TEXT

Top Abstract Text References

All of the major subgroupings of archaea, including methanogens, extreme halophiles, and sulfur-dependent thermophiles and hyperthermophiles, have members that possess flagella that look superficially like bacterial flagella (10). However, recent evidence has indicated that the archaeal flagellum is a unique motility structure, distinct from that of bacteria in composition and likely assembly (4, 10). One major distinction is that the assembly of archaeal flagella requires the posttranslational cleavage of a short (11- or 12-amino-acid) leader peptide (2, 13) from the precursor form of the flagellin monomer (preflagellin) before its incorporation into the growing filament. Bacterial flagellins are not made with leader peptides (12).

Previously, in Methanococcus voltae, four flagellin genes (flaA, flaB1, flaB2, and flaB3) carried by two transcriptional units were identified (13). One transcriptional unit contains only flaA; the other, polycistronic transcriptional unit (at least 5.4 kb in length), containing flaB1, flaB2, flaB3, and a number of presumed flagellum accessory genes, initiates at flaB1 and extends to at least the end of flaG (13; D. P. Bayley, J. D. Correia, and K. F. Jarrell, unpublished data). N-terminal (14), transcriptional (13), and mutational (9) analyses have provided evidence that flaB1 and flaB2 encode the major flagellins in M. voltae. Comparison of the N-terminal sequence of one purified flagellin with the amino acid sequence predicted from the gene sequence (13) confirmed the presence of a 12-amino-acid leader peptide. Similarly, in the related methanogen Methanococcus vannielii, comparison of the N-terminal sequences obtained from the two major flagellins of purified flagellar filaments with the deduced amino acid sequence of the cloned genes indicated the presence of 12-amino-acid leader peptides on the FlaB1 and FlaB2 flagellins (2). The presence of leader peptides on archaeal flagellins indicated that enzymatic activity must be present in archaeal cells to process the preflagellins.

Two different substrates were used for the determination of preflagellin peptidase activity. One preflagellin substrate was prepared by the expression of M. voltae FlaB2 in Escherichia coli (designated strain KJ91) using the T7 polymerase system (3, 18). A second substrate for the preflagellin peptidase was M. voltae FlaB1 with a C-terminal polyhistidine tag (His-tag). M. voltae flaB1 was cloned into the multiple cloning site of the pET23a+ vector (Novagen, Inc., Madison, Wis.) at NdeI and XhoI restriction sites. To do so, forward (5' GGAATCCATATGAACATAAAAGAATT 3') and reverse (5' CCGCTCGAGTTGTAATTCAACAACTT 3') PCR primers were designed to amplify flaB1, as well as generate a 5' NdeI site and a 3' XhoI site (underlined). In addition, the stop codon was deleted, creating an in-frame fusion with a His-tag sequence corresponding to the C-terminal end of the protein. The template for PCR was pKJ43, which contains a 2-kb PstI fragment encompassing flaB1 (13). Amplification of flaB1 was performed with Pwo DNA polymerase (Boehringer Mannheim, Laval, Quebec, Canada) with the following program: 95°C for 5 min and 30 cycles of 95°C for 45 s, 50°C for 45 s, and 72°C for 2 min. The final cycle had an extension time of 5 min. pET23a+ containing flaB1 (designated pKJ202) was transformed into E. coli BL21(DE3) containing pLysS. These cells were grown in 50 ml of Luria-Bertani medium to an optical density at 600 nm of 0.6 to 1, induced with 0.4 mM IPTG (isopropyl--D-thiogalactopyranoside) and grown for an additional 2 to 3 h. Membranes for use in the preflagellin peptidase assay were prepared as previously described (3).

To isolate methanogen membranes, methanogens grown overnight as previously described (15) were harvested aerobically by centrifugation, and the osmotically sensitive cells were lysed by the addition of sterile distilled water. The resulting envelopes were collected by centrifugation at 16,000 × g (Eppendorf Centrifuge 5415; Brinkmann Instruments, Inc., Westbury, N.Y.) for 10 min and resuspended in sterile distilled water.

The standard preflagellin peptidase reaction mixture (based on the prepilin peptidase assay for Pseudomonas aeruginosa [17]) contained approximately 72 µg of induced E. coli KJ91 membranes (as the substrate) combined with approximately 18 µg of methanogen membranes (as the enzyme source) in a final volume of 60 µl of 25 mM HEPES buffer (pH 7.5) containing 0.5% (vol/vol) Triton X-100. Each of the preflagellin peptidase assays was conducted near the optimum growth temperature of the methanogen tested: 37°C for reactions involving a mesophilic archaeon, 60°C for Methanococcus thermolithotrophicus, and 80°C for Methanococcus jannaschii and Methanococcus igneus. The reaction was started by the addition of the methanogen membranes and stopped by the addition of 15 µl of electrophoresis sample buffer (ESB) (0.0625 M Tris [pH 6.8], 1% [wt/vol] sodium dodecyl sulfate [SDS], 10% glycerol, 2% 2-mercaptoethanol, 0.001% bromophenol blue) to 10-µl aliquots (removed at time points of 0, 2, 10, and 30 min) and boiling for 5 min. The activity of a preflagellin peptidase was observed by immunoblotting experiments to detect unprocessed and processed preflagellin with antiserum raised against the M. voltae FlaB2 flagellin (3).

Samples for N-terminal sequencing were prepared as previously described (3). Sequencing was performed by David Watson (National Research Council of Canada, Ottawa, Ontario, Canada).

Preflagellin peptidase activity of M. voltae. M. voltae FlaB2, expressed in E. coli by the pT7 system (18), was detected in the crude E. coli membranes as a 26.5-kDa protein by both Coomassie blue staining and immunoblotting with flagellin antibody (Fig. 1A). N-terminal analysis of the expressed protein revealed the first 10 amino acids to be MKIKEFMSNK, which match exactly the predicted FlaB2 sequence with the attached leader peptide (3, 13). In the case of FlaB1, SDS-polyacrylamide gel electrophoresis analyses of induced E. coli BL21(DE3)-pLysS carrying pKJ202 revealed an induction product migrating at approximately 29 kDa, detected by both Coomassie blue staining and immunoblotting with anti-FlaB2 serum (data not shown).

View larger version (60K): [in this window] [in a new window]   FIG. 1.   Processing of M. voltae preflagellins FlaB1 and FlaB2 by the M. voltae preflagellin peptidase. (A) The preflagellin peptidase reaction was performed with approximately 72 µg of induced E. coli KJ91 membranes (FlaB2 substrate source) combined with approximately 18 µg of M. voltae membranes (enzyme source) in 25 mM HEPES buffer (pH 8.5) containing 0.25% (vol/vol) Triton X-100 and 0.4 M KCl (optimized conditions), at a reaction temperature of 37°C. Ten-µl samples were taken at 0- and 30-min time points and immediately mixed with 15 µl of electrophoresis sample buffer and boiled for 5 min. Twenty- and 10-µl samples were analyzed by Coomassie blue staining (|) and immunoblotting with a primary antibody dilution of 1:10,000 (), respectively. The relative mobility of prestained SDS-polyacrylamide gel electrophoresis low-range molecular mass standards (Bio-Rad) are indicated in kilodaltons (lane M). (B) The standard preflagellin peptidase reaction was performed with approximately 72 µg of induced E. coli KJ202 membranes (FlaB1 substrate source) combined with approximately 18 µg of M. voltae membranes (enzyme source) in 25 mM HEPES buffer (pH 7.5) containing 0.5% (vol/vol) Triton X-100. Samples removed at 0, 2, 10, and 30 min were similarly prepared and 10-µl aliquots were examined by immunoblotting with anti-FlaB2 antiserum. The positions of 33.9- and 28.8-kDa molecular mass markers are indicated.

Optimization of the preflagellin peptidase assay. Preflagellin cleavage activity required the addition of a buffer containing Triton X-100 or Nonidet P-40 as the solubilizing detergent. The processed flagellin was not evident in immunoblots when the assay was performed in reaction buffer that did not contain detergent (data not shown). Furthermore, preflagellin peptidase activity was not detected when Triton X-100 was replaced by a number of other detergents tested at a final concentration of 0.5% (vol/vol), including Tween 20, Tween 80, Brij 58, and SDS (data not shown). Experiments performed to maximize preflagellin cleavage involved varying the detergent concentration (Triton X-100), the salt concentration (KCl and NaCl), pH, and temperature (Fig. 2). A comparison of the initial assay conditions based on the prepilin peptidase system (25 mM HEPES buffer [pH 7.5] containing 0.5% [vol/vol] Triton X-100 at 37°C) with the optimized assay conditions developed in this work (25 mM HEPES buffer [pH 8.5] containing 400 mM KCl and 0.25% [vol/vol] Triton X-100 at 37°C) is presented in Fig. 3. Under optimized conditions, the processed form of the flagellin becomes the predominant of the two flagellin species over the 30-min time course of the reaction.

View larger version (47K): [in this window] [in a new window]   FIG. 2.   Optimization of the in vitro preflagellin peptidase reaction for detergent, salt, temperature, and pH. For all reactions, 10-µl samples were removed at 10 min and then immediately mixed with 15 µl of electrophoresis sample buffer and boiled for 5 min; 10-µl aliquots were examined by immunoblotting with a primary antibody dilution of 1:10,000. (A) The standard preflagellin peptidase reaction was performed with approximately 72 µg of induced E. coli KJ91 membranes (substrate source) combined with approximately 18 µg of M. voltae membranes (enzyme source) in 25 mM HEPES buffer (pH 7.5) containing varying final concentrations of Triton X-100 (0.0, 0.0625, 0.125, 0.25, 0.5, and 1.0% [vol/vol]). (B) The standard preflagellin peptidase reaction (25 mM HEPES [pH 7.5] containing 0.5% [vol/vol] Triton X-100) was supplemented with KCl to a final concentration of 0.0, 0.2, 0.4, 0.6, 0.8, or 1.2 M. (C) The standard preflagellin peptidase reaction was supplemented with NaCl to a final concentration of 0.0, 0.2, 0.4, 0.6, 0.8, or 1.2 M. (D) The standard preflagellin peptidase reaction was performed at reaction temperatures of 21, 30, 40, 50, and 60°C. (E) The standard preflagellin peptidase reaction was performed in 25 mM 2-(N-morpholino)ethanesulfonic acid buffer (pH 5.5 and 6.5), 25 mM HEPES buffer (pH 7.5 and 8.5) and 25 mM 1,3,-bis[tris(hydroxymethyl)-methylamino]propane buffer (pH 8.5, 9.5, and 10.5).

View larger version (23K): [in this window] [in a new window]   FIG. 3.   Comparison of the standard and optimized reaction conditions for the in vitro processing of M. voltae FlaB2 preflagellin by the M. voltae preflagellin peptidase. The standard preflagellin peptidase reaction (A) was performed with approximately 72 µg of induced E. coli KJ91 membranes (substrate source) combined with approximately 18 µg of M. voltae membranes (enzyme source) in 25 mM HEPES buffer (pH 7.5) containing 0.5% (vol/vol) Triton X-100 and the optimized preflagellin peptidase reaction (B) was performed in 25 mM HEPES buffer (pH 8.5) containing 0.4 M KCl and 0.25% (vol/vol) Triton X-100. Ten-microliter samples were removed at 0, 2, 10, and 30 min and then immediately mixed with 15 µl of electrophoresis sample buffer and boiled for 5 min; 10-µl aliquots were examined by immunoblotting with a primary antibody dilution of 1:10,000. The positions of 28- and 19.9-kDa molecular mass markers are indicated.

Heterologous preflagellin peptidase activity. All species of the genus Methanococcus tested (Methanococcus deltae, Methanococcus maripaludis, M. vannielii, M. voltae, M. thermolithotrophicus, and M. jannaschii) exhibited preflagellin peptidase activity against FlaB2 of M. voltae expressed in E. coli, with the sole exception of the hyperthermophile M. igneus (Fig. 4). Interestingly, it is unclear whether the few filamentous structures observed on the surface of M. igneus are, in fact, flagella (6). If M. igneus truly does lack flagella, its lack of preflagellin peptidase activity is readily explained.

View larger version (51K): [in this window] [in a new window]   FIG. 4.   In vitro processing of M. voltae FlaB2 preflagellin by the preflagellin peptidase of M. voltae and other methanococci. The standard preflagellin peptidase reaction was performed with approximately 72 µg of induced E. coli KJ91 membranes (substrate source) combined with approximately 18 µg of M. voltae membranes (A) in 25 mM HEPES buffer (pH 7.5) containing 0.5% (vol/vol) Triton X-100, at a reaction temperature of 37°C. The same reaction was performed with M. deltae membranes (B), M. maripaludis membranes (C), or M. vannielii membranes (D) in place of M. voltae membranes. The same reaction was performed at a reaction temperature of 60°C with M. thermolithotrophicus membranes (E), M. jannaschii membranes (F), or M. igneus membranes (G) as the enzyme source. Ten-microliter samples were removed at 0, 2, 10, and 30 min and then immediately mixed with 15 µl of electrophoresis sample buffer and boiled for 5 min; 10-µl aliquots were examined by immunoblotting with a primary antibody dilution of 1:10,000. Positions of 28- and 19.9-kDa molecular mass markers are indicated.