, No. 24
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kasai, D., Fujinami, T., Abe, T., Mase, K., Katayama, Y., Fukuda, M., Masai, E.
(2009). Uncovering the Protocatechuate 2,3-Cleavage Pathway Genes. J. Bacteriol.
191: 6758-6768
[Abstract]
[Full Text]
-
Sasoh, M., Masai, E., Ishibashi, S., Hara, H., Kamimura, N., Miyauchi, K., Fukuda, M.
(2006). Characterization of the Terephthalate Degradation Genes of Comamonas sp. Strain E6.. Appl. Environ. Microbiol.
72: 1825-1832
[Abstract]
[Full Text]
-
Nogales, J., Canales, A., Jimenez-Barbero, J., Garcia, J. L., Diaz, E.
(2005). Molecular Characterization of the Gallate Dioxygenase from Pseudomonas putida KT2440: THE PROTOTYPE OF A NEW SUBGROUP OF EXTRADIOL DIOXYGENASES. J. Biol. Chem.
280: 35382-35390
[Abstract]
[Full Text]
-
Peng, X., Masai, E., Kasai, D., Miyauchi, K., Katayama, Y., Fukuda, M.
(2005). A Second 5-Carboxyvanillate Decarboxylase Gene, ligW2, Is Important for Lignin-Related Biphenyl Catabolism in Sphingomonas paucimobilis SYK-6. Appl. Environ. Microbiol.
71: 5014-5021
[Abstract]
[Full Text]
-
Kasai, D., Masai, E., Miyauchi, K., Katayama, Y., Fukuda, M.
(2005). Characterization of the Gallate Dioxygenase Gene: Three Distinct Ring Cleavage Dioxygenases Are Involved in Syringate Degradation by Sphingomonas paucimobilis SYK-6. J. Bacteriol.
187: 5067-5074
[Abstract]
[Full Text]
-
Abe, T., Masai, E., Miyauchi, K., Katayama, Y., Fukuda, M.
(2005). A Tetrahydrofolate-Dependent O-Demethylase, LigM, Is Crucial for Catabolism of Vanillate and Syringate in Sphingomonas paucimobilis SYK-6. J. Bacteriol.
187: 2030-2037
[Abstract]
[Full Text]
-
Kasai, D., Masai, E., Miyauchi, K., Katayama, Y., Fukuda, M.
(2004). Characterization of the 3-O-Methylgallate Dioxygenase Gene and Evidence of Multiple 3-O-Methylgallate Catabolic Pathways in Sphingomonas paucimobilis SYK-6. J. Bacteriol.
186: 4951-4959
[Abstract]
[Full Text]
-
Masai, E., Sasaki, M., Minakawa, Y., Abe, T., Sonoki, T., Miyauchi, K., Katayama, Y., Fukuda, M.
(2004). A Novel Tetrahydrofolate-Dependent O-Demethylase Gene Is Essential for Growth of Sphingomonas paucimobilis SYK-6 with Syringate. J. Bacteriol.
186: 2757-2765
[Abstract]
[Full Text]
-
Masai, E., Ichimura, A., Sato, Y., Miyauchi, K., Katayama, Y., Fukuda, M.
(2003). Roles of the Enantioselective Glutathione S-Transferases in Cleavage of {beta}-Aryl Ether. J. Bacteriol.
185: 1768-1775
[Abstract]
[Full Text]
-
Hara, H., Masai, E., Miyauchi, K., Katayama, Y., Fukuda, M.
(2003). Characterization of the 4-Carboxy-4-Hydroxy-2-Oxoadipate Aldolase Gene and Operon Structure of the Protocatechuate 4,5-Cleavage Pathway Genes in Sphingomonas paucimobilis SYK-6. J. Bacteriol.
185: 41-50
[Abstract]
[Full Text]
-
Peng, X., Masai, E., Kitayama, H., Harada, K., Katayama, Y., Fukuda, M.
(2002). Characterization of the 5-Carboxyvanillate Decarboxylase Gene and Its Role in Lignin-Related Biphenyl Catabolism in Sphingomonas paucimobilis SYK-6. Appl. Environ. Microbiol.
68: 4407-4415
[Abstract]
[Full Text]
-
Masai, E., Harada, K., Peng, X., Kitayama, H., Katayama, Y., Fukuda, M.
(2002). Cloning and Characterization of the Ferulic Acid Catabolic Genes of Sphingomonas paucimobilis SYK-6. Appl. Environ. Microbiol.
68: 4416-4424
[Abstract]
[Full Text]
-
Providenti, M. A., Mampel, J., MacSween, S., Cook, A. M., Wyndham, R. C.
(2001). Comamonas testosteroni BR6020 possesses a single genetic locus for extradiol cleavage of protocatechuate. Microbiology
147: 2157-2167
[Abstract]
[Full Text]
-
Eaton, R. W.
(2001). Plasmid-Encoded Phthalate Catabolic Pathway in Arthrobacter keyseri 12B. J. Bacteriol.
183: 3689-3703
[Abstract]
[Full Text]