Previous Article | Next Article 
Journal of Bacteriology, December 2000, p. 6992-6998, Vol. 182, No. 24
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
CTX Prophages in Classical Biotype Vibrio
cholerae: Functional Phage Genes but Dysfunctional Phage
Genomes
Brigid M.
Davis,
Kathryn E.
Moyer,
E. Fidelma
Boyd,
and
Matthew K.
Waldor*
Howard Hughes Medical Institute, Tufts
University School of Medicine, and Division of Geographic Medicine
and Infectious Diseases, New England Medical Center, Boston,
Massachusetts 02111
Received 8 May 2000/Accepted 12 September 2000
 |
ABSTRACT |
CTX
is a filamentous, lysogenic bacteriophage whose genome
encodes cholera toxin, the primary virulence factor produced by Vibrio cholerae. CTX prophages in O1 El Tor and O139
strains of V. cholerae are found within arrays of
genetically related elements integrated at a single locus within the
V. cholerae large chromosome. The prophages of O1 El
Tor and O139 strains generally yield infectious CTX. In contrast, O1
classical strains of V. cholerae do not produce CTX,
although they produce cholera toxin and they contain CTX prophages
integrated at two sites. We have identified the second site of CTX
prophage integration in O1 classical strains and characterized the
classical prophage arrays genetically and functionally. The genes
of classical prophages encode functional forms of all of the
proteins needed for production of CTX. Classical CTX prophages
are present either as solitary prophages or as arrays of two
truncated, fused prophages. RS1, a genetic element that is closely
related to CTX and is often interspersed with CTX prophages in
El Tor strains, was not detected in classical V. cholerae.
Our model for CTX production predicts that the CTX prophage
arrangements in classical strains will not yield extrachromosomal CTX
DNA and thus will not yield virions, and our experimental results
confirm this prediction. Thus, failure of O1 classical strains of
V. cholerae to produce CTX is due to overall
deficiencies in the structures of the arrays of classical
prophages, rather than to mutations affecting individual CTX
prophage genes.
| |
INTRODUCTION |
The severe diarrheal disease cholera
results from colonization of the human small intestine by pathogenic
strains of a gram-negative bacterium, Vibrio cholerae.
Cholera has afflicted human populations in many parts of the world for
more than a millenium (2). Widespread outbreaks have been
common; in the last 200 years alone, seven cholera pandemics have
occurred. Most epidemic strains of V. cholerae have been of
the O1 serogroup, although in the last 8 years O139 serogroup strains
of V. cholerae have also been linked to disease outbreaks
(23). The O1 serogroup of V. cholerae has been
divided into strains of the classical biotype, thought to have been
responsible for the first six cholera pandemics, and the El Tor
biotype, which has caused the ongoing seventh pandemic (2).
These El Tor and classical strains have traditionally been
differentiated in the laboratory with assays of hemolysis,
hemagglutination, phage sensitivity, and polymyxin
sensitivity and with the Voges-Proskauer reaction (23). Genetic typing of strains has also become possible in recent years. However, despite their phenotypic and genotypic differences, the symptoms of infection with strains of the two O1
biotypes are clinically indistinguishable. The clinical manifestations of cholera are almost entirely due to production of cholera toxin, a
potent A-B-type exotoxin that is secreted by pathogenic V. cholerae (10).
The genes that encode cholera toxin, ctxAB, reside within
the genome of a filamentous, lysogenic bacteriophage known as CTX (22). CTX DNA is generally found integrated at
either one (El Tor) or two (classical) loci within the V. cholerae genome (13, 16, 22). In El Tor strains, the
prophage DNA is usually found in tandem arrays that also include a
related genetic element known as RS1 (13, 24). RS1 contains
the genes that enable phage DNA replication and integration
(rstR, rstA, and rstB) plus an additional gene, rstC, whose function is unknown. RS1 does
not contain ctxAB or the other genes of the phage core
region, which are thought to produce proteins needed for virion
assembly and secretion. Most analyses of the structures of CTX
prophage arrays and of CTX have used El Tor strains and virions
derived from them. Consequently, very little is known about the
structure of CTX prophage arrays or the prevalence of RS1 in
strains of the classical biotype. Furthermore, although it is known
that the two classical prophage insertion sites are on different
chromosomes (20), the sequences flanking classical
prophages and their precise locations within chromosomal DNA have
not been determined.
The CTX prophage-RS1 arrays differ widely among pathogenic O1 and
O139 V. cholerae strains. First, there are biotype-specific differences between the phage genomes, in particular between the rstR and flanking sequences from El Tor strains
(rstRET) and the corresponding regions of the
classical prophage (rstRclass)
(11). Second, strains differ by the number of phage genomes and RS1s that they contain and in the relative arrangements of these
elements. Numerous patterns have been detected in O1 El Tor strains as
well as in O139 strains (4, 13, 21). In contrast, the
majority of classical strains have been thought, based on restriction
mapping, to share a single arrangement (13). However, a few
variant arrangements in classical strains have recently been identified
(3) (see below). Thus, there is more heterogeneity among the
prophage arrays of O1 classical strains than was initially recognized.
The CTX prophage first found to yield virions resided within an O1
El Tor strain of V. cholerae. Since CTX is not a
plaque-forming phage, virion formation was detected by the ability of
supernatants from a strain containing a kanamycin resistance
(Knr)-marked prophage to transduce a recipient strain
to Knr. We have subsequently found that O139 strains from
Calcutta, India, which contain two distinct prophages
(CTXET and CTXcalc) also
yield virions and that these virions are produced from both
prophages (6). In contrast, we have never detected
virions derived from the prophages in a prototypical classical
strain of V. cholerae, O395, or a related strain with
Knr-marked prophages, O395NT (14). However,
classical strains (e.g., O395 and 569B) do produce a high titer of
virions following transduction by the Knr-marked El
Tor CTX (CTXET-Kn)
(22). These data suggest that there is a defect within the
classical prophages rather than in chromosomal loci needed for
phage replication and/or secretion.
For this study, we have characterized the virion production capacities
and genetic structures of classical prophage arrays. We have found
that classical strains encode phage proteins capable of mediating both
phage DNA replication and virion assembly and that at least some of
these genes are constitutively expressed by classical lysogens. We have
also found that the genetic element RS1 is not present in classical
strains of V. cholerae. The CTX insertion
sites in classical strains instead contain either a solitary
prophage or a prophage array composed of two truncated, fused
prophages. Neither of these arrangements is predicted to yield
extrachromosomal CTX phage DNA (7). The inability
of classical strains to produce this extrachromosomal replicative form
of the classical prophage DNA, which is thought to be an early
and critical step in production of virions from CTX
prophages (7), probably accounts for the absence of
detectable classical CTX
(CTXclass).
| |
MATERIALS AND METHODS |
Bacterial strains and culture conditions.
Bacterial
strains were cultured in Luria-Bertani medium (LB) at 37°C unless
otherwise noted. The antibiotics kanamycin (50 µg/ml) and ampicillin
(50 µg/ml) were used as required. The classical strains of V. cholerae analyzed in this study are listed in Table 1. Control strains used were the O139
strain AS207, which has one CTX prophage array
(RS1-CTX-CTX-CTX) (6), and the
O1 El Tor strain E7946, which also has just one prophage array
(RS1-CTX-RS1-CTX-RS1) (13).
Plasmids.
pBD600 was generated by digesting
pCTXET-Kn with PstI and religating
two of the three resulting restriction fragments (Fig. 1). The insert for pBD445 was amplified
from the El Tor strain E7946 by using the primers RstRF
(5'CGGCATTATGTTGAGGGGCAGTCGT3') and psh2
(5'AAATGAGACTAGCAACCGC3'). The resulting PCR product was
cloned into the vector pCRII-TOPO (Invitrogen; Carlsbad, Calif.), and the insert was then subcloned on an EcoRI fragment into
the suicide vector pGP704 (15) to generate pBD445. The same
process was used to generate pBD394 from O395 DNA.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Derivatives of pCTXET that do
not encode all of the phage proteins required for virion production are
packaged into infectious virions by a classical strain of V. cholerae, O395. O395 transformed with wild-type
pCTXET-Kn or a plasmid derivative containing
an incomplete or mutant phage genome was used as a source of donor
supernatant in transduction assays. At least one gene required for
production of virions was inactive in or absent from each of the
plasmids (except pCTXET-Kn), yet all of the
plasmids yielded virions when maintained in O395. Phage titer per
milliliter was normalized to the A600 of the
donor culture. Titers are average results based on at least three
experiments. Sequences that no longer yield functional proteins are
marked by diagonal grey lines. (S) and (M) denote SphI and
MluI restriction sites that were filled in and religated to
create frameshift mutations. It is not known whether the
orfU mutation in pMW102 has a polar effect on downstream
phage genes (marked with light stripes). Deletion of the
PstI (P) fragment results in loss or inactivation of three
phage genes. The Knr cassette has been inserted in place of
most of ctxAB, which do not contribute to CTX
production. pGP704 is an Apr suicide vector that cannot
replicate independently in V. cholerae. N.A., not
applicable.
|
|
Transduction assays.
Filter-sterilized supernatants (100 µl) from late-log-phase donor cultures was mixed with the recipient
strain O395 (50 µl), which had been cultured at 30°C to induce
expression of the CTX receptor, TCP. After a 20-min
incubation at room temperature, mixtures were plated on LB agar plates
containing selective antibiotics. Transduced recipients were identified
after growth overnight at 37°C.
PCR.
PCRs for assessing the insertion sites and junction
sequences of classical prophages were performed using standard
conditions. Primers used were RstBF2 (5'GTGGTGTGTTCCTTGTTTGAC3'),
RstRRev (5'CGACCAAGCAAGATAATCGAC3'), TLCF1
(5'TGTCGGAGCTGCTTGGATTAAG3'), Ig1R1
(5'ACGACTGCCCCTCAACATAATG3'), and PyrFF1
(5'GGTGCCTATATCAACTTTCTTGCG3').
Molecular biology techniques.
DNA probes for Southern blots
were labeled with horseradish peroxidase, using the ECL direct nucleic
acid labeling and detection system (Amersham Pharmacia,
Buckinghamshire, England). Blots were hybridized and washed according
to the manufacturer's instructions. Dye-terminator cycle sequencing of
DNA was performed by the Tufts Core Facility. Other techniques were
performed according to standard protocols (1).
Nucleotide sequence accession number.
The sequence of the
junction between adjacent truncated prophages in O395 has been
assigned GenBank accession no. AF262318.
| |
RESULTS AND DISCUSSION |
Classical prophage core genes encode functional proteins.
To determine which component(s) of the classical CTX
prophages is defective, we first tested whether these prophages
could complement a variety of mutations in the core region of the
CTXET-Kn genome (Fig. 1). These mutations do
not interfere with replication of CTXET-Kn
DNA, but they prevent production of new virions in the absence of
supplemental wild-type phage genes (reference 22 and
data not shown). The replicative form (also known as
pCTX) of each mutant genome was introduced into the
classical strain O395, which had previously been shown to maintain
newly introduced phage DNA in plasmid form (22). In the O395
strain background, even a pCTXET-Kn
derivative lacking three of the five core genes needed for virion
assembly (pBD600) readily yielded virions capable of transducing Knr (Fig. 1). Similarly, an ampicillin-resistant
(Apr) derivative of pCTX, pBD445, which
includes the phage genes rstR, rstA, and
rstB but has no intact phage core genes, could also be
packaged into virions by O395, although at a much lower frequency. Transduced DNA corresponded to the mutant genomes, not to wild-type genomes generated by recombination between the pCTX
derivatives and chromosomal prophage DNA (data not shown). These
data suggest that the core genes of the classical prophages encode
functional proteins; thus, the defect of these prophages does not
appear to lie within their core regions. In addition, these data
suggest that all the CTX core genes are at least minimally
expressed from the classical prophages, even though
CTXclass is not produced.
We have not investigated the biological significance of this apparent
maintainance of phage protein synthesis in the absence
of
CTX
class production. However, others have
proposed that two phage-encoded
proteins, Ace and Zot, function as
exotoxins in addition to contributing
to virion formation (
5,
19). It is not yet known how the
intracellular fates and
functions (i.e., phage related versus
toxin related) of individual
molecules of Ace and Zot are determined.
Consequently, it is not clear
whether the failure of classical
strains to produce virions, despite
production of putative toxic
viral proteins, influences the virulence
of classical
V. cholerae.
Classical prophage RS2 genes encode functional proteins.
In addition to the core-encoded proteins required for CTX
production, the phage-encoded proteins RstA and RstR are also needed. RstA and RstR mediate replication of phage DNA and regulation of
rstA expression, respectively (11, 14).
rstRclass has previously been shown to encode a
functional protein (11); however,
rstAclass, which differs slightly from
rstAET, has not been studied. To test for
rstAclass function, we cloned a portion of the
classical prophage containing rstRclass,
rstAclass, rstBclass, and
some adjacent sequences into the suicide vector pGP704. The new
plasmid, pBD394, is the classical equivalent of the core-negative, pCTXET derivative pBD445 (Fig. 1). Like
pBD445, pBD394 was maintained as a plasmid within O395 and within the
attRS El Tor vaccine strain Bah-2 (17)
(data not shown). Since pGP704 alone cannot replicate in V. cholerae, these data prove that the classical prophage genes
encode a functional DNA replication system and, in particular, a
functional form of RstA.
The role, if any, of RstB in CTX
production has not yet
been identified; RstB has been shown only to contribute to phage
DNA
integration (
24). However, it appears that a defect in
rstBclass does not underlie the lack of virion
production from CTX prophages
in classical strains of
V. cholerae. O395 containing either pBD394
or
pCTX with a Mariner transposon inserted in
rstB yields infectious
virions (data not shown), and such
strains can synthesize RstB
only from templates within or derived from
the classical prophages.
Production of virions by O395(pBD394) also
demonstrates that pBD394
(and thus classical prophages) contains a
phage packaging site;
however, specific sequences required for
packaging of CTX
have
not yet been
identified.
Despite the presence in O395 of an
rstA that can mediate
replication of phage DNA, we have never detected a replicative form
of
the classical CTX prophage in any classical strain of
V. cholerae (data not shown). In contrast, most El Tor
strains produce low
but measurable levels of
pCTX
ET, and it appears that production of
pCTX is an early step in CTX
synthesis
(
7). Initially, we believed that pCTX was
generated
from a prophage by site-specific recombination between
the 17-
or 18-bp direct repeats that flank each prophage and RS1,
since
these are known to mediate integration of CTX
DNA
(
16). Consequently,
we assessed whether these end repeats
(ERs) might have altered
sequences in classical strains that prevented
site-specific recombination.
We subsequently discovered that ERs do not
mediate production
of CTX
(
7) (see below);
however, this sequence analysis of
classical ERs did enable us to
identify the sites of CTX prophage
integration in
classical strains and perhaps to account for the
previously puzzling
finding that classical strains maintain exogenous
CTX phage
DNA in plasmid
form.
Analyses of classical CTX prophage integration
sites.
We identified the CTX prophage integration
sites in classical strains of V. cholerae by sequencing the
junctions between prophage and chromosomal DNA in plasmids (pGP2
and pGP3) derived from the two arrays of the classical strain 569B
(13). As expected, we found that one of the two classical
prophage arrays (represented by pGP3) is inserted into the
chromosome at the same site as the CTX prophage(s) in El
Tor strains: the intergenic region between the TLC and RTX gene
clusters, which lies on replicon I, the larger of the two V. cholerae chromosomes (9, 12, 18, 20). The other
classical prophage array (represented by pGP2) is also inserted into an intergenic region, located on replicon II. Alignment of pGP2-derived sequence with the V. cholerae genome sequence
(generated from the El Tor strain N16961 [BLAST search engine for
unfinished microbial genomes;
http://www.tigr.org/cgi-bin/BlastSearch/blast.cgi?]) revealed that
the additional prophage array lies 0.3 kb upstream of a gene
encoding a probable ortholog of the translation initiation factor
yciH and approximately 1.2 kb upstream of a gene encoding D-Ala-D-Ala ligase. The array is predicted to
lie approximately 0.5 kb downstream of an apparent traF
ortholog. In the N16961 genome, the sequences corresponding to those
found 5' and 3' to the pGP2 prophage array form a continuous unit
that contains a sequence similar (14 of 18 bp) to an ER (Fig.
2A). This suggests that the extra
prophage array in O1 classical strains was inserted into the
chromosome by a relatively site specific process, probably one that
utilized the standard CTX integration machinery. However, it is clear that the alternate insertion site is not a preferred target; we have never detected prophages integrated at this ER variant in El Tor strains.
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the junctional sequences between
CTX prophages and adjacent chromosomal DNA in classical
and El Tor strains. pGP2 and pGP3 are plasmids derived from the
prophages of the classical strain 569B (13). N16961 is
the O1 El Tor strain sequenced by the V. cholerae genome
project. The empty integration site in N16961 is the locus where the
CTX prophage(s) are found on the small chromosome of
classical V. cholerae. (A) Analysis of 3' and 5' ER
sequences. Underlined bases differ from the typical El Tor junction
sequences. Known genes and putative homologs that flank junction
sequences are indicated. (B) Schematic alignment of sequences
downstream of CTX prophage integration sites. Black
triangles represent ER variants. Dark grey rectangles represent areas
with essentially identical sequences. Light grey rectangles represent
areas with similar sequences; the overlaid black lines and boxes
represent differences and insertions. Adjacent genes are indicated. The
diagram is not drawn to scale.
|
|
Our analyses of prophage insertion sites also revealed the
sequences of the 3' ERs following the prophage arrays in pGP2 and
pGP3. The final 3' ER of each phage array in 569B differs by one
base
pair from the 3' ER of El Tor prophage arrays. In
addition,
two bases immediately downstream of these ERs also differ
from
the El Tor sequence (Fig.
2A). Since the 3' ER, rather than the
5'
ER, is the integration site for new CTX phage DNA introduced
into El Tor strains (
6), these differences may account for
the previously noted failure of CTX
ET-Kn
DNA
to integrate into the classical chromosome (
22).
Surprisingly, other than the 2-bp difference, the intergenic sequences
immediately downstream of both classical prophage arrays
in 569B
were identical to the sequence downstream of the CTX array
in
O1 El Tor strains for 133 bp. An additional 121 bp of sequence
downstream of the two insertion sites were similar (91% identity)
(Fig.
2B). This ~254-bp sequence is also present on the small
chromosome of El Tor strains, despite the absence in El Tor strains
of
a CTX prophage array at this site. Consequently, it seems
likely
that this ~254-bp duplication predates the development of the
second prophage array in classical strains; it is unlikely to
have
been generated in conjunction with development of the new
prophage
array. Nonetheless, the prophage insertion site does
mark the
boundary of the duplicated region; the DNA sequences
upstream of the
two insertion sites show no
similarity.
Genetic structure of classical CTX prophage
arrays.
As mentioned above, we have recently determined that
production of extrachromosomal phage DNA (and ultimately of
CTX) does not depend upon site-specific recombination
between the ERs that flank a prophage. Instead, the DNA found in
CTX is a hybrid sequence that is derived from the DNA of
two adjacent chromosomal elements (7). The upstream element
contributes all of the CTX genome's coding sequences,
while the downstream element contributes most of the intergenic
sequence between the ER and rstR. Consequently, the presence
of tandem elements
either two prophages or a prophage followed
by an RS1is essential for production of CTX by a
lysogen. We therefore analyzed the structures of the prophage
arrays in classical strains to determine whether they contained one of
the requisite arrangements. Previously published restriction maps of
pGP2 and pGP3 suggested that each insertion site would contain an RS1
followed by a CTX prophage (13). However, our
analyses indicate that classical prophages are present either as
solitary CTX prophages or as an array of truncated, fused prophages.
We first attempted to confirm, using PCR, that classical prophage
arrays contained an RS1 followed by a CTX prophage, as
initially
suggested by the restriction maps of pGP2 and pGP3. We
therefore
generated PCR products expected to span the junction between
RS1
and the downstream CTX prophage, using primers
complementary to
the 3' end of
rstB and to the 5' end of
rstA (Fig.
3). Our templates
were the plasmids derived from strain 569B and chromosomal DNA
from
strain O395. Unexpectedly, all three reactions yielded a
band
approximately 875 bp long, rather than the predicted product
of
approximately 1,450 bp (data not shown). Sequence analysis
of the PCR
product amplified from O395 chromosomal DNA revealed
that it contained
neither a middle ER sequence nor an RS1-specific
sequence. Instead, it
consisted of sequence from a 3' truncated
CTX prophage
(missing the last 4,400 bp) fused to a 5'-truncated
prophage
(missing the first 524 bp) (Fig.
3). Thus, the 3'-truncated
prophage appeared to contain only
rstR,
rstA,
rstB,
psh, and a
truncated
cep. In
contrast, the 5'-truncated prophage lacked most
of an intergenic
region ('ig-1) normally found upstream of
rstR.
These data
suggested that neither 569B nor O395 contain the expected
RS1 element.
Furthermore, they indicated that all the prophages
within 569B are
truncated at either the 5' or 3' end.
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Expected and actual structures of prophage arrays in
classical strains of V. cholerae. Instead of an RS1 followed
by a CTX prophage, CTX insertion sites that
contain tandem elements in classical V. cholerae contain two
truncated, fused prophages. The upstream prophage lacks the
prophage genes downstream of cep (resulting in
cep'), while the downstream prophage lacks ig-1
sequences starting with the ER (resulting in 'ig-11). The PCR
primers used to amplify the sequences between rstB and
rstA are shown as small black arrows. The DNA sequence of
the unexpected 875-bp PCR product (grey line) was determined. The
presence of genes not assayed by DNA sequencing or PCR has been
inferred from restriction maps generated with SphI (S),
NruI (N), and XbaI (X).
|
|
Southern and PCR analyses were performed to determine whether all of
our O1 classical strains (clinical isolates obtained
over a 20-year
period from a variety of regions [Table
1]) lacked
RS1 and
whether all contained fused arrays of truncated prophages.
We found
that an
rstC probe did not hybridize to DNA from any
classical
V. cholerae strains under conditions in
which
rstC was
readily detected in El Tor chromosomal DNA
(data not shown). Consequently,
we suspect that no O1 classical strains
contain RS1 and that RS1
is present only in El Tor strains and the
closely related O139
strains of
V. cholerae. Further
hybridization analyses yielded
the unexpected finding that our
classical strains could be subdivided
into two groups based on the
restriction maps of their prophage
DNA (Fig.
4). Strains O395, GP12, and C33 comprise
the first set
(type I), while strains C34, C21, C14, C1, and CA401
comprise
the second (type II). However, PCR analyses of representative
strains demonstrated that both type I and type II strains (i)
contain
adjacent truncated fused prophages, since the 875-bp PCR
product
corresponding to fused prophages could be amplified from
DNA of
both types (Fig.
5A); (ii) contain a
CTX prophage or prophage
derivative in the El Tor
prophage insertion site downstream of
TLC, since a product could be
amplified with one TLC-specific
primer and one prophage-specific
primer (Fig.
5B); and (iii) contain
a CTX prophage or
prophage derivative in the classical strain-specific
prophage
insertion site downstream of a
traF homolog, since a
product could be amplified with a chromosome-specific primer
and
a prophage-specific primer (Fig.
5C). In addition, both types
do not appear to contain intact tandem prophages, since no PCR
product corresponding to a junction between two intact prophages
could be generated from DNA of classical strains (data not shown).
Thus, although the two types of classical
V. cholerae can be
distinguished
by their restriction maps, they nonetheless have many
features
in common.
View larger version (121K):
[in this window]
[in a new window]
|
FIG. 4.
Southern blot of chromosomal DNA from classical V. cholerae strains demonstrating the heterogeneity of CTX
prophage arrays. Chromosomal DNA was digested with SphI
and probed with rstRclass, which detects only
classical prophage DNA. No additional CTX
prophage-related sequences were detected with a less specific probe
(data not shown). Strains O395, GP12, CA401, C1, C14, C21, C33, and C34
(lanes 1 to 8, respectively) were compared. The single band in lanes 1, 2, and 7 was shown in additional analyses to be a doublet (data not
shown).
|
|
View larger version (33K):
[in this window]
[in a new window]
|
FIG. 5.
PCR amplification of prophage-prophage and
chromosome-prophage junctions in classical V. cholerae.
(A) Amplication of the junction between a CTX prophage
and an upstream element, using primers RstBF2 and RstRproR (Fig. 3). An
~875-bp product was generated from DNA of classical strains C34 (lane
1), CA401 (lane 2), and O395 (lane 3), indicating that all contain
truncated, fused prophages. An ~1,450-bp product was amplified
from the RS1-CTX prophage junction in the O139 strain
AS207 (lane 4), and no product was synthesized in the absence of
template DNA (lane 5). (B) Detection of a junction between the
chromosomal sequence of TLC and a CTX prophage, using
primers TLCF1 and Ig1R1. A ~600-bp product was amplified from the DNA
of classical strains C34 (lane 1), CA401 (lane 2), and O395 (lane 3) as
well as the O139 strain AS207 (lane 4); it was not synthesized if
template DNA was omitted (lane 5). (C) Detection of a junction between
CTX prophages in the classical strain-specific insertion
site and upstream chromosomal sequence, using the primers PyrFF1 and
Ig1R1. A ~550-bp product was amplified from DNA of the classical
strains O395 (lane 1), C34 (lane 2), and CA401 (lane 3); no product was
amplified from AS207 DNA (lane 4), which lacks a CTX
prophage at this insertion site, or in the absence of template DNA
(lane 5).
|
|
Data from additional Southern blots were combined with DNA sequence
data from the
V. cholerae genome project to determine
the
likely structures of the classical CTX prophage arrays.
Restriction
maps generated with
SphI,
NruI,
BglII, and
XbaI were incorporated
into the final
model. Since the genome data were generated from
an El Tor strain of
V. cholerae, the conservation in classical
V. cholerae of several key diagnostic restriction sites was confirmed
by restriction mapping of PCR products amplified from classical
templates. These analyses indicated that all of our classical
strains
contain one array of truncated fused prophages (described
above and
in Fig.
3) and one site in which a solitary prophage
is integrated.
Type I strains contain the array of truncated prophages
at the El
Tor prophage insertion site and the solitary prophage
at the
classical strain-specific insertion site. In contrast,
type II strains
have the opposite arrangement: a solitary prophage
at the El Tor
insertion site and a truncated array at the classical
locus (data
summarized in Fig.
6A). For numerous
restriction enzymes,
the
ctxAB-containing restriction
fragments generated from these
two arrangements are identical (Fig.
6);
thus, it is not surprising
that all classical strains of O1
V. cholerae were initially believed
to contain identical prophage
arrays. Interestingly, neither type
I nor type II strains contain two
truncated prophage arrays, although
analysis of pGP2 and pGP3
indicated that classical strain 569B
contains such arrays at both
prophage integration sites. We hypothesize
that homologous
recombination between sequences within the prophage
arrays can
result in conversion of one array, via deletion, into
a solitary
prophage. Preliminary analyses suggest that such a
conversion has
occurred in an auxotrophic derivative of 569B,
strain RV508, since
restriction maps of RV508 prophages resemble
those of type II
classical strains (data not shown). It is possible
that all of our
classical strains initially had fused truncated
prophages at both
insertion sites, and that type I and type II
strains differ now due to
their modification by different recombination
events. These type I and
type II strains are the first natural
isolates of
V. cholerae that we have found to contain solitary
prophages; prophages in El Tor and O139 strains are always
flanked
by at least one intact related element.
View larger version (116K):
[in this window]
[in a new window]
|
FIG. 6.
Restriction mapping of the CTX prophage
insertions sites in classical biotype strains. (A) Summary of the
restriction fragments detected on Southern blots of DNA from type I and
type II classical strains digested with SphI (S),
NruI (N), and XbaI (X) and probed with various
prophage-derived probes. The precise sizes of restriction fragments
(in kilobases) were derived from the V. cholerae genome
database as well as laboratory sequence data. Band sizes on blots could
not be determined as precisely, but all except one were consistent with
sequence-derived sizes. X denotes an XbaI
site that is farther downstream than expected; classical biotypes
apparently lack an XbaI site that is present in this region
in El Tor strains. The location of the ctxA probe used for
panel B is shown at the bottom. (B) ctxAB-spanning
restriction fragments from diverse classical strains of V. cholerae are identical. A Southern blot of DNAs digested with
SphI, XbaI, and NruI, as indicated,
was probed with a ctxA probe. Each enzyme produced
equal-size fragments from the classical strains C21 (lanes 1, 4, and 7)
and O395 (lanes 2, 5, and 8). AS207 DNA (lanes 3, 6, and 9) had one
fragment in common with the classical DNAs for each enzyme. Digests of
classical DNA do not have the band with a constant size (~7 kb),
indicative of tandem prophages, that is produced from AS207
DNA. The AS207 prophage array was previously shown to contain
an RS1 followed by three tandem CTX prophages. Faint
bands in a few lanes resulted from incomplete digestion of DNA.
|
|
The restriction analyses confirmed the conclusion, initially based on
PCR analyses, that classical strains do not contain
intact tandem
prophages. Southern blots of classical
V. cholerae DNA
digested with multiple restriction enzymes always lacked the
prophage-length band that is the hallmark of tandem prophages
(Fig.
6B). In addition, DNA sequence analysis revealed that the
downstream prophages in the arrays of truncated classical
prophages
lack most, if not all, of the sequence typically
contributed to
CTX
by the downstream element in an array
that produces virions.
Consequently, classical strains do not contain
any arrays of elements
that we expect to yield extrachromosomal
CTX DNA and CTX
class. The finding
that neither pCTX, pCTX variants, nor
CTX
class is produced by classical strains of
V. cholerae is consistent
with, and provides additional
support for, our new model describing
production of CTX
.
In conclusion, our analyses have revealed that all of the proteins
required for CTX
production can be generated from the
prophages within classical strains of
V. cholerae. Many
of these
proteins are synthesized by classical strains under typical
laboratory
growth conditions, although some (e.g., Cep) are probably
produced
at low levels that can be limiting for virion assembly. Thus,
it seems likely that phage genes are expressed to some degree
even when
pCTX and CTX
are not produced. CTX
prophages are located
at two sites within the genome of classical
O1
V. cholerae: at
the insertion site occupied in El Tor
strains (on chromosome I
between TLC and the RTX gene cluster)
and within an intergenic
region of chromosome II, near the gene
encoding
D-Ala-
D-Ala ligase.
Classical
prophages are present either as solitary elements or
as
truncated elements within arrays, and the prophage arrays never
contain RS1. Thus, the prophages in classical strains lack the
necessary chromosomal arrangements (i.e., tandem prophages or
a
prophage followed by an RS1) for generation of pCTX
and CTX
,
and this fact apparently underlies the failure of
classical
V. cholerae to produce classical CTX
.
| |
ACKNOWLEDGMENTS |
We thank J. Mekalanos and G. Pearson for pGP2 and pGP3. We are
grateful to A. Camilli and to Waldor lab colleagues for helpful suggestions and critical reading of the manuscript. We thank A. Kane
and the New England Medical Center GRASP Center for preparation of
plates and media.
This work was supported by NIH grant AI-42347 to M.K.W., NIH grant
P30DK-34928 to the NEMC GRASP Digestive Center, and NIH grant
GM20483-01 to B.M.D. M.K.W. is a Pew Scholar in the Biomedical Sciences and an Assistant Investigator of the Howard Hughes Medical Institute.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Tufts University
School of Medicine and Division of Geographic Medicine and Infectious Diseases, New England Medical Center #041, 750 Washington St., Boston,
MA 02111. Phone: (617) 636-7618. Fax: (617) 636-5292. E-mail:
mwaldor{at}lifespan.org.
Present address: Department of Microbiology, University College
Cork, Cork, Ireland.
| |
REFERENCES |
| 1.
|
Ausubel, F. M. R.,
Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1990.
Current protocols in molecular biology.
Greene Publishing and Wiley-Interscience, New York, N.Y.
|
| 2.
|
Barua, D.
1992.
History of cholera, p. 1-36.
In
D. Barua, and W. B. Greenough (ed.), Cholera. Plenum Medical Book Co., New York, N.Y.
|
| 3.
|
Basu, A.,
A. K. Mukhopadhyay,
P. Garg,
S. Chakraborty,
T. Ramamurthy,
S. Yamasaki,
Y. Takeda, and G. B. Nair.
2000.
Diversity in the arrangement of the CTX prophages in classical strains of Vibrio cholerae O1.
FEMS Microbiol. Lett.
182:35-40[CrossRef][Medline].
|
| 4.
|
Basu, A.,
A. K. Mukhopadhyay,
C. Sharma,
J. Jyot,
N. Gupta,
A. Ghosh,
S. K. Bhattacharya,
Y. Takeda,
A. S. Faruque,
M. J. Albert, and G. Balakrish Nair.
1998.
Heterogeneity in the organization of the CTX genetic element in strains of Vibrio cholerae O139 Bengal isolated from Calcutta, India and Dhaka, Bangladesh and its possible link to the dissimilar incidence of O139 cholera in the two locales.
Microb. Pathog.
24:175-183[CrossRef][Medline].
|
| 5.
|
Baudry, B.,
A. Fasano,
J. Ketley, and J. B. Kaper.
1992.
Cloning of a gene (zot) encoding a new toxin produced by Vibrio cholerae.
Infect. Immun.
60:428-434[Abstract/Free Full Text].
|
| 6.
|
Davis, B. M.,
H. H. Kimsey,
W. Chang, and M. K. Waldor.
1999.
The Vibrio cholerae O139 Calcutta bacteriophage CTX is infectious and encodes a novel repressor.
J. Bacteriol.
181:6779-6787[Abstract/Free Full Text].
|
| 7.
|
Davis, B. M., and M. K. Waldor.
2000.
CTX contains a hybrid genome derived from tandemly integrated elements.
Proc. Natl. Acad. Sci. USA
97:8572-8577[Abstract/Free Full Text].
|
| 8.
|
Hanne, L. F., and R. A. Finkelstein.
1982.
Characterization and distribution of the hemagglutinins produced by Vibrio cholerae.
Infect. Immun.
36:209-214[Abstract/Free Full Text].
|
| 9.
|
Heidelberg, J. F.,
J. A. Eisen,
W. C. Nelson,
R. A. Clayton,
M. L. Gwinn,
R. J. Dodson,
D. H. Haft,
E. K. Hickey,
J. D. Peterson,
L. Umayam,
S. R. Gill,
K. E. Nelson,
T. D. Read,
H. Tettelin,
D. Richardson,
M. D. Ermolaeva,
J. Vamathevan,
S. Bass,
H. Qin,
I. Dragoi,
P. Sellers,
L. McDonald,
T. Utterback,
R. D. Fleishmann,
W. C. Nierman,
O. White,
S. L. Salzberg,
H. O. Smith,
R. R. Colwell,
J. J. Mekalanos,
J. C. Venter, and C. M. Fraser.
2000.
DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae.
Nature
406:477-484[CrossRef][Medline].
|
| 10.
|
Kaper, J. B.,
J. G. Morris, Jr., and M. M. Levine.
1995.
Cholera.
Clin. Microbiol. Rev.
8:48-86[Abstract].
|
| 11.
|
Kimsey, H. H., and M. K. Waldor.
1998.
CTX immunity: application in the development of cholera vaccines.
Proc. Natl. Acad. Sci. USA
95:7035-7039[Abstract/Free Full Text].
|
| 12.
|
Lin, W.,
K. J. Fullner,
R. Clayton,
J. A. Sexton,
M. B. Rogers,
K. E. Calia,
S. B. Calderwood,
C. Fraser, and J. J. Mekalanos.
1999.
Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage.
Proc. Natl. Acad. Sci. USA
96:1071-1076[Abstract/Free Full Text].
|
| 13.
|
Mekalanos, J. J.
1983.
Duplication and amplification of toxin genes in Vibrio cholerae.
Cell
35:253-263[CrossRef][Medline].
|
| 14.
|
Mekalanos, J. J.,
D. J. Swartz,
G. D. Pearson,
N. Harford,
F. Groyne, and M. de Wilde.
1983.
Cholera toxin genes: nucleotide sequence, deletion analysis and vaccine development.
Nature
306:551-557[CrossRef][Medline].
|
| 15.
|
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583[Abstract/Free Full Text].
|
| 16.
|
Pearson, G. D.,
A. Woods,
S. L. Chiang, and J. J. Mekalanos.
1993.
CTX genetic element encodes a site-specific recombination system and an intestinal colonization factor.
Proc. Natl. Acad. Sci. USA
90:3750-3754[Abstract/Free Full Text].
|
| 17.
|
Pearson, G. D. N.
1989.
Doctoral thesis.
Harvard University Medical School, Cambridge, Mass.
|
| 18.
|
Rubin, E. J.,
W. Lin,
J. J. Mekalanos, and M. K. Waldor.
1998.
Replication and integration of a Vibrio cholerae cryptic plasmid linked to the CTX prophage.
Mol. Microbiol.
28:1247-1254[CrossRef][Medline].
|
| 19.
|
Trucksis, M.,
J. E. Galen,
J. Michalski,
A. Fasano, and J. B. Kaper.
1993.
Accessory cholera enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette.
Proc. Natl. Acad. Sci. USA
90:5267-5271[Abstract/Free Full Text].
|
| 20.
|
Trucksis, M.,
J. Michalski,
Y. K. Deng, and J. B. Kaper.
1998.
The Vibrio cholerae genome contains two unique circular chromosomes.
Proc. Natl. Acad. Sci. USA
95:14464-14469[Abstract/Free Full Text].
|
| 21.
|
Waldor, M. K., and J. J. Mekalanos.
1994.
Emergence of a new cholera pandemic: molecular analysis of virulence determinants in Vibrio cholerae O139 and development of a live vaccine prototype.
J. Infect. Dis.
170:278-283[Medline].
|
| 22.
|
Waldor, M. K., and J. J. Mekalanos.
1996.
Lysogenic conversion by a filamentous phage encoding cholera toxin.
Science
272:1910-1914[Abstract].
|
| 23.
|
Waldor, M. K., and J. J. Mekalanos.
1996.
Vibrio cholerae: molecular pathogenesis, immune response, and vaccine development, p. 37-56.
In
L. J. Paradise (ed.), Enteric infections and immunity. Plenum Press, New York, N.Y.
|
| 24.
|
Waldor, M. K.,
E. J. Rubin,
G. D. Pearson,
H. Kimsey, and J. J. Mekalanos.
1997.
Regulation, replication, and integration functions of the Vibrio cholerae CTX are encoded by region RS2.
Mol. Microbiol.
24:917-926[CrossRef][Medline].
|
Journal of Bacteriology, December 2000, p. 6992-6998, Vol. 182, No. 24
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chun, J., Grim, C. J., Hasan, N. A., Lee, J. H., Choi, S. Y., Haley, B. J., Taviani, E., Jeon, Y.-S., Kim, D. W., Lee, J.-H., Brettin, T. S., Bruce, D. C., Challacombe, J. F., Detter, J. C., Han, C. S., Munk, A. C., Chertkov, O., Meincke, L., Saunders, E., Walters, R. A., Huq, A., Nair, G. B., Colwell, R. R.
(2009). Comparative genomics reveals mechanism for short-term and long-term clonal transitions in pandemic Vibrio cholerae. Proc. Natl. Acad. Sci. USA
106: 15442-15447
[Abstract]
[Full Text]
-
Nguyen, B. M., Lee, J. H., Cuong, N. T., Choi, S. Y., Hien, N. T., Anh, D. D., Lee, H. R., Ansaruzzaman, M., Endtz, H. P., Chun, J., Lopez, A. L., Czerkinsky, C., Clemens, J. D., Kim, D. W.
(2009). Cholera Outbreaks Caused by an Altered Vibrio cholerae O1 El Tor Biotype Strain Producing Classical Cholera Toxin B in Vietnam in 2007 to 2008. J. Clin. Microbiol.
47: 1568-1571
[Abstract]
[Full Text]
-
Chatterjee, S., Patra, T., Ghosh, K., Raychoudhuri, A., Pazhani, G. P., Das, M., Sarkar, B., Bhadra, R. K., Mukhopadhyay, A. K., Takeda, Y., Nair, G. B., Ramamurthy, T., Nandy, R. K.
(2009). Vibrio cholerae O1 clinical strains isolated in 1992 in Kolkata with progenitor traits of the 2004 Mozambique variant. J Med Microbiol
58: 239-247
[Abstract]
[Full Text]
-
Udden, S. M. N., Zahid, M. S. H., Biswas, K., Ahmad, Q. S., Cravioto, A., Nair, G. B., Mekalanos, J. J., Faruque, S. M.
(2008). Acquisition of classical CTX prophage from Vibrio cholerae O141 by El Tor strains aided by lytic phages and chitin-induced competence. Proc. Natl. Acad. Sci. USA
105: 11951-11956
[Abstract]
[Full Text]
-
Pang, B., Yan, M., Cui, Z., Ye, X., Diao, B., Ren, Y., Gao, S., Zhang, L., Kan, B.
(2007). Genetic Diversity of Toxigenic and Nontoxigenic Vibrio cholerae Serogroups O1 and O139 Revealed by Array-Based Comparative Genomic Hybridization. J. Bacteriol.
189: 4837-4849
[Abstract]
[Full Text]
-
Faruque, S. M., Tam, V. C., Chowdhury, N., Diraphat, P., Dziejman, M., Heidelberg, J. F., Clemens, J. D., Mekalanos, J. J., Nair, G. B.
(2007). Genomic analysis of the Mozambique strain of Vibrio cholerae O1 reveals the origin of El Tor strains carrying classical CTX prophage. Proc. Natl. Acad. Sci. USA
104: 5151-5156
[Abstract]
[Full Text]
-
Danin-Poleg, Y., Cohen, L. A., Gancz, H., Broza, Y. Y., Goldshmidt, H., Malul, E., Valinsky, L., Lerner, L., Broza, M., Kashi, Y.
(2007). Vibrio cholerae Strain Typing and Phylogeny Study Based on Simple Sequence Repeats. J. Clin. Microbiol.
45: 736-746
[Abstract]
[Full Text]
-
Maiti, D., Das, B., Saha, A., Nandy, R. K., Nair, G. B., Bhadra, R. K.
(2006). Genetic organization of pre-CTX and CTX prophages in the genome of an environmental Vibrio cholerae non-O1, non-O139 strain. Microbiology
152: 3633-3641
[Abstract]
[Full Text]
-
Yoon, S. S., Mekalanos, J. J.
(2006). 2,3-Butanediol Synthesis and the Emergence of the Vibrio cholerae El Tor Biotype. Infect. Immun.
74: 6547-6556
[Abstract]
[Full Text]
-
Safa, A., Bhuyian, N. A., Nusrin, S., Ansaruzzaman, M., Alam, M., Hamabata, T., Takeda, Y., Sack, D. A., Nair, G. B.
(2006). Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes.. J Med Microbiol
55: 1563-1569
[Abstract]
[Full Text]
-
Huang, X.-Z., Nikolich, M. P., Lindler, L. E.
(2006). Current trends in plague research: from genomics to virulence.. Clin Med Res
4: 189-199
[Abstract]
[Full Text]
-
Lee, J. H., Han, K. H., Choi, S. Y., Lucas, M. E. S., Mondlane, C., Ansaruzzaman, M., Nair, G. B., Sack, D. A., von Seidlein, L., Clemens, J. D., Song, M., Chun, J., The Mozambique Cholera Vaccine Demonstration Proje, , Kim, D. W.
(2006). Multilocus sequence typing (MLST) analysis of Vibrio cholerae O1 El Tor isolates from Mozambique that harbour the classical CTX prophage. J Med Microbiol
55: 165-170
[Abstract]
[Full Text]
-
O'Shea, Y. A., Reen, F. J., Quirke, A. M., Boyd, E. F.
(2004). Evolutionary Genetic Analysis of the Emergence of Epidemic Vibrio cholerae Isolates on the Basis of Comparative Nucleotide Sequence Analysis and Multilocus Virulence Gene Profiles. J. Clin. Microbiol.
42: 4657-4671
[Abstract]
[Full Text]
-
Campos, J., Martinez, E., Marrero, K., Silva, Y., Rodriguez, B. L., Suzarte, E., Ledon, T., Fando, R.
(2003). Novel Type of Specialized Transduction for CTX{phi} or Its Satellite Phage RS1 Mediated by Filamentous Phage VGJ{phi} in Vibrio cholerae. J. Bacteriol.
185: 7231-7240
[Abstract]
[Full Text]
-
Liang, W., Wang, S., Yu, F., Zhang, L., Qi, G., Liu, Y., Gao, S., Kan, B.
(2003). Construction and Evaluation of a Safe, Live, Oral Vibrio cholerae Vaccine Candidate, IEM108. Infect. Immun.
71: 5498-5504
[Abstract]
[Full Text]
-
Campos, J., Martinez, E., Suzarte, E., Rodriguez, B. L., Marrero, K., Silva, Y., Ledon, T., del Sol, R., Fando, R.
(2003). VGJ{phi}, a Novel Filamentous Phage of Vibrio cholerae, Integrates into the Same Chromosomal Site as CTX{phi}. J. Bacteriol.
185: 5685-5696
[Abstract]
[Full Text]
-
Faruque, S. M., Zhu, J., Asadulghani, , Kamruzzaman, M., Mekalanos, J. J.
(2003). Examination of Diverse Toxin-Coregulated Pilus-Positive Vibrio cholerae Strains Fails To Demonstrate Evidence for Vibrio Pathogenicity Island Phage. Infect. Immun.
71: 2993-2999
[Abstract]
[Full Text]
-
Faruque, S. M., Kamruzzaman, M., Asadulghani, , Sack, D. A., Mekalanos, J. J., Nair, G. B.
(2003). CTXPhi -independent production of the RS1 satellite phage by Vibriocholerae. Proc. Natl. Acad. Sci. USA
100: 1280-1285
[Abstract]
[Full Text]
-
Faruque, S. M., Kamruzzaman, M., Meraj, I. M., Chowdhury, N., Nair, G. B., Sack, R. B., Colwell, R. R., Sack, D. A.
(2003). Pathogenic Potential of Environmental Vibrio cholerae Strains Carrying Genetic Variants of the Toxin-Coregulated Pilus Pathogenicity Island. Infect. Immun.
71: 1020-1025
[Abstract]
[Full Text]
-
Nandi, S., Maiti, D., Saha, A., Bhadra, R. K.
(2003). Genesis of variants of Vibrio cholerae O1 biotype El Tor: role of the CTX{phi} array and its position in the genome. Microbiology
149: 89-97
[Abstract]
[Full Text]
-
Boyd, E. F., Waldor, M. K.
(2002). Evolutionary and functional analyses of variants of the toxin-coregulated pilus protein TcpA from toxigenic Vibrio cholerae non-O1/non-O139 serogroup isolates. Microbiology
148: 1655-1666
[Abstract]
[Full Text]
-
Faruque, S. M., Asadulghani, , Kamruzzaman, M., Nandi, R. K., Ghosh, A. N., Nair, G. B., Mekalanos, J. J., Sack, D. A.
(2002). RS1 Element of Vibrio cholerae Can Propagate Horizontally as a Filamentous Phage Exploiting the Morphogenesis Genes of CTX{Phi}. Infect. Immun.
70: 163-170
[Abstract]
[Full Text]
Top
Abstract
Introduction
