Previous Article
Journal of Bacteriology, February 2000, p. 855-858, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Posttranslational Processing of Methanococcus
voltae Preflagellin by Preflagellin Peptidases of M. voltae and Other Methanogens
Jason D.
Correia and
Ken F.
Jarrell*
Department of Microbiology and Immunology,
Queen's University, Kingston, Ontario, Canada K7L 3N6
Received 4 August 1999/Accepted 11 November 1999
 |
ABSTRACT |
Methanococcus voltae is a mesophilic archaeon with
flagella composed of flagellins that are initially made with 11- or
12-amino-acid leader peptides that are cleaved prior to incorporation
of the flagellin into the growing filament. Preflagellin peptidase
activity was demonstrated in immunoblotting experiments with flagellin antibody to detect unprocessed and processed flagellin subunits. Escherichia coli membranes containing the expressed
M. voltae preflagellin (as the substrate) were combined in
vitro with methanogen membranes (as the enzyme source). Correct
processing of the preflagellin to the mature flagellin was also shown
directly by comparison of the N-terminal sequences of the two flagellin
species. M. voltae preflagellin peptidase activity was
optimal at 37°C and pH 8.5 and in the presence of 0.4 M KCl with
0.25% (vol/vol) Triton X-100.
| |
TEXT |
All of the major subgroupings of
archaea, including methanogens, extreme halophiles, and
sulfur-dependent thermophiles and hyperthermophiles, have members
that possess flagella that look superficially like bacterial
flagella (10). However, recent evidence has indicated that
the archaeal flagellum is a unique motility structure, distinct from
that of bacteria in composition and likely assembly (4, 10).
One major distinction is that the assembly of archaeal flagella
requires the posttranslational cleavage of a short (11- or
12-amino-acid) leader peptide (2, 13) from the precursor
form of the flagellin monomer (preflagellin) before its incorporation
into the growing filament. Bacterial flagellins are not made with
leader peptides (12).
Previously, in Methanococcus voltae, four flagellin genes
(flaA, flaB1, flaB2, and
flaB3) carried by two transcriptional units were identified
(13). One transcriptional unit contains only flaA; the other, polycistronic transcriptional unit (at
least 5.4 kb in length), containing flaB1, flaB2,
flaB3, and a number of presumed flagellum accessory genes,
initiates at flaB1 and extends to at least the end of
flaG (13; D. P. Bayley, J. D. Correia, and K. F. Jarrell, unpublished data). N-terminal
(14), transcriptional (13), and mutational
(9) analyses have provided evidence that flaB1
and flaB2 encode the major flagellins in M. voltae. Comparison of the N-terminal sequence of one purified flagellin with the amino acid sequence predicted from the gene sequence
(13) confirmed the presence of a 12-amino-acid leader peptide. Similarly, in the related methanogen Methanococcus
vannielii, comparison of the N-terminal sequences obtained from
the two major flagellins of purified flagellar filaments with the
deduced amino acid sequence of the cloned genes indicated the presence
of 12-amino-acid leader peptides on the FlaB1 and FlaB2 flagellins
(2). The presence of leader peptides on archaeal flagellins
indicated that enzymatic activity must be present in archaeal cells to
process the preflagellins.
Two different substrates were used for the determination of
preflagellin peptidase activity. One preflagellin substrate was prepared by the expression of M. voltae FlaB2 in
Escherichia coli (designated strain KJ91) using the T7
polymerase system (3, 18). A second substrate for the
preflagellin peptidase was M. voltae FlaB1 with a C-terminal
polyhistidine tag (His-tag). M. voltae flaB1 was cloned into
the multiple cloning site of the pET23a+ vector (Novagen, Inc.,
Madison, Wis.) at NdeI and XhoI restriction
sites. To do so, forward (5'
GGAATCCATATGAACATAAAAGAATT 3') and reverse (5'
CCGCTCGAGTTGTAATTCAACAACTT 3') PCR primers were
designed to amplify flaB1, as well as generate a 5'
NdeI site and a 3' XhoI site (underlined). In
addition, the stop codon was deleted, creating an in-frame fusion with
a His-tag sequence corresponding to the C-terminal end of the protein.
The template for PCR was pKJ43, which contains a 2-kb PstI
fragment encompassing flaB1 (13). Amplification
of flaB1 was performed with Pwo DNA polymerase
(Boehringer Mannheim, Laval, Quebec, Canada) with the following
program: 95°C for 5 min and 30 cycles of 95°C for 45 s, 50°C
for 45 s, and 72°C for 2 min. The final cycle had an extension time of 5 min. pET23a+ containing flaB1 (designated pKJ202)
was transformed into E. coli BL21(DE3) containing pLysS.
These cells were grown in 50 ml of Luria-Bertani medium to an optical
density at 600 nm of 0.6 to 1, induced with 0.4 mM IPTG
(isopropyl-
-D-thiogalactopyranoside) and grown for an
additional 2 to 3 h. Membranes for use in the preflagellin
peptidase assay were prepared as previously described (3).
To isolate methanogen membranes, methanogens grown overnight as
previously described (15) were harvested aerobically by centrifugation, and the osmotically sensitive cells were lysed by the
addition of sterile distilled water. The resulting envelopes were
collected by centrifugation at 16,000 × g (Eppendorf
Centrifuge 5415; Brinkmann Instruments, Inc., Westbury, N.Y.) for 10 min and resuspended in sterile distilled water.
The standard preflagellin peptidase reaction mixture (based on the
prepilin peptidase assay for Pseudomonas aeruginosa
[17]) contained approximately 72 µg of induced
E. coli KJ91 membranes (as the substrate) combined with
approximately 18 µg of methanogen membranes (as the enzyme source) in
a final volume of 60 µl of 25 mM HEPES buffer (pH 7.5) containing
0.5% (vol/vol) Triton X-100. Each of the preflagellin peptidase assays
was conducted near the optimum growth temperature of the methanogen
tested: 37°C for reactions involving a mesophilic archaeon, 60°C
for Methanococcus thermolithotrophicus, and 80°C for
Methanococcus jannaschii and Methanococcus
igneus. The reaction was started by the addition of the methanogen
membranes and stopped by the addition of 15 µl of electrophoresis
sample buffer (ESB) (0.0625 M Tris [pH 6.8], 1% [wt/vol] sodium
dodecyl sulfate [SDS], 10% glycerol, 2% 2-mercaptoethanol, 0.001%
bromophenol blue) to 10-µl aliquots (removed at time points of 0, 2, 10, and 30 min) and boiling for 5 min. The activity of a preflagellin
peptidase was observed by immunoblotting experiments to detect
unprocessed and processed preflagellin with antiserum raised against
the M. voltae FlaB2 flagellin (3).
Samples for N-terminal sequencing were prepared as previously described
(3). Sequencing was performed by David Watson (National Research Council of Canada, Ottawa, Ontario, Canada).
Preflagellin peptidase activity of M. voltae.
M. voltae FlaB2, expressed in E. coli by the pT7
system (18), was detected in the crude E. coli membranes as a 26.5-kDa protein by both Coomassie blue
staining and immunoblotting with flagellin antibody (Fig.
1A). N-terminal analysis of the expressed protein revealed the first 10 amino acids to be MKIKEFMSNK,
which match exactly the predicted FlaB2 sequence with the
attached leader peptide (3, 13). In the case of FlaB1,
SDS-polyacrylamide gel electrophoresis analyses of induced E. coli BL21(DE3)-pLysS carrying pKJ202 revealed an induction product
migrating at approximately 29 kDa, detected by both Coomassie blue
staining and immunoblotting with anti-FlaB2 serum (data not shown).
View larger version (60K):
[in this window]
[in a new window]
|
FIG. 1.
Processing of M. voltae preflagellins FlaB1
and FlaB2 by the M. voltae preflagellin peptidase. (A) The
preflagellin peptidase reaction was performed with approximately 72 µg of induced E. coli KJ91 membranes (FlaB2 substrate
source) combined with approximately 18 µg of M. voltae
membranes (enzyme source) in 25 mM HEPES buffer (pH 8.5) containing
0.25% (vol/vol) Triton X-100 and 0.4 M KCl (optimized conditions), at
a reaction temperature of 37°C. Ten-µl samples were taken at 0- and
30-min time points and immediately mixed with 15 µl of
electrophoresis sample buffer and boiled for 5 min. Twenty- and 10-µl
samples were analyzed by Coomassie blue staining (|) and
immunoblotting with a primary antibody dilution of 1:10,000 ( ),
respectively. The relative mobility of prestained SDS-polyacrylamide
gel electrophoresis low-range molecular mass standards (Bio-Rad) are
indicated in kilodaltons (lane M). (B) The standard preflagellin
peptidase reaction was performed with approximately 72 µg of induced
E. coli KJ202 membranes (FlaB1 substrate source) combined
with approximately 18 µg of M. voltae membranes (enzyme
source) in 25 mM HEPES buffer (pH 7.5) containing 0.5% (vol/vol)
Triton X-100. Samples removed at 0, 2, 10, and 30 min were similarly
prepared and 10-µl aliquots were examined by immunoblotting with
anti-FlaB2 antiserum. The positions of 33.9- and 28.8-kDa molecular
mass markers are indicated.
|
|
E. coli membranes containing FlaB2 were mixed with
M. voltae envelopes in the presence of 25 mM HEPES buffer containing
0.5%
(vol/vol) Triton X-100, and samples taken at various time points
were analyzed by immunoblotting with antiflagellin antiserum.
Western
blot analysis of the preflagellin peptidase assay clearly
demonstrated
the appearance, with time, of a second cross-reactive
band with greater
electrophoretic mobility than the 26.5-kDa preflagellin
(Fig.
1A). This
additional band increased in intensity with time,
and its size
corresponded to that expected for the processed flagellin.
The
N-terminal sequence determined for this smaller (25 kDa),
cross-reactive band was ASGIGT(L/G)IVF, indicating that it
was
indeed the product of the FlaB2 precursor after cleavage of its
12-amino-acid N-terminal leader peptide (
13). The 25-kDa
flagellin
was absent when the assay was performed without the addition
of
M. voltae membranes or with the addition of
M. voltae membranes
previously boiled for 5 min (data not shown). The
addition of
cardiolipin was not necessary for
M. voltae
preflagellin cleavage
(data not shown), unlike the in vitro prepilin
peptidase assay
system of
P. aeruginosa, where an acidic
phospholipid is an essential
component (
17). In addition,
since all assays were conducted
aerobically, the preflagellin peptidase
did not require the strict
anaerobic conditions that are essential for
the growth of
M. voltae.
E. coli membranes containing FlaB1 were similarly incubated
with
M. voltae membranes in the presence of 25 mM HEPES
buffer
containing 0.5% (vol/vol) Triton X-100, and the appearance of
mature flagellin was observed by immunoblotting with anti-FlaB2
serum
(Fig.
1B). Although both overexpressed FlaB2 and polyhistidine-tagged
FlaB1 were suitable substrates of the preflagellin peptidase,
the work
described below utilized the FlaB2
substrate.
Optimization of the preflagellin peptidase assay.
Preflagellin
cleavage activity required the addition of a buffer containing Triton
X-100 or Nonidet P-40 as the solubilizing detergent. The processed
flagellin was not evident in immunoblots when the assay was performed
in reaction buffer that did not contain detergent (data not shown).
Furthermore, preflagellin peptidase activity was not detected when
Triton X-100 was replaced by a number of other detergents tested at a
final concentration of 0.5% (vol/vol), including Tween 20, Tween 80, Brij 58, and SDS (data not shown). Experiments performed to maximize
preflagellin cleavage involved varying the detergent concentration
(Triton X-100), the salt concentration (KCl and NaCl), pH, and
temperature (Fig. 2). A comparison of the
initial assay conditions based on the prepilin peptidase system (25 mM
HEPES buffer [pH 7.5] containing 0.5% [vol/vol] Triton X-100 at
37°C) with the optimized assay conditions developed in this work (25 mM HEPES buffer [pH 8.5] containing 400 mM KCl and 0.25% [vol/vol]
Triton X-100 at 37°C) is presented in Fig.
3. Under optimized conditions, the
processed form of the flagellin becomes the predominant of the two
flagellin species over the 30-min time course of the reaction.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Optimization of the in vitro preflagellin peptidase
reaction for detergent, salt, temperature, and pH. For all reactions,
10-µl samples were removed at 10 min and then immediately mixed with
15 µl of electrophoresis sample buffer and boiled for 5 min; 10-µl
aliquots were examined by immunoblotting with a primary antibody
dilution of 1:10,000. (A) The standard preflagellin peptidase reaction
was performed with approximately 72 µg of induced E. coli
KJ91 membranes (substrate source) combined with approximately 18 µg
of M. voltae membranes (enzyme source) in 25 mM HEPES buffer
(pH 7.5) containing varying final concentrations of Triton X-100 (0.0, 0.0625, 0.125, 0.25, 0.5, and 1.0% [vol/vol]). (B) The standard
preflagellin peptidase reaction (25 mM HEPES [pH 7.5] containing
0.5% [vol/vol] Triton X-100) was supplemented with KCl to a final
concentration of 0.0, 0.2, 0.4, 0.6, 0.8, or 1.2 M. (C) The standard
preflagellin peptidase reaction was supplemented with NaCl to a final
concentration of 0.0, 0.2, 0.4, 0.6, 0.8, or 1.2 M. (D) The standard
preflagellin peptidase reaction was performed at reaction temperatures
of 21, 30, 40, 50, and 60°C. (E) The standard preflagellin peptidase
reaction was performed in 25 mM
2-(N-morpholino)ethanesulfonic acid buffer (pH 5.5 and 6.5),
25 mM HEPES buffer (pH 7.5 and 8.5) and 25 mM
1,3,-bis[tris(hydroxymethyl)-methylamino]propane buffer (pH 8.5, 9.5, and 10.5).
|
|
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3.
Comparison of the standard and optimized reaction
conditions for the in vitro processing of M. voltae FlaB2
preflagellin by the M. voltae preflagellin peptidase. The
standard preflagellin peptidase reaction (A) was performed with
approximately 72 µg of induced E. coli KJ91 membranes
(substrate source) combined with approximately 18 µg of M. voltae membranes (enzyme source) in 25 mM HEPES buffer (pH 7.5)
containing 0.5% (vol/vol) Triton X-100 and the optimized preflagellin
peptidase reaction (B) was performed in 25 mM HEPES buffer (pH 8.5)
containing 0.4 M KCl and 0.25% (vol/vol) Triton X-100. Ten-microliter
samples were removed at 0, 2, 10, and 30 min and then immediately mixed
with 15 µl of electrophoresis sample buffer and boiled for 5 min;
10-µl aliquots were examined by immunoblotting with a primary
antibody dilution of 1:10,000. The positions of 28- and 19.9-kDa
molecular mass markers are indicated.
|
|
A nonflagellated
M. voltae mutant (
M. voltae P-2
[
9]) was also examined for preflagellin peptidase
activity under the standard
reaction conditions. This mutant has an
insertional vector located
in
flaB2, which also results in a
polar effect on the cotranscribed
downstream genes. Preflagellin
peptidase activity with
M. voltae P-2 membranes was
comparable to that observed in the membranes
of wild-type
M. voltae cells after a reaction time of 30 min (data
not shown),
indicating that the preflagellin peptidase activity
is not attributable
to the products encoded by
flaC-flaG.
Heterologous preflagellin peptidase activity.
All species of
the genus Methanococcus tested (Methanococcus
deltae, Methanococcus maripaludis, M. vannielii, M. voltae, M. thermolithotrophicus, and M. jannaschii) exhibited
preflagellin peptidase activity against FlaB2 of M. voltae
expressed in E. coli, with the sole exception of the
hyperthermophile M. igneus (Fig.
4). Interestingly, it is unclear whether
the few filamentous structures observed on the surface of M. igneus are, in fact, flagella (6). If M. igneus truly does lack flagella, its lack of preflagellin
peptidase activity is readily explained.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
In vitro processing of M. voltae FlaB2
preflagellin by the preflagellin peptidase of M. voltae and
other methanococci. The standard preflagellin peptidase reaction was
performed with approximately 72 µg of induced E. coli KJ91
membranes (substrate source) combined with approximately 18 µg of
M. voltae membranes (A) in 25 mM HEPES buffer (pH 7.5)
containing 0.5% (vol/vol) Triton X-100, at a reaction temperature of
37°C. The same reaction was performed with M. deltae
membranes (B), M. maripaludis membranes (C), or M. vannielii membranes (D) in place of M. voltae
membranes. The same reaction was performed at a reaction temperature of
60°C with M. thermolithotrophicus membranes (E), M. jannaschii membranes (F), or M. igneus membranes (G) as
the enzyme source. Ten-microliter samples were removed at 0, 2, 10, and
30 min and then immediately mixed with 15 µl of electrophoresis
sample buffer and boiled for 5 min; 10-µl aliquots were examined by
immunoblotting with a primary antibody dilution of 1:10,000. Positions
of 28- and 19.9-kDa molecular mass markers are indicated.
|
|
M. thermolithotrophicus demonstrated excellent preflagellin
peptidase activity at 60°C (Fig.
4) as well as 37°C (data not
shown). Unexpectedly, preflagellin peptidase activity of
M. jannaschii was observed at 60 but not at 80°C (data not shown),
close to
its optimum growth temperature of 85°C. Since
M. jannaschii is
flagellated at 80°C and thus would be expected to
have an active
preflagellin peptidase at this temperature, we surmised
that the
absence of preflagellin peptidase activity at 80°C might be
due
to the instability of the
M. voltae substrate at this
elevated
temperature. FlaB2 stability was examined by preheating
E. coli KJ91 membranes containing FlaB2 for 10 min at 60 or
80°C and subsequently
performing an assay for preflagellin peptidase
activity with
M. voltae membranes at a reaction temperature
of 37°C. Peptidase
activity was unaffected by the pretreatment at
either temperature
(data not
shown).
We also tested other flagellated methanogens with a wall profile
similar to that of the
Methanococcus species for the
presence
of a preflagellin peptidase active against
M. voltae FlaB2. Membranes
isolated from
Methanoculleus
marisnigri and
Methanogenium cariaci did not cleave the
FlaB2 preflagellin of
M. voltae under the standard
reaction
conditions (data not shown). No attempt to detect preflagellin
peptidase activity in these methanogens by altering the standard
reaction conditions was
done.
Direct demonstration of preflagellin processing adds more evidence to
the description of archaeal flagellation as a unique
motility
structure, distinct from that of its bacterial counterpart
and with
several similarities to type IV pili. Since searches
of the complete
genome sequences reported for flagellated archaea
do not reveal
homologs to prepilin peptidases, archaeal preflagellin
peptidases may
represent a new class of proteolytic
enzymes.
Cleavage of the preflagellin leader peptide occurs following an
invariant glycine residue in
M. voltae and
M. vannielii and
likely in all other archaeal preflagellins
(
11). In addition,
the
2 and
3 positions in archaeal
flagellins are always held
by charged amino acids, usually a basic
amino acid (lysine or
arginine), but in the case of
Halobacterium
salinarum, glutamic
acid is found. Aside from the flagellins, to
date the S-layer
protein is the only other
M. voltae protein
with a demonstrated
leader peptide. However, the 12-amino-acid leader
sequence (MVASALATGVFA)
for the S-layer protein (initially
reported as an ATPase [
7])
has little similarity to
the archaeal preflagellin leader peptides,
despite the identity in
length, and specifically it lacks the
conserved glycine at
1. In
addition, the leader peptide is not
followed by a stretch of
hydrophobic amino acids as always found
in archaeal flagellins
(
8) but instead has acidic or basic
amino acids in 8 of the
first 21 positions of the mature protein.
The S-layer gene and protein
of
Methanothermus fervidus, another
flagellated methanogen,
have also been studied (
5). In this
case, the leader peptide
has a typical bacterium like leader peptide
of 22 amino acids with an
Ala-Gly-Ala sequence preceding the cleavage
site. This is also very
unlike the leader peptides observed in
the archaeal flagellins and,
again, the conserved
1 glycine is
absent. Interestingly, a glucose
binding protein in
Sulfolobus solfataricus is also produced
with an 11-amino-acid leader peptide
that is processed at a
glycyl-leucyl peptide bond. This leader
peptide, as with those of the
preflagellins, is also positively
charged, which may suggest that this
protein is secreted by a
similar mechanism (
1). However,
whether flagellins, S-layer
proteins, and other precursors are
processed by the same enzyme
has yet to be experimentally determined.
We would predict, based
on the conservation of the amino acids around
the cleavage site
of the preflagellins in all archaea, that the
preflagellin peptidase
is a dedicated enzyme for cleavage of
preflagellin and perhaps
a limited number of related proteins, much as
the prepilin peptidase
recognizes only prepilin and pseudopilin
substrates (
17).
Currently, we are generating, by PCR, a family of mutant preflagellins
with amino acid substitutions at the conserved positions
near the
cleavage site. Development and optimization of the preflagellin
peptidase assay, as reported in this contribution, will allow
us to
determine key residues present in the preflagellin that
are required
for proper processing and should allow the identification
of the gene
encoding the enzyme responsible for preflagellin peptidase
activity in
M. voltae.
| |
ACKNOWLEDGMENTS |
This research was supported by a grant from the Natural Sciences
and Engineering Research Council of Canada (NSERC) awarded to K.F.J.
We thank David C. Jarrell for help in cloning FlaB1 with the His-tag
and W. B. Whitman and R. M. Sparling for
Methanococcus strains.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Queen's University, Kingston, Ontario K7L 3N6, Canada. Phone: (613) 533-2456. Fax: (613) 533-6796. E-mail: jarrellk{at}post.queensu.ca.
| |
REFERENCES |
| 1.
|
Albers, S.-V.,
W. N. Konings, and A. J. M. Driessen.
1999.
A unique short signal sequence in membrane-anchored proteins of Archaea.
Mol. Microbiol.
31:1595-1596[CrossRef][Medline].
|
| 2.
|
Bayley, D. P.,
V. Florian,
A. Klein, and K. F. Jarrell.
1998.
Flagellin genes of Methanococcus vannielii: amplification by the polymerase chain reaction, demonstration of signal peptides and identification of major components of the flagellar filament.
Mol. Gen. Genet.
258:639-645[CrossRef][Medline].
|
| 3.
|
Bayley, D. P., and K. F. Jarrell.
1999.
Overexpression of Methanococcus voltae flagellin subunits in Escherichia coli and Pseudomonas aeruginosa: a source of archaeal preflagellin.
J. Bacteriol.
181:4146-4153[Abstract/Free Full Text].
|
| 4.
|
Bayley, D. P., and K. F. Jarrell.
1998.
Further evidence to suggest that archaeal flagella are related to bacterial type IV pili.
J. Mol. Evol.
46:370-373[Medline].
|
| 5.
|
Bröckl, G.,
M. Behr,
S. Farby,
R. Hensel,
H. Kaudewitz,
E. Biendel, and H. König.
1991.
Analysis and nucleotide sequence of the genes encoding the surface-layer glycoproteins of the hyperthermophilic methanogens Methanothermus fervidus and Methanothermus sociabilis.
Eur. J. Biochem.
199:147-152[Medline].
|
| 6.
|
Burggraf, S.,
H. Fricke,
A. Neuner,
J. Kristjansson,
P. Rouvier,
L. Mandelco,
C. R. Woese, and K. O. Stetter.
1990.
Methanococcus igneus sp. nov., a novel hyperthermophilic methanogen from a shallow submarine hydrothermal system.
Syst. Appl. Microbiol.
13:263-269[Medline].
|
| 7.
|
Dharmavaram, R.,
P. Gillevet, and J. Konisky.
1991.
Nucleotide sequence of the gene encoding the vandate-sensitive membrane-associated ATPase of Methanococcus voltae.
J. Bacteriol.
173:2131-2133[Abstract/Free Full Text].
|
| 8.
|
Faguy, D. M.,
K. F. Jarrell,
J. Kuzio, and M. L. Kalmokoff.
1994.
Molecular analysis of archaeal flagellins: similarity to type IV pilin-transport superfamily widespread in bacteria.
Can. J. Microbiol.
40:67-71[Medline].
|
| 9.
|
Jarrell, K. F.,
D. P. Bayley,
V. Florian, and A. Klein.
1996.
Isolation and characterization of insertional mutations in flagellin genes in the archaeon Methanococcus voltae.
Mol. Microbiol.
20:657-666[CrossRef][Medline].
|
| 10.
|
Jarrell, K. F.,
D. P. Bayley, and A. S. Kostyukova.
1996.
The archaeal flagellum: a unique motility structure.
J. Bacteriol.
178:5057-5064[Free Full Text].
|
| 11.
|
Jarrell, K. F.,
J. D. Correia, and N. A. Thomas.
1999.
Is the processing and translocation system used by flagellins also used by membrane-anchored secretory proteins in archaea?
Mol. Microbiol.
34:395-398[CrossRef][Medline].
|
| 12.
|
Jones, C. J., and S. Aizawa.
1991.
The bacterial flagellum and flagellar motor: structure, assembly and function.
Adv. Microb. Physiol.
32:109-172[Medline].
|
| 13.
|
Kalmokoff, M. L., and K. F. Jarrell.
1991.
Cloning and sequencing of a multigene family encoding the flagellins of Methanococcus voltae.
J. Bacteriol.
173:7113-7125[Abstract/Free Full Text].
|
| 14.
|
Kalmokoff, M. L.,
T. M. Karnauchow, and K. F. Jarrell.
1990.
Conserved N-terminal sequences in the flagellins of archaebacteria.
Biochem. Biophys. Res. Commun.
167:154-160[CrossRef][Medline].
|
| 15.
|
Kalmokoff, M. L.,
S. F. Koval, and K. F. Jarrell.
1992.
Relatedness of the flagellins from methanogens.
Arch. Microbiol.
157:481-487[Medline].
|
| 16.
|
Nunn, D. N., and S. Lory.
1992.
Components of the protein-excretion apparatus of Pseudomonas aeruginosa are processed by the type IV prepilin peptidase.
Proc. Natl. Acad. Sci. USA
89:47-51[Abstract/Free Full Text].
|
| 17.
|
Strom, M. S.,
D. N. Nunn, and S. Lory.
1994.
Posttranslational processing of type IV prepilin and homologs by PilD of Pseudomonas aeruginosa.
Methods Enzymol.
235:527-540[Medline].
|
| 18.
|
Tabor, S., and C. C. Richardson.
1985.
A bacteriophage T7 RNA polymerase/promoter system for controlled expression of specific genes.
Proc. Natl. Acad. Sci. USA
82:1074-1078[Abstract/Free Full Text].
|
Journal of Bacteriology, February 2000, p. 855-858, Vol. 182, No. 3
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ng, S. Y. M., VanDyke, D. J., Chaban, B., Wu, J., Nosaka, Y., Aizawa, S.-I., Jarrell, K. F.
(2009). Different Minimal Signal Peptide Lengths Recognized by the Archaeal Prepilin-Like Peptidases FlaK and PibD. J. Bacteriol.
191: 6732-6740
[Abstract]
[Full Text]
-
Chaban, B., Logan, S. M., Kelly, J. F., Jarrell, K. F.
(2009). AglC and AglK Are Involved in Biosynthesis and Attachment of Diacetylated Glucuronic Acid to the N-Glycan in Methanococcus voltae. J. Bacteriol.
191: 187-195
[Abstract]
[Full Text]
-
Eichler, J., Adams, M. W. W.
(2005). Posttranslational Protein Modification in Archaea. Microbiol. Mol. Biol. Rev.
69: 393-425
[Abstract]
[Full Text]
-
Voisin, S., Houliston, R. S., Kelly, J., Brisson, J.-R., Watson, D., Bardy, S. L., Jarrell, K. F., Logan, S. M.
(2005). Identification and Characterization of the Unique N-Linked Glycan Common to the Flagellins and S-layer Glycoprotein of Methanococcus voltae. J. Biol. Chem.
280: 16586-16593
[Abstract]
[Full Text]
-
Ng, S. Y. M., Jarrell, K. F.
(2003). Cloning and Characterization of Archaeal Type I Signal Peptidase from Methanococcus voltae. J. Bacteriol.
185: 5936-5942
[Abstract]
[Full Text]
-
Albers, S.-V., Szabo, Z., Driessen, A. J. M.
(2003). Archaeal Homolog of Bacterial Type IV Prepilin Signal Peptidases with Broad Substrate Specificity. J. Bacteriol.
185: 3918-3925
[Abstract]
[Full Text]
-
Galagan, J. E., Nusbaum, C., Roy, A., Endrizzi, M. G., Macdonald, P., FitzHugh, W., Calvo, S., Engels, R., Smirnov, S., Atnoor, D., Brown, A., Allen, N., Naylor, J., Stange-Thomann, N., DeArellano, K., Johnson, R., Linton, L., McEwan, P., McKernan, K., Talamas, J., Tirrell, A., Ye, W., Zimmer, A., Barber, R. D., Cann, I., Graham, D. E., Grahame, D. A., Guss, A. M., Hedderich, R., Ingram-Smith, C., Kuettner, H. C., Krzycki, J. A., Leigh, J. A., Li, W., Liu, J., Mukhopadhyay, B., Reeve, J. N., Smith, K., Springer, T. A., Umayam, L. A., White, O., White, R. H., de Macario, E. C., Ferry, J. G., Jarrell, K. F., Jing, H., Macario, A. J.L., Paulsen, I., Pritchett, M., Sowers, K. R., Swanson, R. V., Zinder, S. H., Lander, E., Metcalf, W. W., Birren, B.
(2002). The Genome of M. acetivorans Reveals Extensive Metabolic and Physiological Diversity. Genome Res
12: 532-542
[Abstract]
[Full Text]
-
Thomas, N. A., Jarrell, K. F.
(2001). Characterization of Flagellum Gene Families of Methanogenic Archaea and Localization of Novel Flagellum Accessory Proteins. J. Bacteriol.
183: 7154-7164
[Abstract]
[Full Text]
Top
Abstract
Text
