Previous Article | Next Article 
Journal of Bacteriology, February 2000, p. 607-612, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Thermostable Single-Strand DNase from
Methanococcus jannaschii Related to the RecJ Recombination
and Repair Exonuclease from Escherichia coli
Luis A.
Rajman and
Susan T.
Lovett*
Department of Biology and Rosenstiel Basic
Medical Sciences Research Center, Brandeis University, Waltham,
Massachusetts 02454-9110
Received 7 September 1999/Accepted 5 November 1999
 |
ABSTRACT |
The RecJ protein of Escherichia coli plays an important
role in a number of DNA repair and recombination pathways. RecJ
catalyzes processive degradation of single-stranded DNA in a 5'-to-3'
direction. Sequences highly related to those encoding RecJ can be found
in most of the eubacterial genomes sequenced to date. From alignment of
these sequences, seven conserved motifs are apparent. At least five of
these motifs are shared among a large family of proteins in eubacteria,
eukaryotes, and archaea, including the PPX1 polyphosphatase of yeast
and Drosophila Prune. Archaeal genomes are particularly rich in such sequences, but it has not been clear whether any of the
encoded proteins play a functional role similar to that of RecJ
exonuclease. We have investigated three such proteins from
Methanococcus jannaschii with the strongest overall
sequence similarity to E. coli RecJ. Two of the genes,
MJ0977 and MJ0831, partially complement a recJ mutant
phenotype in E. coli. The expression of MJ0977 in E. coli resulted in high levels of a thermostable single-stranded
DNase activity with properties similar to those of RecJ exonuclease.
Despite overall weak sequence similarity between the MJ0977 product and
RecJ, these nucleases are likely to have similar biological functions.
 |
INTRODUCTION |
The RecJ exonuclease of
Escherichia coli is a single-stranded DNA (ssDNA)-specific
exonuclease that plays a role in DNA repair, recombination, and
mutation avoidance (4, 6, 8, 9, 11). A comparison of the
available sequenced genomes shows that RecJ is ubiquitous throughout
the eubacteria. Sequences with a strong similarity to E. coli RecJ are found in at least nine bacterial divisions,
indicating an ancient origin and important biological function for
RecJ. Alignment of sequences from 11 eubacterial genera with strong
similarity to RecJ has revealed seven conserved motifs among the
eubacterial RecJ proteins (10) (Fig.
1). Mutational analysis of amino acids
within six of these motifs in the E. coli RecJ protein
(motifs 1, 2, 3, 4, 6, and 7) confirmed that these residues are
essential for exonuclease activity in vitro and genetic function in
vivo (10). Residues within these motifs are good candidates
for interactions with the phosphates of the substrate DNA, or with
Mg2+ ions, which are cofactors required for RecJ-mediated
hydrolysis of DNA (9).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of RecJ motifs among archaeal proteins and
PPX1 of S. cerevisiae. MJ, AF, MTH, and PHO prefixes
indicate proteins of the archaea M. jannaschii, A. fulgidus, M. thermoautotrophicum, and P. horikoshii, respectively. Eco, E. coli sequence; Sce,
S. cerevisiae sequence. NR, the motif is not recognizable
within the sequence alignments. Each member of the defined groups has
very strong sequence similarity to other members of the group, with
E values in pairwise BLASTP alignments of
<10 25. (A) Conserved motifs from the E. coli
RecJ sequence, with invariant residues among the eubacterial
RecJ-related sequences (11) shown in bold. (B) Motifs from
group B archaeal sequences with strongest similarity to RecJ. (C)
AF0075 archaeal sequence with somewhat weaker similarity to RecJ and
similarity to group B. (D) Archaeal RecJ-related sequences with both
RecJ motifs and an N-terminal DnaJ domain. (E) AF0291, an outlying
archaeal sequence with no strong homology to any of the other groups.
(F) Archaeal sequences with similarity to group G. (G) Sequences with
similarity to group F. (H) PPX1 of S. cerevisiae and related
sequences from archaea.
|
|
The genomes of archaea are especially rich in sequences carrying RecJ
motifs: Methanococcus jannaschii has six,
Archaeoglobus fulgidus has seven, and Methanobacterium
thermoautotrophicum and Pyrococcus horikoshii each have
three. Each of these archaeal hypothetical proteins contains at least
five of the seven motifs that are conserved among eubacterial RecJ
proteins (Fig. 1). Although overall sequence similarity between these
proteins and eubacterial RecJ is limited, the presence of the RecJ
motifs strongly suggests that these proteins are related to RecJ and
raises the possibility that they possess exonuclease activity.
The conserved motifs in RecJ define a large family of proteins in
eubacteria, archaea, and eukaryotes (2, 10). Although the
biochemical properties of this group, for the most part, have not been
established, it includes two proteins that have been characterized
extensively: the ssDNA-specific RecJ exonuclease of E. coli
(9) and the PPX1 polyphosphatase of Saccharomyces cerevisiae (14, 15). Although RecJ and PPX1 have very
little amino acid sequence similarity outside the conserved motifs,
both have phosphoesterase activity, albeit on very different biological substrates. Although the presence of the RecJ motifs implicates phosphoesterase activity, it is difficult at present to assign phosphatase or exonuclease activity to individual members of this family. We have therefore chosen to examine the three open reading frames from M. jannaschii with strongest similarity to the
sequences encoding eubacterial RecJ. We have tested these genes for
genetic complementation of a UV-sensitive phenotype conferred by a
recJ mutation in E. coli and for expression of
nuclease activity on DNA. Two of the genes, MJ0977 and MJ0831, do
indeed show partial genetic complementation, indicating that they
likely share function with RecJ exonuclease. We also demonstrate that
one of these genes, MJ0977, encodes a thermostable ssDNA nuclease
activity with properties similar to those of E. coli RecJ exonuclease.
 |
MATERIALS AND METHODS |
Database searches.
The gapped BLASTP and PSI-BLAST programs
(1) were used to generate sequence alignments by use of the
website provided by the National Center for Biotechnology Information
(http://www/ncbi/nlm.nih.gov/BLAST). In all cases, the BLOSUM62 matrix
was used, with gap penalties of 11 (open) and 1 (per residue
extension), with a lambda ratio of 0.85, and with the sequence filter off.
Plasmids.
The following primers were used to amplify three
recJ-related sequences from M. jannaschii genomic
DNA by use of Pfu polymerase (Stratagene) under conditions
described by the manufacturer: 5' TAATGTATCGATTGGAAAGGAGGTACAAGCGATGATGGAAAAACTTAAAGAAATA 3' (N terminal) and 5'
TAATGGCTGCAGATATTTTTATCTCCTTAA 3' (C terminal) for
MJ0831, 5'
TAATGTATCGATTGGAAAGGAGGTACAAGCGATGGAAAATTGGGTAGAATTGAAA 3' (N terminal) and 5'
TAATGGCTGCAGATATTTTTATCTCAAAGC 3' (C terminal) for
MJ0977, and 5'
TAATGTATCGAT TGGAAAGGAG GTACAAGCGATGATAG TAAAG TG TCCAAT T TG T
3' (N terminal) and 5'
TAATGGCTGCAGTATTTTTTATTGCTCTTT 3' (C terminal) for
MJ1198. The N-terminal primers contain a ClaI restriction
site and a ribosome-binding site (underlined). The C-terminal primers
contain a PstI restriction site. PCR products were digested
with ClaI and PstI and ligated into compatible
sites on the low-copy-number vector pWSK29 (12) to produce
pLAR101, pLAR102, and pLAR103, respectively. Plasmid pSTL132 contains
the ApaI-SacII fragment of pSTL175
(10) cloned into identical sites on pWSK29. A
low-copy-number vector was chosen because of toxicity exhibited by
E. coli recJ when present on a high-copy-number plasmid.
UV survival assays.
Complementation experiments were carried
out with plasmids pWSK29, pLAR101, pLAR102, pLAR103, and pSTL132,
described above. Plasmids were introduced by electroporation
(5) into the E. coli K-12 strain STL3266
[F
DE3 recB21 recC22 sbcA23
recJ284::Tn10 thi-1 argE3 hisG4
(gpt-proA)62 thr-1 leuB6 kdgK51 rfbD1 ara-14 lacY1
galK2 xyl-5 mtl-1 tsx-33 supE44 rpsL31], a
DE3 lysogen
carrying an isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible T7 RNA polymerase gene. Transformants were grown overnight on Luria-Bertani (LB) agar (1.5%) plates containing ampicillin (100 µg/ml) and tetracycline (15 µg/ml) (LB+Ap+Tc agar). Individual transformants were selected, and cells were grown in liquid
LB+Ap+Tc medium to exponential phase (optical density at 600 nm, 0.6).
Cultures were split, and one half was induced with 1 mM IPTG. Both sets
of cultures were grown for 1 h, serially diluted in 56/2 buffer
(13), and plated on LB+Ap+Tc agar plates. Plates were
incubated at 45°C for 15 min, exposed to a 0-, 1-, 2-, or
5-J/m2 dose of UV (254 nm) irradiation, and incubated at
45°C in the dark for an additional 15 min and then overnight at
37°C. Fractional survival was calculated as the number of CFU on
irradiated plates relative to the number of CFU on unirradiated plates.
Protein expression.
E. coli K-12 strain STL2329
[
DE3 sbcB15 recJ284::Tn10 endA
(xth-pncA gal thi)], a
DE3 lysogen carrying an
IPTG-inducible T7 RNA polymerase gene, was used to express the protein
products of MJ0831, MJ0977, and MJ1198 from pLAR101, pLAR102, and
pLAR103, respectively. Cells were grown at 37°C in liquid LB+Ap+Tc
medium to exponential phase (optical density at 600 nm, 0.8). IPTG (2 mM final concentration) was added to induce plasmid-encoded gene expression, and the culture was incubated for an additional hour. Cells
were harvested by centrifugation, resuspended in 0.01 volume of 50 mM
Tris-HCl (pH 7.5)-10% sucrose (wt/vol), and stored at
70°C. To
thawed cell suspensions, EDTA, lysozyme, and dithiothreitol were added
to final concentrations of 4 mM, 1.5 mg/ml, and 0.8 mM, respectively.
Cells were lysed by incubation at 4°C for 30 min followed by heat
shock at 37°C for 5 min. The lysates were cleared by centrifugation,
and the subsequent crude extracts were assayed as described below.
Nuclease assays.
Uniformly labeled bacteriophage T7
3H-DNA was prepared as previously described (7)
with [3H]thymidine (Dupont NEN). End-labeled substrates
were prepared from linearized 3-kb pBSSK
plasmid DNA and
purified with Qiagen QiaExII kits. 3'-End-labeled substrate was
generated from XbaI-digested pBSSK
by
"fill-in" synthesis with the E. coli DNA polymerase I
large fragment (New England Biolabs) in the presence of
[
-
32P]dATP (Dupont NEN). 5'-End-labeled substrate
was generated from HindIII-digested
pBSSK
DNA, treated with shrimp alkaline phosphatase
(United States Biochemical Corp.), and phosphorylated with T4
polynucleotide kinase (New England Biolabs) and
[
-
32P]ATP (Dupont NEN).
Enzyme assays were done with either 0.5 µg (1.5 nmol) of T7
3H-DNA or 0.2 µg (0.2 pmol of ends) of 3'- or
5'-end-labeled substrate.
Standard reaction mixtures contained 50 mM
Tris-HCl (pH 6.5) (measured
at 65°C), 10 mM MgCl
2, 0.67 mM dithiothreitol, and 1 mg of bovine
serum albumin (BSA) per ml in a
50-µl volume. Substrate DNA was
heat denatured by incubation at
100°C for 5 min, followed by quenching
on ice. When required, crude
extracts were diluted in a buffer
containing 10 mM Tris-HCl (pH 7.5),
10 mM 2-mercaptoethanol, and
0.5 mg of BSA per ml. Protein samples or
sample dilutions (2 µl)
were added to reaction mixtures, which were
then incubated at
65°C for 20 min. Trichloroacetic acid precipitation
and determination
of soluble radioactivity were performed as described
previously
(
9). Protein concentrations of the crude extracts
were determined
by the Bradford method (
3) with a reagent
from Bio-Rad and
BSA as the standard. One unit of nuclease activity
corresponds
to the release of 1 nmol of acid-soluble
product.
 |
RESULTS |
Sequence comparison of archaeal hypothetical proteins with
eubacterial RecJ and polyphosphatase PPX1 of yeast.
Database
searches of eubacterial genomes with E. coli RecJ and the
gapped BLASTP program (1) revealed 14 sequences that define
seven conserved sequence motifs (10) (Fig. 1A). Individual pairwise alignments from such searches yielded E values (the
probability of matching by chance) of 10
21 to
10
69, indicating very strong similarity with
E. coli RecJ exonuclease, including open reading frames from
the diverse genera Aquifex, Bacillus,
Borrelia, Chlamydia, Chlamydophila,
Erwinia, Haemophilus, Helicobacter,
Rickettsia, Synechocystis, and
Treponema. Both Bacillus subtilis and
Helicobacter pylori carry two RecJ-related sequences, one
with somewhat less similarity to E. coli RecJ. (The second Bacillus sequence is encoded on an SP
2 prophage.)
Twenty open reading frames with similarity to the
E. coli
RecJ sequence can be found in the four archaeal species
M. jannaschii,
A. fulgidus,
M. thermoautotrophicum, and
P. horikoshii (Fig.
1)
with
iterative PSI-BLAST (
1) searches of the National Center
for
Biotechnology Information DNA database
(
http://www/ncbi/nlm.nih.gov/BLAST).
The PSI-BLAST program allows the
database to be searched iteratively,
first with a "seed" sequence
and then with a matrix of related
proteins, with position-specific
scoring. Highly conserved motifs
among otherwise weakly related
proteins can therefore be more
easily identified. These archaeal
RecJ-related sequences can be
placed into seven groups based on strong
mutual similarity (
E,
<10
25). The sequence
relationships between certain representative members
of groups A to H
are given in Table
1. Group A includes
the eubacterial
sequences epitomized by the
E. coli RecJ
exonuclease. The second
group (Fig.
1B) includes seven archaeal
sequences with the strongest
overall similarity to the eubacterial RecJ
sequence. This group
includes two sequences from
M. jannaschii that we have chosen
to examine in this study: MJ0977
and MJ0831. Although not necessarily
strongly homologous to the
E. coli RecJ sequence (as can be seen
in Table
1), the
members of group B show strong similarity to
one or more of the
eubacterial RecJ sequences (usually from the
chlamydiae,
Bacillus, or
Borrelia), with
E values
of 10
3 to 10
9. Group C has a single member,
AF0075, which is similar to members
of group B and to the eubacterial
RecJ sequence (Table
1). AF0075
is most similar to the
Rickettsia
prowazekii RecJ sequence, with
an
E value of
10
5. Group D includes four archaeal sequences (MJ1198,
AF1337, MTH0763,
and PHO0340) with predicted proteins larger than RecJ
and an N-terminal
extension with homology to DnaJ, an
E. coli chaperonin. These
sequences are highly related to each other,
with pairwise BLASTP
E values ranging from
10
92 to 10
159. We have chosen to examine
MJ1198 from this group. The MJ1198
product is significantly similar in
its C-terminal portion to
Borrelia RecJ (
E, 3 × 10
5). Group E includes a single member, AF0291,
whose product is
only very weakly similar to those of other groups or
to RecJ (Table
1). Groups F and G include sequences from two or more
archaeal
genera which are strongly similar (
E for group F,
10
45;
E for group G, 10
84 to
10
87); groups F and G are themselves related (Table
1).
Group H includes
two sequences whose products have been annotated as
polyphosphatases
based on similarity to
S. cerevisiae PPX1
metaphosphatase. Members
of groups E, F, G, and H have no significant
homology in pairwise
BLASTP alignments to any of the eubacterial RecJ
sequences. However,
members of groups F and G are similar to another
group of eubacterial
sequences, including those from the mycoplasmal
MgPa and P1 cytoadhesion
operons, a domain from several poly(A)
polymerases, and sequences
for numerous
B. subtilis
hypothetical proteins (including YtiQ,
YybT, and YybQ) (
2).
Cloning of RecJ-related genes from Methanococcus and
genetic complementation of recJ in E. coli.
To assess the ability of the methanococcal genes to
complement a recJ mutation, the open reading frames MJ0977,
MJ0831, and MJ1198 were amplified by PCR from M. jannaschii
chromosomal DNA, fused to a ribosome-binding site sequence, and cloned
into a low-copy-number expression vector of E. coli. The
plasmid derivatives were introduced by transformation into an E. coli recJ mutant strain, STL3266, and tested for their ability to
enhance UV survival. A T7 phage promoter on the vector controls
expression of the genes. The addition of IPTG to the growth medium
triggers the expression of the genes by induction of T7 RNA polymerase
from a resident
DE3 lysogenic phage.
To promote the functionality of the potentially thermophilic proteins,
the growth temperature was raised to 45°C both prior
to and
immediately after irradiation. With this regimen, both
MJ0977 and
MJ0831 exhibited partial complementation of the
recJ mutation. The presence of MJ0977 or MJ0831 in strain STL3266 resulted
in ~50-fold and ~25-fold increases in survival at a UV dosage
of 5 J/m
2, respectively (Fig.
2).
Complementation was dependent on the
induction of the MJ0831 and MJ0977
genes with the addition of
IPTG, as no substantial
complementation was observed in its absence
(data not shown).
In contrast, MJ1198 had weak or no ability to
complement the
recJ mutation.
E. coli recJ expression restored
UV survival fully (Fig.
2).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 2.
UV survival of E. coli STL3266 transformed
with plasmids containing M. jannaschii genes, E. coli
recJ, or the vector alone. Symbols: , vector; , E. coli recJ; , MJ0831; , MJ0977; , MJ1198. Values are the
means of five or more experiments.
|
|
Overexpression and characterization of MJ0977 nuclease
activity.
Plasmids pLAR101, pLAR102, and pLAR103 were introduced
into STL2329 for protein expression. Crude extracts were prepared from cells induced for expression of each of the three methanococcal genes.
Extracts were tested for the ability to degrade a uniformly 3H-labeled T7 DNA substrate. At 37°C, extracts from cells
expressing the MJ0977-encoded protein exhibited a sixfold increase in
nuclease activity over cells carrying the vector alone (Fig.
3). No increased DNase activity was
evident in extracts from cells expressing the product of MJ0831 or
MJ1198 (data not shown).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Thermostability of ssDNA nuclease activity in crude
extracts of cells induced for the expression of the MJ0977 product or
E. coli RecJ. Nuclease assays were performed under
standard conditions (as described in Materials and Methods) with noted
temperature variations. The specific ssDNA nuclease activity of
extracts from cells containing the vector alone was <35 U/mg of
protein.
|
|
To assess the thermostability of MJ0977-encoded nuclease activity,
extracts of MJ0977-expressing cells were also tested at
higher reaction
temperatures. Crude extracts from cells expressing
E. coli
RecJ were used for comparison.
E. coli RecJ DNase activity
was optimal at 37°C and was reduced significantly when the reaction
temperature was increased (Fig.
3). In contrast, the nuclease
activity
of extracts from MJ0977-expressing cells increased significantly
when
the reaction temperature was above 37°C and was optimal at
65°C. At
65°C, MJ0977-expressing cells exhibited nuclease activity
30-fold
above that of cells carrying the vector alone. The DNase
activity in
extracts of cells expressing MJ0977 was ssDNA specific:
no activity was
detected on double-stranded DNA in comparable
reactions at 65°C
relative to the results for cells expressing
the vector alone (data not
shown). Nearly 65% of the ssDNase activity
in extracts of
MJ0977-expressing cells was retained when the reaction
temperature was
raised to 80°C (Fig.
3), demonstrating the thermostability
of the
protein.
As with
E. coli RecJ, the MJ0977-associated nuclease
activity was dependent on the presence of a divalent cation. In
reactions
at 65°C, both Mg
2+ and Mn
2+ are
effective cofactors for MJ0977, with optimal concentrations
of 5 and 1 mM, respectively (Fig.
4C and D). No
activity was detected
when Co
2+, Cu
2+,
Ni
2+, Ca
2+, or Zn
2+ was used as a
cofactor (data not shown). The activity was optimal
in the presence of
5 mM NaCl, and increasing the NaCl concentration
above 10 mM resulted
in a significant loss of activity (Fig.
4B).
The optimal pH for
MJ0977-associated nuclease activity was 6.5
at 65°C (Fig.
4A).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Optimization of nuclease activity on ssDNA in crude
extracts of cells induced for the expression of the MJ0977 product. T7
nuclease assays were performed at 65°C under standard conditions (as
described in Materials and Methods) with noted variations in Tris
buffer pH (measured at 65°C) (A), NaCl concentration (B),
Mg2+ concentration (C), or Mn2+ concentration
in the absence of Mg2+ (D).
|
|
To determine the polarity of degradation, MJ0977 DNase activity was
tested on end-labeled ssDNA substrates approximately 3,000
bases in
length. Protein extracts from strains expressing MJ0977
were efficient
at releasing the terminal nucleotide from 5' ssDNA
ends but not from 3'
ssDNA ends (Fig.
5). Whereas more than
60%
of 5' ends were released by the MJ0977 product after only 10 min,
less than 20% of 3' ends were released in the same interval. This
property of the MJ0977 product is similar to that of
E. coli
RecJ,
which degrades ssDNA processively in a 5'-to-3' direction
(
9;
S. T. Lovett, unpublished results).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5.
DNA end preference of the expressed MJ0977 product.
Values were derived by subtracting the fraction of acid-soluble
radioactivity released by extracts from cells expressing MJ0977 from
that released by extracts from cells containing the vector alone.
Symbols: , 5'-end-labeled ssDNA substrate; , 3'-end-labeled
substrate.
|
|
 |
DISCUSSION |
RecJ-related sequences appear to be especially abundant in
archaeal genomes. Alignments of these diverged archaeal sequences define several groups that share sequence motifs with eubacterial RecJ
exonucleases. We sought to determine which, if any, of these sequences
had functional similarity to RecJ. We have demonstrated that two
sequences from M. jannaschii, MJ0831 and MJ0977, members of
the group with the strongest similarity to eubacterial RecJ sequences,
can partially complement a recJ mutation in E. coli K-12. This result indicates a conservation of function
between these proteins and E. coli RecJ. A third opening
reading frame, MJ1198, yielded complementation too weak to assess its
functional relevance.
The expression of one of the genes, MJ0977, resulted in high levels of
a thermostable ssDNA nuclease activity. This nuclease had many
properties in common with E. coli RecJ (9): it
was highly specific for ssDNA, required Mg2+ or
Mn2+ as a cofactor, and attacked 5' ends with a higher
avidity. Despite overall weak sequence similarity between the MJ0977
product and E. coli RecJ (Table 1), these genetic and
biochemical data support the contention that these proteins are indeed
functionally related.
Failure to achieve complete genetic complementation with MJ0977 or
MJ0831 was not unexpected. Because M. jannaschii is a
thermophilic organism, its proteins may be less apt to function in a
mesophilic organism such as E. coli. In addition, different
biochemical properties, such as a lower affinity for substrate,
catalytic rate, processivity, or a failure to interact properly with
other E. coli proteins, may account for incomplete
functionality in E. coli.
Although both MJ0977 and MJ0831 demonstrated similar abilities to
complement an E. coli recJ mutation, we detected ssDNA
nuclease activity associated only with the expression of MJ0977. A
failure to detect nuclease activity for MJ0831 could have been due to poorer stability in E. coli or to enzymatic requirements not
supplied by our reaction conditions. The two proteins might also differ in their thermostability: if the MJ0831 product is considerably less
thermostable than the MJ0977 product, it might be difficult to detect
over the background of nucleases in E. coli crude extracts. Further purification of the MJ0831-encoded peptide should clarify this issue.
The aspartate, histidine, and arginine residues found in conserved
motifs 1, 2, 3, 4, 6, and 7 of the E. coli RecJ exonuclease have been shown to be important for its biological and biochemical functions (10). Most of these residues are also conserved
among the archaeal groups (Fig. 1). Some of these motifs may define residues that interact with the catalytic divalent metal ion(s) required for phophoesterase activity. In E. coli RecJ,
mutation of the aspartate residues in motifs 1, 3, and 4 results in a
dominant-negative phenotype in vivo and a complete loss of nuclease
activity in vitro (10). In the archaeal proteins, one
aspartate (corresponding to D79 of motif 1 of E. coli RecJ)
has been replaced by histidine and displaced in its position within
motif 1 for groups F, G, and H. The DHH of motif 3 is probably the most
diagnostic of this family of proteins (2) and, accordingly,
all three residues are essential for E. coli RecJ activity
(10). The NP of motif 3A, invariant in the eubacterial RecJ
proteins, is reduced to a single proline or absent in most of the
archaeal sequences, with groups B and D as the exceptions. Motif 5, barely recognizable among some members of group B, is missing or not
recognizable (perhaps reduced to a single lysine or arginine) in the
other groups. Mutations in this motif have not yet been assayed for their impact on the activity of E. coli RecJ exonuclease. In
motif 6, only the arginine is invariant; in E. coli RecJ,
mutation of this residue to alanine results in a complete loss of
exonuclease activity and a recessive mutant phenotype. Although the
glycine richness of motif 7 is conserved among archaeal groups, the
histidine often is not, and the motif is entirely missing in the
methanococcal Ppx1 sequence. This lack of conservation may not be so
surprising, since the mutation of motif 7 histidine to alanine in RecJ
exonuclease produced a somewhat leaky phenotype (10).
Because of the high degree of sequence similarity among E. coli RecJ nuclease, the MJ0977 product, and the products of the group B sequences (Fig. 1B), we think it is likely that all group B
proteins are nucleases for DNA or RNA. Although it is tempting to
speculate, based on sequence similarity, that group C and D proteins
are also nucleases and that group F, G, and H proteins are
phosphatases, further experimentation is required to assign a
biological substrate to these proteins.
 |
ACKNOWLEDGMENTS |
This work was supported by grant RO1 GM43889 from the National
Institutes of Health and by predoctoral training grants T32 GM07122 and
F31 GM19179 to L.A.R.
We thank Steven Sandler of the University of Massachusetts at Amherst
for providing us with M. jannaschii chromosomal DNA.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Rosenstiel Basic
Medical Sciences Research Center, Brandeis University, Waltham, MA 02454-9110. Phone: (781) 736-2487. Fax: (781) 736-2405. E-mail: lovett{at}hydra.rose.brandeis.edu.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Aravind, L., and E. V. Koonin.
1998.
A novel family of predicted phosphoesterases includes Drosophila Prune protein and bacterial RecJ exonuclease.
Trends Biochem. Sci.
23:17-19[CrossRef][Medline].
|
| 3.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[CrossRef][Medline].
|
| 4.
|
Dianov, G.,
B. Sedgwick,
G. Daly,
M. Olsson,
S. Lovett, and T. Lindahl.
1994.
Release of 5'-terminal deoxyribose-phosphate residues from incised abasic sites in DNA by the Escherichia coli RecJ protein.
Nucleic Acids Res.
22:993-998[Abstract/Free Full Text].
|
| 5.
|
Dower, W. J.,
J. F. Miller, and C. W. Ragsdale.
1988.
High efficiency transformation of E. coli by high voltage electroporation.
Nucleic Acids Res.
16:6127-6145[Abstract/Free Full Text].
|
| 6.
|
Grilley, M.,
J. Griffith, and P. Modrich.
1993.
Bidirectional excision in methyl-directed mismatch repair.
J. Biol. Chem.
268:11830-11837[Abstract/Free Full Text].
|
| 7.
|
Hinkle, D. C., and M. J. Chamberlin.
1972.
Studies of the binding of Escherichia coli RNA polymerase to DNA. I. The role of sigma subunit in site selection.
J. Mol. Biol.
70:157-185[CrossRef][Medline].
|
| 8.
|
Lovett, S. T., and A. J. Clark.
1984.
Genetic analysis of the recJ gene of Escherichia coli K-12.
J. Bacteriol.
157:190-196[Abstract/Free Full Text].
|
| 9.
|
Lovett, S. T., and R. D. Kolodner.
1989.
Identification and purification of a single-strand-specific exonuclease encoded by the recJ gene of Escherichia coli.
Proc. Natl. Acad. Sci. USA
86:2627-2631[Abstract/Free Full Text].
|
| 10.
|
Sutera, V. A., Jr.,
E. S. Han,
L. A. Rajman, and S. T. Lovett.
1999.
Mutational analysis of RecJ exonuclease of Escherichia coli: identification of phosphoesterase motifs.
J. Bacteriol.
181:6098-6102[Abstract/Free Full Text].
|
| 11.
|
Viswanathan, M., and S. T. Lovett.
1998.
Single-strand DNA specific exonucleases in Escherichia coli: roles in repair and mutation avoidance.
Genetics
249:7-16.
|
| 12.
|
Wang, R. F., and S. R. Kushner.
1991.
Construction of versatile low-copy vectors for cloning, sequencing and gene expression in Escherichia coli.
Gene
100:195-199[CrossRef][Medline].
|
| 13.
|
Willetts, N. S.,
A. J. Clark, and B Loco.
1969.
Genetic location of certain mutations conferring recombination deficiency in Escherichia coli.
J. Bacteriol.
97:244-249[Abstract/Free Full Text].
|
| 14.
|
Wurst, H., and A. Kornberg.
1994.
A soluble exopolyphophatase of Saccharomyces cerevisiae.
J. Biol. Chem.
269:10996-11001[Abstract/Free Full Text].
|
| 15.
|
Wurst, H.,
T. Shiba, and A. Kornberg.
1995.
The gene for a major exopolyphosphatase of Saccharomyces cerevisiae.
J. Bacteriol.
177:898-906[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2000, p. 607-612, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kickstein, E., Harms, K., Wackernagel, W.
(2007). Deletions of recBCD or recD influence genetic transformation differently and are lethal together with a recJ deletion in Acinetobacter baylyi. Microbiology
153: 2259-2270
[Abstract]
[Full Text]
-
Han, E. S., Cooper, D. L., Persky, N. S., Sutera, V. A. Jr, Whitaker, R. D., Montello, M. L., Lovett, S. T.
(2006). RecJ exonuclease: substrates, products and interaction with SSB. Nucleic Acids Res
34: 1084-1091
[Abstract]
[Full Text]
-
Yamagata, A., Kakuta, Y., Masui, R., Fukuyama, K.
(2002). The crystal structure of exonuclease RecJ bound to Mn2+ ion suggests how its characteristic motifs are involved in exonuclease activity. Proc. Natl. Acad. Sci. USA
99: 5908-5912
[Abstract]
[Full Text]
-
Yamagata, A., Masui, R., Kakuta, Y., Kuramitsu, S., Fukuyama, K.
(2001). Overexpression, purification and characterization of RecJ protein from Thermus thermophilus HB8 and its core domain. Nucleic Acids Res
29: 4617-4624
[Abstract]
[Full Text]
-
Yamagata, A., Kakuta, Y., Masui, R., Fukuyama, K.
(2002). The crystal structure of exonuclease RecJ bound to Mn2+ ion suggests how its characteristic motifs are involved in exonuclease activity. Proc. Natl. Acad. Sci. USA
99: 5908-5912
[Abstract]
[Full Text]