Previous Article | Next Article 
Journal of Bacteriology, February 2000, p. 734-741, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Regulation by Overlapping Promoters of the Rate of
Synthesis and Deposition into Crystalline Inclusions of
Bacillus thuringiensis
-Endotoxins
Mira
Sedlak,
Thomas
Walter, and
Arthur
Aronson*
Department of Biological Sciences, Purdue
University, West Lafayette, Indiana 47907
Received 8 September 1999/Accepted 8 November 1999
 |
ABSTRACT |
During sporulation, Bacillus thuringiensis produces
intracellular, crystalline inclusions comprised of a mixture of
protoxins active on insect larvae. A major class of these protoxin
genes, designated cry1, is transcribed from two overlapping
promoters (BtI and BtII) utilizing RNA polymerase containing
sporulation sigma factors
E and
K,
respectively. Fusions of these promoters to lacZ were
constructed in order to analyze transcription patterns. Mutations
within the
10 region of the BtII promoter (within the spacer region
of the BtI promoter) which departed from the consensus
10 sequence
for either
E or
K resulted in
inactivation of transcription from BtII and a fivefold stimulation of
transcription from BtI. In contrast, transcription from both promoters
was inhibited with a change to the
E consensus. One of
the "promoter-up" mutations was fused to the cry1Ac1
gene, and enhanced transcription was confirmed by Northern blotting.
There was an increase in the accumulation of Cry1Ac antigen at early
but not later times in sporulation in the mutant. This shift was due to
the rapid turnover of much of the excessively accumulated protoxin at
the early times as measured by pulse-chase labeling. As a result of the
turnover and the inactivation of the BtII promoter, the mutant produced
smaller inclusions which contained two- to threefold-less protoxin than
inclusions from the wild type. Promoter overlap is a mechanism for
modulating protoxin synthesis, thus ensuring the efficient packaging of
these protoxins into inclusions.
 |
INTRODUCTION |
Bacillus thuringiensis is
unique in its capacity to produce, primarily during sporulation, large,
intracellular, crystalline inclusions comprised of protoxins active on
insect larvae (4, 20, 38). Most B. thuringiensis
subspecies contain multiple, plasmid-borne protoxin genes (4,
20). Related protoxins are present in the same inclusion, but the
relative amounts differ as determined from steady-state mRNA levels
(3) and protoxin contents (27, 28). Since each of
these toxins has a unique specificity profile, usually for a subset of
insects from within a particular order (20), the presence of
several protoxins in different amounts is important for the overall
toxicity profile of an isolate. There may also be synergistic
interactions between specific toxins (23, 42).
In addition to the differential regulation of the various protoxin
genes, there must be mechanisms to ensure the synthesis of very large
amounts of the protoxins and their orderly deposition into a
crystalline inclusion. The latter process involves extensive intermolecular disulfide cross-linking (9), and there are
probably enzymes to aid this process as well as chaperones and/or
protective proteins (2, 8) for the initial assembly process.
A very abundant class of protoxin genes designated cry1 all
have very similar overlapping promoters, designated BtI and BtII, which
function primarily at different times during sporulation (2, 8,
20). Transcription from the former is dependent upon a form of
RNA polymerase containing a sigma factor with 88% identity to
Bacillus subtilis
E, whereas transcription
from BtII utilizes a sigma factor with 85% identity to
K from B. subtilis (1).
In B. subtilis, these sigma factors are necessary for the
transcription of sporulation genes expressed in the mother cell (15, 26). There are examples of tandem promoters in
sporulating B. subtilis cells which ensure extended
transcription during sporulation (17) or during both growth
and sporulation (12, 13). A few sporulation genes contain
overlapping promoters (21, 43), but the significance, if
any, of such an arrangement has not been studied. In B. thuringiensis,
E and
K must function
for the transcription of mother cell sporulation genes as well as for
the protoxin genes, a conclusion supported by in vitro studies
(1).
Since this prevalent class of cry1 protoxin genes contains
two promoters that overlap, the function of such a unique arrangement in regulation was examined by constructing fusions of wild-type and
mutated promoter regions to lacZ. Mutations of the
10
region of the BtII promoter (within the spacer region of the BtI
promoter) which departed from the consensus sequence resulted in
stimulation of transcription from BtI, indicating a modulating function
for this promoter arrangement. This regulation was critical for the rate of accumulation of protoxins and ultimately their deposition in an inclusion.
 |
MATERIALS AND METHODS |
Bacterial strains and growth.
Escherichia coli DH5
was the host for plasmid constructs, and E. coli CJ236 was
the host for the preparation of uracil-containing DNA and for the
propagation of helper phage R408 (Promega). B. thuringiensis
strain 80-21 was used for the introduction of the lacZ
fusions by electroporation (39). This strain had
spontaneously lost the 44-mDa plasmid containing the cry1Ab3
gene from Bacillus thuringiensis subsp. kurstaki
HD1 but still contained the cry1Aa1, cry1Ac1,
cry2Aa1, and cry2Ab1 genes (5).
B. thuringiensis subsp. kurstaki HD73 contains
only the cry1Ac1 gene and was used for reverse transcriptase mapping.
A clone of the cry1Ac1 gene in pHT3101 (3, 24)
was electroporated into strain CryB (an acrystalliferous, plasmid-cured derivative of B. thuringiensis subsp. kurstaki
HD1) (41) to form strain CryB/pHT3101-1Acwt (wild
type). CryB/pHT3101 was the control strain. The 242-bp NsiI
promoter fragment from mutant 272 (see below) was cloned into
pHT3101-1Acwt which had been digested with NsiI
to remove the wild-type promoters. The resulting plasmid, pHT3101-1Ac272, contained the mutant promoters as
demonstrated by the additional SpeI site (see below). The
orientation of the promoters was established by digestion with
HpaI, and the promoter region was sequenced to confirm the
construct. This plasmid was also electroporated into strain CryB to
create CryB/pHT3101-1Ac272.
E. coli was grown at 37°C in Luria-Bertani medium
(
35) with 50 µg of ampicillin per ml for selection.
B. thuringiensis strains
were grown at 30°C in G-Tris
medium (
6). This medium was supplemented
with 7 µg of
chloramphenicol per ml for selection of cells containing
lacZ fusions and 10 µg of erythromycin per ml for those
containing
the
cry1Ac1 clones. Growth was monitored in a
Klett colorimeter
(660-nm-wavelength filter). Cells clump at the end of
growth (
T0)
due to the accumulation of organic
acids in the medium, and phase-dull
endospores are usually visible
about 3 h later (
T3), with phase-white
endospores present 2 to 3 h after this time
(
T6).
Plasmid constructs.
A 242-bp NsiI fragment
extending from nucleotides
150 to +91 relative to the start site of
transcription for BtI contained the promoter region of the
cry1Ab3 gene (7). This fragment was cloned into
the NsiI site in plasmid pGEM-llZf(+) from Promega (Fig.
1) for site-directed mutagenesis
(36). It should be noted that this region of the
cry1Ab3 gene is identical in sequence to that of the
cry1Ac1 gene (M. Geiser, personal communication). The latter
was chosen for measuring protoxin synthesis because the protoxin is
more stable (31). The 251-bp
XbaI/HindIII fragment from this clone was
also subcloned into M13 for mutagenesis. Single-stranded DNA was
produced in E. coli CJ236 with helper phage R408 (Promega) for pGEM. The
10 region of each promoter was mutagenized by employing gel-purified and phosphorylated primer 271 (3'TACTCAGTCGACACAATTTAAC) for BtI and primer 272 (3'TAAAAAAGGCTTCTGATCAGTATA) for BtII by using pGEM. The
following primers were all used with M13: primer 1076 (3'CGTAAAAAAGTACTCTACTCAGTA) for BtII, primer 1077 (3'CGTAAAAAAGTATGTTACTCAGTA) for BtII, and primer 1078 (3'GTATTCTACTGAGTATACAA) and primer 1079 (3'CGTAAAATAGTATTCTAC) for changes in the BtI spacer outside of the
10 region. The mutations are summarized in Table
1.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of an E. coli-B. thuringiensis
shuttle vector with a fragment containing the cry1A BtI and
BtII promoters inserted upstream of the lacZ gene. See
Materials and Methods for further discussion. Letters for pSGMU37 are
restriction enzyme sites as described previously (14).
|
|
Twelve nanomoles of single-stranded DNA template was mixed with 32 pmol
of each of the mutagenic primers and 3.5 pmol of each
of the M13
primers. Following incubation at 80°C for 5 min and
cooling to 27°C
for 20 min, 4 U of Klenow fragment and 5 U of
T4 DNA ligase were added
for 20 h at 16°C. The DNA was precipitated
with 2 volumes of
ethanol and dissolved in 5 µl of Tris-EDTA (TE)
buffer for
transformation of
E. coli DH5

. Clones with the desired
mutations were identified by the introduction of unique restriction
sites for the primer 271 (
PvuII), 272 (
SpeI), and
1076 (
BspHI)
oligonucleotide-primed reactions. All of the
mutated promoters
were sequenced (
37) to verify the changes
as shown in Table
1 and Fig.
2.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Sequence of the region upstream of the
cry1Acl gene from the NsiI site to the ATG
initiation codon. The 10 and 35 regions of the dual overlapping
promoters are singly (BtI) or doubly (BtII) underlined, with the base
substitutions in the 10 regions for the 271 (BtI) and 272 (BtII)
oligonucleotides indicated below each. The start sites of transcription
are marked (I and II), and the ribosome binding site is overlined. The
sequence of an additional 900 bp upstream of the cry1A genes
is available (GenBank accession number AF039908).
|
|
The 251-bp
HindIII/
XbaI wild-type and mutant
promoter regions were excised and purified from low-melting-point
agarose with
GELase TM (Epicentre Technologies). These fragments were
then
subcloned into pSGMU37 (Fig.
1), a vector containing a
promoterless
lacZ gene (
15). An
E. coli-B.
thuringiensis shuttle vector containing
the
promoter-
lacZ fusions was then constructed by ligating
purified
HindIII/
BglII fragments from
pSGMU37-P and pHT to form pHT/pSGMU-P.
Plasmid pHT is a shuttle vector
consisting of plasmid pBD12 (from
a gram-positive organism) with a
nonessential
PvuII fragment deleted
(
19) ligated
to
PvuII-digested pUC18 (H. Tsai and A. Aronson,
unpublished
results).
Enzyme assays and primer extension.
B. thuringiensis
strains containing lacZ fusions were grown at 30°C in
G-Tris plus 7 µg of chloramphenicol per ml. The optical density was
monitored (Klett colorimeter with a 660-nm-wavelength filter), and 1-ml
samples were removed periodically during growth and sporulation. Stages
of sporulation were monitored in the phase microscope and the percent
phase-white endospores was recorded. Cells were pelleted by
centrifugation for 5 min in an Eppendorf microcentrifuge, and the
pellets were frozen at
70°C. Samples were thawed and assayed in
duplicate for
-galactosidase (18), and the average values
(+/
6%) are reported as Miller units (30).
RNA was prepared (
7) at various times during sporulation
from cells grown as described above. For primer extension of promoters
fused to
lacZ, a 19-mer (3'CGGCGTAGATCTCAGCTGG)
complementary
to nucleotides 34 to 52 in the
lacZ gene
was purified on a Sephadex
G-25 column. Oligonucleotide
5'GGTTACTTAAACAATTATAAGG (complementary
to nucleotides 34 to
55 in the
cry1Ac1 gene) was used for primer
extension of
cry1Ac1 RNA from strain 80-21 and
B. thuringiensis subsp.
kurstaki HD73. The
oligonucleotides were labeled with [
32P]ATP (6,000 Ci
mmol
1) using T4 polynucleotide kinase (
36).
The labeled primers were
mixed with 30 µg of RNA, annealed at 37°C,
and extended with reverse
transcriptase (
16,
36). These
primers were also used for the
sequencing
reactions.
For Northern hybridizations (
36), 20 µg of RNA was
electrophoresed in a sodium dodecyl sulfate (SDS)-6% polyacrylamide
gel.
The gel was examined under UV light to establish that the 16S
and
23S rRNAs were intact. The RNA was then transferred to a polyvinylidene
difluoride membrane and hybridized with a
32P-oligonucleotide specific to the
cry1Ac1 gene
(
3), 5'TACCCCAATTAACGTTGAGGTGAATCGGGG
(nucleotides 1609 to 1638 from the ATG codon of
cry1Ac1). Following
washing and exposure to an X-ray film,
the oligonucleotide was
scanned in a
phosphorimager.
Measurements of protoxin synthesis.
Strains CryB/pHT3101,
CryB/pHT3101-1Acwt, and CryB/pHT3101-1Ac272 were
grown at 30°C in 30 ml of G-Tris medium in a New Brunswick shaker. As
mentioned above, a marker for the commencement of sporulation is cell
clumping, so 5-ml samples were removed approximately 1 h prior to
this time, 1 h later, and at two subsequent times during sporulation (as monitored with the phase microscope). The remainder of
the culture was incubated for 24 h in order to obtain free spores
and inclusions.
The cells were washed once with 1 M KCl-5 mM EDTA, pH 8.0, and twice
with 50 mM Tris-5 mM EDTA-2 mM phenylmethylsulfonyl fluoride,
pH 7.6. The pellets were suspended in 6 M urea-1% SDS 2 mM
phenylmethylsulfonyl
fluoride-50 mM dithiothreitol, pH 9.6 (UDS),
sonicated (Branson
45 with a microtip) for 40 s, and then heated
to 90°C for 3 min.
Aliquots of the cell extracts were precipitated
with 10% trichloroacetic
acid. The pellets were dissolved in 0.2 ml of
0.2 N NaOH for protein
determinations with the bicinchoninic acid
reagent (Pierce Chemical
Co.).
Spores plus inclusions from the 24-h cultures were harvested, washed as
described above, resuspended in 2 ml of deionized
water, and sonicated
for 12 s to remove clumps. A 0.2-ml sample
was taken, and
following centrifugation for 5 min in an Eppendorf
microcentrifuge, the
pellet was extracted twice with 40 µl of
UDS at 37°C for 20 min
each time and the supernatants were
pooled.
A trace amount of purified
14C-inclusions (5,000 cpm) was
added to the remaining spore-plus-inclusion suspensions in order to
monitor inclusion recovery. The labeled inclusions were prepared
by
incubating 10 ml of sporulating cells with 5 µCi of
[
14C]isoleucine until sporulation was completed. These
inclusions
were purified as described
below.
The suspensions were layered on step gradients of Renografin-76 (66%
diatrizoate meglumine plus 10% diatrizoate sodium; Squibb)
comprised
of 1 ml of 60% and 3 ml each of 50 and 40% Renografin.
The tubes were
centrifuged for 1 h at 8,000 rpm in a Sorvall HB4
swinging-bucket
rotor. The band of inclusions was removed with
a syringe, diluted
10-fold with water, and collected by centrifugation
at 10,000 rpm for
20 min in a Sorvall centrifuge. The pellets
were examined in the phase
microscope for spore contamination
and recentrifuged through a second
Renografin gradient if >5%
of the initial spores were present.
Samples of purified inclusions
from the wild type, the mutant, and a
mixture were photographed
with a Nikon Eclipse phase microscope using
the oil immersion
objective (2,000×). Digital images were converted
with Adobe Photoshop
and
printed.
The purified inclusions were dissolved in 50 µl of UDS by incubation
for 10 min at 37°C. This step was repeated, and 10 µl
of the pooled
supernatants was precipitated with 10% trichloroacetic
acid. The
precipitates were collected on Whatman glass fiber filters,
and the
radioactivity was determined in a Beckman scintillation
counter.
Fifty micrograms of cell extract protein, the extract from an equal
volume of the spore-inclusion mixture, or an equal quantity
of counts
per minute from the purified inclusions (indicative
of inclusion
recovery) was diluted in UDS, heated at 90°C for
3 min, and
electrophoresed in SDS-10% polyacrylamide. Immunoblotting
was done as
described previously by employing a Cry1Ac1 polyclonal
antibody
(
32). Staining was done with the Pierce Gelcode blue
stain
reagent.
The stability of the Cry1Ac1 protoxin antigen was determined in
pulse-chase experiments. Five milliliters from a 30-ml culture
grown as
described above was removed when the cells started to
clump and at
hourly intervals thereafter (five total samples).
These subcultures
were incubated with 5 µCi of [
14C]isoleucine for 7 min.
At that time, a 2-ml sample was pipetted
into a tube on ice containing
1 mg of chloramphenicol. Unlabeled
isoleucine was added to 200 µg/ml
to the remaining culture, which
was sampled as described above after an
additional 60 min of incubation.
Following centrifugation at 10,000 rpm
for 10 min in a Sorvall
SS34 rotor, the pellets were washed twice with
10 ml (each time)
of 0.05 M Tris-0.15 M NaCl-1.0% Nonidet P-40 (pH
8.0), suspended
in 0.8 ml of this buffer, and sonicated on ice three
times for
40 s each time. The suspensions were centrifuged for 2 min in
an Eppendorf microcentrifuge and the supernatants were stored
at

70°C. This pulse-chase protocol was repeated at hourly intervals
for at least four additional
hours.
The radioactive and protein contents of aliquots of each sample were
determined, and 150 µg of protein was incubated at 0°C
for 1 h
with preimmune serum plus 2 µg of purified, unlabeled
Cry1Ac1
protoxin. A 50% suspension of protein A-Sepharose CL4B
(Pharmacia) was
added to 25% of the volume, and the suspensions
were incubated at
4°C for 40 min. Following centrifugation for
2 min in an Eppendorf
microcentrifuge, the supernatants were carefully
removed and
anti-Cry1Ac1 antibody (
32) was added followed by
protein
A-Sepharose CL4B as described above. These suspensions
were
centrifuged, and the pellets were washed three times with
0.2 ml of the
above buffer each time. The final pellets were suspended
in 50 µl of
UDS and heated at 90°C for 3 min, and one-half was
electrophoresed by
SDS-10% PAGE. The gels were dried and exposed
to X-ray film and the
130-kDa bands were quantitated in a
phosphorimager.
 |
RESULTS |
Transcription patterns.
Initially, the transcription pattern
of the cry1Ac1 gene in a strain (80-21) which contained this
gene as one of several protoxin genes (5) and in a strain in
which this was the only protoxin gene (B. thuringiensis
subsp. kurstaki HD73) was established by reverse
transcriptase mapping (Fig. 3). The
results confirmed the reverse transcriptase mapping of the
cry1Ba1 gene (11) in that there was transcription
from both BtI and BtII at different although somewhat overlapping times
and to approximately the same extent. A fairly constant rate of
transcription starting at T2 and continuing
throughout much of sporulation was also found with the fusion of the
wild-type cry1A promoters to lacZ (Fig.
4).

View larger version (84K):
[in this window]
[in a new window]
|
FIG. 3.
Reverse transcriptase mapping of the transcription of
the cry1Ac1 gene in strain 80-21 (A) and B. thuringiensis subsp. kurstaki HD73 (B). In both cases,
transcription from BtI started at about T2 and
sporulation was completed 11 to 12 h after
T0.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4.
-Galactosidase synthesis in B. thuringiensis 80-21 containing plasmids with the cry1A
gene promoter region fused to lacZ. The fusions contained
the wild-type promoter ( ), the 272 mutant BtII promoter ( ), and
the 271 mutant BtI promoter ( ). The cells were grown and sporulated
in G-Tris medium plus 7 µg of chloramphenicol per ml and sampled as
described in Materials and Methods. In all cases, exponential growth
ended at about 10 h.
|
|
Mutagenesis of the promoter region.
Initially, each of the
promoters was inactivated by introducing several mutations into
conserved bases in the
10 regions (mutations 271 and 272 [Table 1;
Fig. 2]). Loss of promoter function was determined by reverse
transcriptase mapping using RNA prepared from sporulating cells of
strain 80-21 transformed with each of the lacZ fusion
plasmids (Fig. 5). At the sampling time
for the wild type, there was a strong transcript initiating at BtI and a weaker one at BtII. There was also a transcript initiating 14 bp
downstream from BtI which was not seen in the reverse transcriptase mapping of the cry1Ac1 gene (Fig. 3) or in the mutant 271 and 272 lanes. The lack of transcription from the BtII promoter in mutant 272 was confirmed by sampling at several times later in sporulation. There was a weak transcript from the BtI promoter with RNA
prepared from the 271 mutant which was not enhanced by sampling at
earlier times in sporulation (data not shown).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 5.
Reverse transcriptase mapping of the start sites of
transcription from the wild-type (Wt) and mutant (271 and 272)
promoters in plasmid pHT/pSGMU-P in B. thuringiensis 80-21. The start sites for BtI and BtII are shown on the right. The Wt RNA was
prepared from cells at the equivalent of 14 to 15 h in Fig. 4, the
RNA for the 271 lane was prepared from cells at the equivalent of 16 to
17 h in Fig. 4, and the RNA for the 272 lanes (separate gel) was
prepared from cells at the equivalent of 16 and 17 h in Fig. 4.
All of the sequencing lanes are in the order AGCT as indicated in the
panel on the right side. Note that these sequencing lanes start six
bases lower than the Wt and 271 sequencing lanes and that this sequence
is compressed at the top.
|
|
Similar reverse transcriptase mapping was done with the other mutants
listed in Table
1. Transcription from both promoters
in mutants 1077, 1078, and 1079 was established by preparing RNA
at
T3 and
T6. Transcription
was barely detectable in mutant 1077
even with five times more
RNA.
As previously mentioned, strain 80-21, containing a fusion of the
wild-type promoters to
lacZ, synthesized

-galactosidase
over about 10 h commencing at
T2 of
sporulation (Fig.
4). Expression
from a construct containing only a
functional BtII promoter (mutation
271) began later and at a slightly
lower rate. The rates at very
late times were somewhat variable because
of sporulation asynchrony
and lysis of sporulated cells with the
subsequent inactivation
of the

-galactosidase.
Mutation within the

10 region of the BtII promoter (mutation 272)
resulted in a ca. fivefold increase in both the initial
rate and final
amount of

-galactosidase. This stimulation was
confirmed by making a
single mutation within the

10 region of
BtII which inactivated this
promoter (mutation 1076 [Table
1]).
Both the 272 and 1076 mutations
resulted in further deviations
from the
B. subtilis 
10
consensus sequence for
K (and
E) (Table
1). When the

10 region was changed to the
E consensus
(mutation 1077), there was transcription from both
promoters but at a
greatly reduced rate. Single base pair changes
within the spacer region
but outside the BtII

10 sequence (mutations
1078 and 1079) had no
effect (Table
1).
Effect of a promoter-up mutation on mRNA and protoxin
accumulation.
The cry1Ac1 gene containing the 272 promoter-up mutation was cloned and electroporated into strain CryB.
Early in sporulation (equivalent to about 13 h in Fig. 4), there
was 2.2-fold more cry1Ac1 mRNA in this strain than in a
strain containing the cry1Ac1 gene with the wild-type
promoters (CryB/pHT3101-1Acwt) (Fig.
6). At a later time (>70% phase-white
endospores; equivalent to 18-20 h in Fig. 4), there was 30% less
cry1Ac1 mRNA in the mutant. This decrease was due to the
lack of transcription from the BtII promoter and decay of the
earlier-transcribed mRNA.

View larger version (76K):
[in this window]
[in a new window]
|
FIG. 6.
Northern hybridizations of 20 µg of RNA prepared from
CryB/pHT3101-1Acwt (lanes 1 and 4) and
CryB/pHT3101-1Ac272 (lanes 2 and 3) at
T2.5 (lanes 1 and 2) and
T6 (lanes 3 and 4) of sporulation. Hybridization
and quantitation of both bands were done as described in Materials and
Methods. The upper bands in each lane are the expected size for
cry1Ac1 mRNA; the lower, less prevalent bands are apparently
stable degradation products.
|
|
The accumulation of Cry1Ac antigen in sporulating cells was determined
over a 3-h period from about hour 13 to 16 in Fig.
4, when there was
transcription from the BtI promoter. There was
2.5 times more antigen
in the mutant than the wild type at the
first sampling time and about
40% more 90 min later; the values
were about equal after an additional
90 min (Fig.
7A).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 7.
(A) Immunoblot of cell extracts of strains
CryB/pHT3101-1Acwt (lanes 1 to 3) and
CryB/pHT3101-1Ac272 (lanes 4 to 6) sampled at
T1.5 (lanes 1 and 4),
T3.0 (lanes 2 and 5), and
T4.5 (lanes 3 and 6). Electrophoresis and
treatment with a Cry1Ac antibody were done as described in Materials
and Methods. (B) Stained SDS-10% PAGE of crude spore-inclusion
mixtures (lanes 1 and 2) and of purified inclusions (lanes 3 and 4)
from CryB/pHT3101-1Acwt (lanes 1 and 3) and
CryB/pHT3101-1Ac272 (lanes 2 and 4). Standards (STD), from
top to bottom, are 116, 97, 66, 45, and 29 kDa.
|
|
Following completion of sporulation, protoxin was extracted from the
spore-plus-inclusion mixtures and from purified inclusions.
The amount
of protoxin antigen in spore-plus-inclusion extracts
from the mutant
was 50% higher than that in extracts from the
wild type, but the
amount in purified inclusions was 2.5-fold
less (Fig.
7B). On the
whole, inclusions produced by CryB/pHT3101-
1Ac272 were much
smaller than those produced by strain CryB/pHT3101-
1Acwt (Fig.
8B and C).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 8.
Phase-contrast micrographs of purified inclusions from a
mixture (A), CryB/pHT3101-1Ac272 (B), and
CryB/pHT3101-1Acwt (C), examined with oil immersion
(2,000×) with an additional ×2.5 magnification when photographed.
Panel A shows three inclusions from the wild type with three from the
mutant immediately adjacent.
|
|
Despite the hyperactivity of the BtI promoter in the mutant, there was
an impairment in protoxin accumulation, especially
in inclusions. Since
both transcription and translation of the
cry1Ac1 gene were
enhanced in the mutant at early times, the lack
of protoxin
accumulation was most likely due to turnover. This
possibility was
examined by pulse-chase immunoprecipitation experiments
as described in
Materials and Methods (Fig.
9). There was
a twofold-enhanced
synthesis of
14C-Cry1Ac protoxin in the
mutant during the earliest 7-min labeling,
consistent with the protoxin
antigen accumulation results in Fig.
7. In the mutant, however, almost
all of the protoxin turned over,
in contrast to its stability in the
wild type (Fig.
9, compare
lanes 1 and 2 with lanes 7 and 8). Even an
hour later, at least
half the
14C-protoxin in the mutant
was unstable. This unstable fraction
decreased over an additional
3 h until the switch in transcription
from BtI to BtII. At this
time, there was very little additional
synthesis of protoxin in the
mutant.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 9.
Autoradiogram of SDS-PAGE of immunoprecipitated Cry1Ac
antigen from CryB/pHT3101-1Acwt (lanes 1 to 4) and
CryB/pHT3101-1Ac272 (lanes 7 to 10) from a pulse-chase
experiment (see Materials and Methods). Five-milliliter aliquots of the
cultures were removed and incubated with
[14C]isoleucine for 7 min at clumping (about
T0.5) (lanes 1 and 7) and then chased with an
excess of [12C]isoleucine for 1 h (lanes 2 and 8).
At this time (T1.5), another 5-ml sample of
cells was incubated with [14C]isoleucine for 7 min (lanes
3 and 9) and chased (lanes 4 and 10). Lanes 5 and 6 contained extracts,
like lanes 1 and 2, but they were treated only with preimmune serum.
|
|
 |
DISCUSSION |
Fusions of the cry1A gene promoters to lacZ
were used to establish the pattern of transcription of this class of
protoxin genes. The timing and relative transcription from each of the cry1Ac1 promoters (Fig. 3) were independent of the presence
of other cry1A genes and consistent with the reverse
transcriptase mapping results obtained with the cry1Ba1 gene
(11).
The
10 region of the BtII promoter within the spacer region of the
BtI promoter is critical for regulation. Mutations which departed from
the consensus
E or
K sequence resulted in
stimulation of transcription (Fig. 4 and 6; Table 1), whereas a change
to the
E consensus was inhibitory (mutation 1077 [Table
1]). These results imply that
E or some form of RNA
polymerase containing this subunit is involved in the regulation.
Transcription from BtI occurs primarily before there is functional
K (although pro-
K may be present), so
this sigma subunit is unlikely to be involved. In addition,
transcription of the cry1Aa1 gene in a strain lacking
K was unaltered at early times, with no evidence for
enhanced expression (10). Unproductive binding of
E RNA polymerase to the BtII promoter could modulate
transcription from BtI.
In general, promoter function is most severely affected by mutations in
the
10 and
35 regions, but some within the spacer region which
alter promoter bending (35) or perhaps other properties, such as conformation (29, 35, 45), can be detrimental.
Promoter-up mutations in this region are rare, although a regulatory
region analogous to the one described here is present in the spacer
region of a DNA replication gene promoter in Caulobacter
(46). While the sequence of this regulatory region was very
similar to that of the
10 region, there was no evidence for
overlapping promoters.
Related protoxins (such as the Cry1 types) are packaged into single
inclusions (3). The packaging involves extensive
intermolecular disulfide bond formation (9), so
rate-limiting steps involving chaperones (2, 8) and
disulfide interchange reactions (9) are likely. In such a
multistep assembly process, efficient packaging over a prolonged time
during sporulation may depend upon a mechanism for controlling the rate
of protoxin synthesis. The results reported here indicate that this
control can be achieved by the overlap of two mother cell sporulation
promoters. Additional regulatory mechanisms are required for the
differential transcription of the multiple protoxin genes
(44) and to balance protoxin synthesis with that of mother
cell spore components.
While there is a small amount of transcription of some cry
genes at the end of growth (8, 47), most synthesis does not occur until stage II of sporulation, when
E RNA
polymerase becomes functional. Parenthetically, this timing coincides
with the conditions necessary for inclusion assembly. Toxins active on
Lepidoptera and Diptera form inclusions consisting of protoxins
cross-linked by disulfide bonds and thus require the more oxidative
conditions found in sporulating cells (40). In contrast,
inclusions comprised of the Cry3Aa1 protoxin probably do not contain
disulfide bonds (2), and this protoxin is readily solubilized at a lower pH in the absence of a reducing agent
(reflecting conditions in the midgut of susceptible coleopteran
larvae). Transcription of this gene is not dependent upon sporulation,
and there is a novel
A-like promoter which functions in
late exponential-phase cells (2). Differences in the time of
expression of protoxin genes may in part reflect the intracellular
conditions needed for inclusion assembly.
It was possible to substantially increase the size of inclusions
comprised of the Cry3Aa1 toxin either by expressing a cloned gene in a
spo0A deletion strain (25) or by using a hybrid
promoter (34). In the latter case, a 12.7-fold enhancement
of Cry3Aa1 protein accumulation over that of the wild-type strain was
found, but the toxicities were comparable. Apparently, these large
inclusions either were not readily ingested or were not solubilized. In
contrast, only a twofold increase in total Cry1 protoxin was obtained
by introducing an additional gene, cry1Ca1, into the
chromosome of B. thuringiensis subsp. kurstaki
HD73 (22). The regulated expression of the cry1
genes by overlapping promoters as well as other regulatory steps in
inclusion assembly could account for the less extensive enhancement of
Cry1 protoxin accumulation.
 |
ACKNOWLEDGMENTS |
This research was supported by Public Health Service grant
GM34035 from the National Institutes of Health and grant MCB-9600584 from the National Science Foundation.
The technical assistance of Lan Wu is appreciated. Dr. Chris Staiger
was most helpful with the phase microscopy.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biological Sciences, Purdue University, West Lafayette, IN 47907. Phone: (765) 494-4992. Fax: (765) 494-0876. E-mail:
aaronson{at}bilbo.bio.purdue.edu.
Present address: Laboratory of Renewable Research Engineering,
Purdue University, West Lafayette, IN 47907.
 |
REFERENCES |
| 1.
|
Adams, L. F.,
K. I. Brown, and H. R. Whiteley.
1991.
Molecular cloning and characterization of two genes encoding sigma factors that direct transcription from a Bacillus thuringiensis crystal protein gene promoter.
J. Bacteriol.
173:3846-3854[Abstract/Free Full Text].
|
| 2.
|
Agaisse, H., and D. Lereclus.
1995.
How does Bacillus thuringiensis produce so much insecticidal crystal protein?
J. Bacteriol.
177:6027-6032[Free Full Text].
|
| 3.
|
Aronson, A.
1995.
The protoxin composition of Bacillus thuringiensis insecticidal inclusions affects solubility and toxicity.
Appl. Environ. Microbiol.
61:4057-4060[Abstract].
|
| 4.
|
Aronson, A. I.
1993.
The two faces of Bacillus thuringiensis: insecticidal proteins and post-exponential survival.
Mol. Microbiol.
7:489-496[CrossRef][Medline].
|
| 5.
|
Aronson, A. I.
1994.
Flexibility in the protoxin composition of Bacillus thuringiensis.
FEMS Microbiol. Lett.
117:21-28[CrossRef][Medline].
|
| 6.
|
Aronson, A. I.,
N. Angelo, and S. C. Holt.
1971.
Regulation of extracellular protease production in Bacillus cereus T: characterization of mutants producing altered amounts of protease.
J. Bacteriol.
106:1016-1025[Abstract/Free Full Text].
|
| 7.
|
Arvidson, H.,
P. E. Dunn,
S. Strnad, and A. I. Aronson.
1989.
Specificity of Bacillus thuringiensis for lepidopteran larvae: factors involved in vivo and in the structure of a purified protein.
Mol. Microbiol.
3:1533-1543[CrossRef][Medline].
|
| 8.
|
Baum, J. A., and T. Malvar.
1995.
Regulation of insecticidal crystal protein production in Bacillus thuringiensis.
Mol. Microbiol.
18:1-12[CrossRef][Medline].
|
| 9.
|
Bietlot, H. P. L.,
J. Vishmulhatla,
P. R. Carey,
M. Pozsgay, and H. Kaplan.
1990.
Characterization of the cysteine residues and disulphide linkages in the protein crystal of Bacillus thuringiensis.
Biochem. J.
267:309-315[Medline].
|
| 10.
|
Bravo, A.,
H. Agaisse,
S. Salamitou, and D. Lereclus.
1996.
Analysis of cry1Aa expression in sigE and sigK mutants of Bacillus thuringiensis.
Mol. Gen. Genet.
250:734-741[Medline].
|
| 11.
|
Brizzard, B. L.,
H. E. Schnepf, and J. W. Kronstad.
1991.
Expression of the cry1B crystal protein gene of Bacillus thuringiensis.
Mol. Gen. Genet.
231:59-64[CrossRef][Medline].
|
| 12.
|
Carter, H. L., III,
L.-F. Wang,
R. H. Doi, and C. P. Moran, Jr.
1988.
rpoD operon promoter used by H-RNA polymerase in Bacillus subtilis.
J. Bacteriol.
170:1617-1621[Abstract/Free Full Text].
|
| 13.
|
Chibazakura, T.,
F. Kawamura, and H. Takahashi.
1991.
Differential regulation of spo0A transcription in Bacillus subtilis: glucose represses promoter switching at the initiation of sporulation.
J. Bacteriol.
173:2625-2632[Abstract/Free Full Text].
|
| 14.
|
Errington, J.
1986.
A general method for fusion of the Escherichia coli lacZ gene to chromosomal genes in Bacillus subtilis.
J. Gen. Microbiol.
132:2953-2966[Abstract/Free Full Text].
|
| 15.
|
Errington, J.
1993.
Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis.
Microbiol. Rev.
57:1-33[Abstract/Free Full Text].
|
| 16.
|
Ferrari, E.,
D. J. Henner,
M. Perego, and J. A. Hoch.
1988.
Transcription of Bacillus subtilis subtilisin and expression of subtilisin in sporulating mutants.
J. Bacteriol.
170:289-295[Abstract/Free Full Text].
|
| 17.
|
Foulger, D., and J. Errington.
1991.
Sequential activation of dual promoters by different sigma factors maintains spoVJ expression during successive developmental stages of Bacillus subtilis.
Mol. Microbiol.
5:1363-1373[CrossRef][Medline].
|
| 18.
|
Giacomini, A.,
V. Corich,
F. J. Ollero,
H. Squarlini, and M. P. Nuti.
1992.
Experimental conditions may affect reproducibility of the -galactosidase assay.
FEMS Microbiol. Lett.
100:87-90[CrossRef].
|
| 19.
|
Gryczan, T.,
A. G. Shivakumar, and D. Dubnau.
1980.
Characterization of chimeric plasmid cloning vehicles in Bacillus subtilis.
J. Bacteriol.
141:246-253[Abstract/Free Full Text].
|
| 20.
|
Höfte, H., and H. R. Whiteley.
1989.
Insecticidal crystal proteins of Bacillus thuringiensis.
Microbiol. Rev.
53:242-255[Abstract/Free Full Text].
|
| 21.
|
Johnson, C. W.,
C. P. Moran, Jr., and R. Losick.
1983.
Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene.
Nature
302:800-804[CrossRef][Medline].
|
| 22.
|
Kalman, S.,
K. L. Kiehne,
N. Cooper,
M. S. Reynoso, and T. Yamamoto.
1995.
Enhanced production of insecticidal proteins in Bacillus thuringiensis strains carrying an additional crystal protein gene in their chromosome.
Appl. Environ. Microbiol.
61:3063-3068[Abstract].
|
| 23.
|
Lee, M. K.,
A. Curtiss,
E. Alcantara, and D. H. Dean.
1996.
Synergistic effect of the Bacillus thuringiensis toxins CryIAa and CryIAc on the gypsy moth, Lymantria dispar.
Appl. Environ. Microbiol.
62:583-586[Abstract].
|
| 24.
|
Lereclus, D.,
O. Arantes,
J. Chaufaux, and M.-M. Lecadet.
1989.
Transformation and expression of a cloned -endotoxin gene in Bacillus thuringiensis.
FEMS Microbiol. Lett.
60:211-218[CrossRef].
|
| 25.
|
Lereclus, D.,
H. Agaisse,
M. Gominet, and J. Chaufaux.
1995.
Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis Spo0A mutant.
Bio/Technology
13:67-71[CrossRef][Medline].
|
| 26.
|
Losick, R., and P. J. Stragier.
1992.
Crisscross regulation of cell-type specific gene expression during development in Bacillus subtilis.
Nature
355:601-604[CrossRef][Medline].
|
| 27.
|
Masson, L.,
G. Prefontaine,
L. Peloquin, and P. C. K. Lau.
1989.
Comparative analysis of the individual protoxin constituents in P1 crystals of Bacillus thuringiensis subsp. kurstaki isolates NRD12 and HD1.
Biochem. J.
269:507-512.
|
| 28.
|
Masson, L.,
M. Erlandson,
M. Puzstai-Carey,
R. Brousseau,
V. Juarez-Perez, and R. Frutos.
1998.
A holistic approach for determining the entomopathogenic potential of Bacillus thuringiensis strains.
Appl. Environ. Microbiol.
64:4782-4788[Abstract/Free Full Text].
|
| 29.
|
Mellies, J.,
R. Brems, and M. Villarejo.
1994.
The Escherichia coli proU promoter element and its contribution to osmotically signaled transcription activation.
J. Bacteriol.
176:3638-3645[Abstract/Free Full Text].
|
| 30.
|
Miller, J. H.
1972.
Experiments in molecular genetics, p. 352-355.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 31.
|
Minnich, S. A., and A. I. Aronson.
1984.
Regulation of protoxin synthesis in Bacillus thuringiensis.
J. Bacteriol.
158:447-454[Abstract/Free Full Text].
|
| 32.
|
Mohammed, S. I.,
D. E. Johnson, and A. I. Aronson.
1996.
Altered binding of the Cry1Ac toxin to larval membranes but not to the toxin-binding protein in Plodia interpunctella selected for resistance to different Bacillus thuringiensis isolates.
Appl. Environ. Microbiol.
62:4168-4173[Abstract].
|
| 33.
|
Moran, C. P., Jr.
1993.
RNA polymerase and transcription factors, p. 653-667.
In
A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and other gram-positive bacteria. American Society for Microbiology, Washington, D.C.
|
| 34.
|
Park, H.-W.,
B. Ge,
L. S. Bauer, and B. A. Federici.
1998.
Optimization of Cry3A yields in Bacillus thuringiensis by use of sporulation-dependent promoters in combination with the STAB-SD mRNA sequence.
Appl. Environ. Microbiol.
64:3932-3938[Abstract/Free Full Text].
|
| 35.
|
Pérez-Martín, J.,
F. Rojo, and V. de Lorenzo.
1994.
Promoters responsive to DNA bending: a common theme in prokaryotic gene expression.
Microbiol. Rev.
58:268-290[Abstract/Free Full Text].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 37.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 38.
|
Schnepf, E.,
N. Crickmore,
J. Van Rie,
D. Lereclus,
J. Baum,
J. Feitelson,
D. R. Zeigler, and D. H. Dean.
1998.
Bacillus thuringiensis and its pesticidal crystal proteins.
Microbiol. Mol. Biol. Rev.
62:775-806[Abstract/Free Full Text].
|
| 39.
|
Schurter, W.,
M. Geiser, and D. Mathe.
1989.
Efficient transformation of Bacillus thuringiensis and B. cereus via electroporation: transformation of acrystalliferous strains with a cloned delta-endotoxin gene.
Mol. Gen. Genet.
218:177-181[CrossRef][Medline].
|
| 40.
|
Setlow, B., and P. Setlow.
1977.
Levels of acetyl coenzyme A, reduced and oxidized coenzyme A, and coenzyme A in disulfide linkage to protein in dormant and germinated spores and growing and sporulating cells of Bacillus megaterium.
J. Bacteriol.
132:444-452[Abstract/Free Full Text].
|
| 41.
|
Stahly, C. P.,
D. W. Dingman,
L. A. Bulla, Jr., and A. I. Aronson.
1978.
Possible origin and function of the parasporal crystals in Bacillus thuringiensis.
Biochem. Biophys. Res. Commun.
84:581-588[CrossRef][Medline].
|
| 42.
|
Tabashnik, B. E.
1992.
Evaluation of synergism among Bacillus thuringiensis toxins.
Appl. Environ. Microbiol.
58:3343-3346[Abstract/Free Full Text].
|
| 43.
|
Tatti, K. M., and C. P. Moran, Jr.
1985.
Utilization of one promoter by two forms of RNA polymerase from Bacillus subtilis.
Nature
314:190-192[CrossRef][Medline].
|
| 44.
|
Walter, T., and A. Aronson.
1998.
Specific binding of the E2 subunit of pyruvate dehydrogenase to the upstream region of Bacillus thuringiensis protoxin genes.
J. Biol. Chem.
274:7901-7906[Abstract/Free Full Text].
|
| 45.
|
Warne, S. E., and P. L. deHaseth.
1993.
Promoter recognition by Escherichia coli RNA polymerase. Effects of single base pair deletions and insertions in the spacer DNA separating the 10 and 35 regions are dependent on spacer DNA sequence.
Biochemistry
32:6134-6140[CrossRef][Medline].
|
| 46.
|
Winzeler, E., and L. Shapiro.
1996.
A novel promoter motif for Caulobacter cell cycle-controlled DNA replication genes.
J. Mol. Biol.
264:412-425[CrossRef][Medline].
|
| 47.
|
Yoshisue, H.,
K. Ihara,
T. Nishimoto,
H. Sakai, and T. Komano.
1995.
Expression of the genes for insecticidal crystal proteins in Bacillus thuringiensis: cryIVA, not cryIVB, is transcribed by RNA polymerase containing H and that containing E.
FEMS Microbiol. Lett.
127:65-67[Medline].
|
Journal of Bacteriology, February 2000, p. 734-741, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Marraffini, L. A., Schneewind, O.
(2007). Sortase C-Mediated Anchoring of BasI to the Cell Wall Envelope of Bacillus anthracis. J. Bacteriol.
189: 6425-6436
[Abstract]
[Full Text]
-
Kim, H.-S., Sherman, D., Johnson, F., Aronson, A. I.
(2004). Characterization of a Major Bacillus anthracis Spore Coat Protein and Its Role in Spore Inactivation. J. Bacteriol.
186: 2413-2417
[Abstract]
[Full Text]
-
Chang, L., Grant, R., Aronson, A.
(2001). Regulation of the Packaging of Bacillus thuringiensisdelta -Endotoxins into Inclusions. Appl. Environ. Microbiol.
67: 5032-5036
[Abstract]
[Full Text]