Previous Article | Next Article ![]()
Journal of Bacteriology, February 2000, p. 919-927, Vol. 182, No. 4
Department of Microbiology and Molecular
Genetics and New Jersey Medical School National Tuberculosis Center,
UMDNJ/New Jersey Medical School, Newark, New Jersey 17103
Received 22 June 1999/Accepted 19 November 1999
Genes encoding L-arginine biosynthetic and transport
proteins have been shown in a number of pathogenic organisms to be
important for metabolism within the host. In this study we describe the cloning of a gene (Rv0522) encoding an amino acid transporter from
Mycobacterium bovis BCG and the effects of its deletion on L-arginine transport and metabolism. The Rv0522 gene of BCG
was cloned from a cosmid library by using primers homologous to the rocE gene of Bacillus subtilis, a putative
arginine transporter. A deletion mutant strain was constructed by
homologous recombination with the Rv0522 gene interrupted by a
selectable marker. The mutant strain was complemented with the
wild-type gene in single copy. Transport analysis of these strains was
conducted using 14C-labeled substrates. Greatly reduced
uptake of L-arginine and The mycobacteria are distinguishable
from most other organisms on the basis of their low permeability. Cell
wall structural analysis (41) and permeability studies
(18, 28) have provided an increased understanding of
this characteristic. However, few of the mycobacterial transporters
mediating the uptake of nutrients have been characterized at the
genetic, molecular, or biochemical levels. There are few recent studies
of nutrient transport by mycobacteria (9; for a
review, see reference 18), and, in particular, there
are no studies of the role of nutrient transport in the intracellular
survival of mycobacteria. The nature and availability of carbon,
nitrogen, and energy sources within the macrophage can best be studied
with genetic mutants altered in intermediary metabolism and transport.
This study presents a genetic approach to the transport of
L-arginine in mycobacteria.
Many microorganisms use L-arginine as a source of energy
and/or nitrogen, and the pathways of L-arginine
biosynthesis and utilization are well understood in some cases. At
least five pathways of L-arginine catabolism have been
identified in microorganisms, listed here by the first enzyme to act
upon the substrate: arginase, arginine deiminase, arginine
decarboxylase, arginine succinyl transferase, and arginine oxidase.
L-Arginine metabolism has not previously been examined in
the slow-growing mycobacteria, but scrutiny of the genomic sequence of
Mycobacterium tuberculosis (16) reveals the
presence of two of these five enzymes, arginine deiminase (Rv1001) and
arginine decarboxylase (Rv2531c). Arginine decarboxylase has been
studied in the context of regulation of pyrimidine synthesis in
M. smegmatis (2, 3, 5, 40).
In the arginase pathway, L-arginine is converted to urea
and ornithine. Urea is subsequently converted to NH3 and
CO2 by urease. There is no apparent homolog of arginase in
the Sanger database, but homologs of genes of subsequent enzymes in the
arginase pathway are present in the H37Rv genome. In addition, the
urease genes of BCG and M. tuberculosis have been cloned and
characterized (15, 46). By constructing a strain lacking the
urease gene, it was demonstrated that ureolytic activity was not
essential to BCG L-Arginine transport is an important aspect of arginine
metabolism and is regulated in concert with L-arginine
catabolic enzymes in many bacterial systems. Several different classes
of permeases are responsible for L-arginine transport among
the bacteria: the existence within a single organism of multiple
transport systems for this amino acid attest to its importance. In
Escherichia coli and Salmonella, the major
L-arginine permease is a member of the binding
protein-dependent family of transporter systems, with three separate
periplasmic binding proteins of differing specificities (24). The first binds L-lysine,
L-arginine, and L-ornithine (11,
48); the second binds L-arginine and
L-ornithine (13); and the third binds only
L-arginine (48, 53).
In Bacillus subtilis, the rocE and
rocC genes encode putative arginine permeases and are
homologous to each other (23, 42). The sequence of these
permease genes probably classifies them as members of the amino
acid-polyamine-organocation superfamily, single-protein membrane
carriers characterized by 12 or 14 transmembrane Here, Rv0522 was cloned from BCG and used to construct a strain lacking
the permease encoded by this ORF. The deletion strain and its wild-type
parent are characterized with respect to transport, growth properties,
and survival in a murine macrophage cell line.
Bacterial strains, plasmids, and growth conditions.
The
bacterial strains and plasmids used in this study are described in
Table 1. Escherichia coli
strains were grown in Luria-Bertani medium, and mycobacterial strains
were grown in Middlebrook medium [per liter,
(NH4)SO4, 0.5 g; L-glutamic
acid, 0.5 g; sodium citrate, 0.1 g; pyridoxine, 0.001 g;
biotin, 0.0005 g; Na2HPO4, 2.5 g; KH2PO4, 1.0 g; ferric ammonium citrate,
0.04 g; MgSO4, 0.05 g; CaCl2, 0.0005;
ZnSO4, 0.001; CuSO4, 0.001 g]. Middlebrook 7H9 (liquid) and 7H11 (1.5% agar) media (Difco) were supplemented with
glycerol (0.5% vol/vol) and ADC supplement (0.5% bovine serum albumin, fraction V [Boehringer Mannheim], 0.2% dextrose, 0.85% NaCl). Antibiotics were added at the following concentrations: ampicillin, 100 µg/ml, kanamycin and streptomycin, 50 µg/ml for E. coli and 20 µg/ml for BCG; and hygromycin, 150 µg/ml
for E. coli and 50 µg/ml for BCG. The minimal medium used
was composed of basal salts (0.1% KH2PO4,
0.25% NaH2PO4, 0.5% NH4Cl, 0.2%
K2SO4) medium supplemented with glycerol
(0.5%). Sauton's medium was used without amino acid supplements
(17). Where applicable, the nitrogen (NH4Cl)
and/or carbon (glycerol and/or dextrose) sources were omitted. All
liquid cultures of BCG were supplemented with 0.05% Tween 80 (Sigma
Chemicals).
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Amino Acid Transport and Metabolism in Mycobacteria: Cloning,
Interruption, and Characterization of an
L-Arginine/
-Aminobutyric Acid Permease in
Mycobacterium bovis BCG
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-aminobutyric acid (GABA) but
not of lysine, ornithine, proline, or alanine was observed in the
mutant strain compared to the wild type, grown in Middlebrook 7H9
medium. However, when the strains were starved for 24 h or
incubated in a minimal salts medium containing 20 mM arginine (in which
even the parent strain does not grow), L-[14C]arginine uptake by the mutant but not
the wild-type strain increased strongly. Exogenous
L-arginine but not GABA, lysine, ornithine, or alanine was
shown to be toxic at concentrations of 20 mM and above to wild-type
cells growing in optimal carbon and nitrogen sources such as glycerol
and ammonium. L-Arginine supplied in the form of dipeptides
showed no toxicity at concentrations as high as 30 mM. Finally, the
permease mutant strain showed no defect in survival in unactivated
cultured murine macrophages compared with wild-type BCG.
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
ure grown in vitro. However, a slight
decrease in the multiplication and persistence of the mutated strain
compared with wild-type BCG was observed in the lungs of infected mice (47).
-helices
(37). To study L-arginine transport in
mycobacteria, the M. tuberculosis sequence was searched for
predicted open reading frames (ORFs) with homology to the B. subtilis L-arginine transport proteins. Two homologs
were identified, Rv0522 and Rv2320c.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Strains and plasmids used in this study
Cloning and DNA manipulations. Plasmid DNA preparations, restriction endonuclease digestions, alkaline phosphatase treatments, ligations, transformations, and other DNA manipulations were performed by standard procedures (36). For electroporation of BCG, the cells were grown until the culture reached a turbidity (optical density at 600 nm [OD600]) of about 0.6 and then harvested at 4,000 × g for 10 min. The pellet was washed with 10% glycerol and centrifuged again at 4,000 × g for 10 min. The procedure was repeated two more times before resuspension of the pellet in 1/10 volume of 10% glycerol. All manipulations were carried out at 37°C. DNA (3 to 5 µg) was added to 0.5 ml of cells in a 0.4-cm electroporation cuvette (BTX). The cuvette was subjected to a single pulse using the Bio-Rad Gene Pulser set at 2.5 kV and 25 µF, with the pulse controller resistance set at 1,000. The contents of the cuvette were diluted into 5 ml of 7H9 medium and incubated overnight at 37°C. After incubation, the entire 5 ml was centrifuged and plated onto 7H10-antibiotic plates. Transformants appeared after incubation at 37°C for 3 to 4 weeks.
Construction of BCG Rv052 deletion strain.
PCR analysis to
screen the BCG genomic library to isolate a cosmid containing the
B. subtilis rocE homolog was performed using the PCR kit
from Boehringer Mannheim Biochemicals. The primers used were 5'
ATCGTGATCTTCTTCGTCGG 3' and 5' ATGATCACGCACAGGAATCC 3'.
The cosmid DNA was digested with a number of restrictions enzymes, and a Southern analysis using the PCR product as a probe revealed the presence of a 6-kb EcoRI fragment bearing the
homolog. This fragment was then subcloned into pGEM3Zf
and is called
pAS5 (see Fig. 1). This was then transformed into a dam E. coli strain, GM48. Transformation into GM48 permitted digestion
with the enzyme BclI, which released a 191-bp fragment. A
Kan-Str cassette as a BamHI fragment from plasmid pSM240 was
then inserted into the BclI site of pAS5 to create pAS6.
This construct was then used for allelic exchange of the homolog, the
Rv052 gene in BCG.
Uptake assays. Cells were grown to mid-log phase, washed three times with basal salts medium plus Tween 80 at 0.05%, and concentrated in basal salts medium approximately fivefold to a final OD600 of 3.0. The cell suspensions (1 ml) were warmed to 37°C with shaking. The culture was treated with rifampin (200 µg/ml) for 10 min prior to initiation of an uptake assay to block transcription and subsequently protein synthesis; this prevented the unlimited incorporation of radiolabeled amino acids into protein. The uptake reaction was initiated by the addition of radiolabeled substrate plus unlabeled substrate at the specific activities (usually 40 to 50 µCi/µmol) and to the final concentrations (usually 100 µM) described in the legends of the figures. Incorporation was terminated by removal of 0.1-ml samples at the indicated time to filters (Whatman GF/F; 0.45 µm) prewetted with BS medium. The cells were rinsed quickly (within 10 to 15 s) three times with 7 ml of ice-cold basal salts medium plus Tween 80 on a Hoeffer 10-place manifold with air vacuum. Filters with cells thereon were transferred to vials containing 5 ml of scintillation fluid for determination of radioactivity. The counts per minute were normalized to milligrams of protein per 0.1-ml aliquot for each cell suspension; protein was determined by the Bio-Rad protein assay.
For analysis of uptake by cells resuspended in different media, care was taken to ensure that the cultures used for uptake studies were at similar densities before the washing and concentration steps. This was essential when cells were resuspended in a medium that does not support measurable growth (minimal salts plus amino acid or
-aminobutyric
acid [GABA]) and compared with cells resuspended in Middlebrook medium.
To measure the effect of exogenous L-arginine on
[3H]uracil incorporation, 0.5 µCi of
[3H]uracil (38.5 Ci/mmol) (New England Nuclear) and
peptide were added simultaneously to the cells to initiate the
experiment. After 16 h, the cultures were precipitated in 10%
trichloroacetic acid (TCA) (Sigma) at 4°C for 20 min, filtered, and
washed three times with 5 ml of cold 10% TCA over filters (Whatman
GF/F; 0.45-µm pore size) prewetted with 10% TCA on a Hoeffer
10-place manifold with air vacuum (as above).
Macrophage survival assays. J774.1 cells were maintained in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum (Sigma), amino acids (BioWhittaker), and L-glutamine (Sigma). The cells were subcultured into 96-well plates (1.5 × 105 cells per well) for 6 to 12 h. Then 2 × 106 CFU of logarithmically growing bacteria were washed in macrophage medium and placed in the wells. After 4 to 6 h of attachment, the wells were rinsed three times in macrophage medium. The numbers of intracellular bacteria was determined by removing the supernatant of three wells in parallel, lysing the macrophages in double-distilled H2O ddH2O, diluting, and plating for CFU on 7H11 plates with the appropriate antibiotics. The supernatants were checked for the presence of extracellular bacteria at every time point, and the number of extracellular bacteria remained in the range of 1 to 5% of that of intracellular organisms. Triplicate determinations were made for each time point, and the experiment was performed five times.
| |
RESULTS |
|---|
|
|
|---|
Cloning and interruption of the rocE permease homolog from BCG. The rocE gene of B. subtilis encodes a major L-arginine permease. Its expression is induced by L-arginine in the medium, controlled at the level of transcription by the product of the rocR gene, a member of the NtrC/NifA family of regulators. Using the amino acid sequence of the B. subtilis rocE gene, the Sanger TB database was analyzed for ORFs with homology to the rocE gene. The strongest homology was exhibited by Rv0522 (31% identity and 53% similarity). The sequence of this predicted ORF in turn shows 44.3% identity to the GABA permease gene (gabP) of E. coli and 20% identity to gabP of B. subtilis. In B. subtilis, the rocE gene is part of the rocDEF operon bearing the genes for L-arginine catabolism. In contrast, Rv0522 is not part of an operon and is flanked by divergent ORFs of unknown function.
Primers derived from the Sanger database (16) were used to screen a genomic library of BCG (Pasteur) DNA in pYUB18 (27) for the presence of Rv0522 sequences. A cosmid carrying the BCG homolog of Rv0522 was identified (Fig. 1). From this cosmid, an EcoRI fragment of 6 kb bearing the BCG Rv0522 homolog was cloned into pGEM3Zf to create pAS5 (Table 1). A 191-bp BclI fragment in the ORF was removed and replaced with an antibiotic cassette containing kanamycin and streptomycin resistance markers to create pAS6. This final construct was linearized with BamHI and electroporated into BCG. Transformants resistant to both kanamycin and streptomycin were selected. The candidates for allele replacements were first screened by PCR, using oligonucleotide primers flanking the marker insertion site (see Materials and Methods). Southern blot analysis confirmed the structure of genomic DNA representing the wild-type strain and the allele replacement (double crossover) strain, AS1 (Fig. 1).
|
Uptake properties of AS1 (
Rv0522).
AS1 and its wild-type
parent were analyzed for uptake of various L-amino acids by
using radiolabelled substrates. The cells were grown in Middlebrook
medium (7H9 plus glycerol, ADC supplement, and 0.05% Tween). The
mutant strain showed a significant decrease in uptake of
L-[14C]arginine (90% reduction) (Fig.
2A). In addition, the mutant showed a
clear defect (75% reduction) in uptake of [14C]GABA
compared with wild-type cells (Fig. 2B). Neither
L-[14C]arginine nor [14C]GABA
uptake was completely abolished. This was not unexpected, as most
bacteria have multiple transporters for L-arginine. There was no difference between the wild type and mutant in uptake of the
structurally related amino acids
L-[14C]ornithine (Fig. 2C) or
L-[14C]lysine (Fig. 2D). The complemented
mutant strain, AS2, contained a wild-type copy of the Rv0522 gene
supplied in trans that fully complemented the
L-[14C]arginine (Fig. 2A) and
[14C]GABA (data not shown) uptake defects. Comparison of
the uptake of structurally unrelated amino acids, L-alanine
and L-proline, indicated that there were no differences
between the wild-type and AS1 strains (data not shown). Finally, the
apparent Kms for transport of
L-[14C]arginine and [14C]GABA
were calculated from Lineweaver-Burk analyses (Fig.
3) and found to be 250 and 165 µM,
respectively.
|
|
L-[14C]arginine uptake by wild-type BCG and AS1. In other bacteria, expression of L-arginine catabolic and biosynthetic operons is regulated by the presence or absence of exogenous L-arginine (7, 13, 23, 53). This regulation is often mediated by L-arginine acting as a corepressor in concert with the ArgR/AhrC protein as a repressor (34). To examine the effect of exogenous L-arginine on uptake of L-[14C]arginine in wild-type BCG, cells in balanced growth in Middlebrook medium were washed and incubated in minimal salts medium (see Materials and Methods) with 20 mM L-arginine as the sole carbon and nitrogen source. After 24 h at 37°C, uptake of L-[14C]arginine by cells incubated in L-arginine alone was only slightly reduced (25%) in comparison to that by wild-type cells growing in Middlebrook medium (Fig. 4A). The effect of starvation for carbon and nitrogen on L-[14C]arginine uptake by wild-type BCG was also examined. After 2 h (data not shown) or 24 h (Fig. 4A) of starvation in basal salts lacking sources of carbon and nitrogen, L-[14C]arginine uptake by wild-type cells was unchanged.
|
[14C]GABA uptake by wild-type BCG and AS1. To examine the effect of exogenous GABA on [14C]GABA uptake in BCG, wild-type cells in balanced growth in Middlebrook medium and cells washed and incubated in minimal salts medium with 20 mM GABA as the sole carbon and nitrogen source were compared. Figure 5A shows that there was a 70% reduction in [14C]GABA uptake by wild-type cells after exposure to 20 mM GABA. The results were identical after only 2 h of incubation in 20 mM GABA (data not shown).
|
L-Arginine utilization by BCG. Growth of wild-type BCG and AS1 cells in minimal arginine medium was measured. The cells were first grown to the mid-logarithmic growth phase in standard Middlebrook medium. They were washed and resuspended at an OD600 of 0.2 in various minimal media (basal salts medium or Sauton's medium [see Materials and Methods]) containing at 1 or 20 mM L-arginine as the sole carbon and/or sole nitrogen source. Surprisingly, neither wild-type nor mutant cells were capable of growing in either medium with L-arginine as the sole carbon or nitrogen source. In basal salts medium or Sauton's medium supplemented with glycerol (0.5%) and ammonium chloride (0.5%), wild-type cells grew at rates comparable to those seen for Middlebrook 7H9-grown cells. The following amino acids were tested as sources of either carbon or nitrogen to support the growth of wild-type BCG: L-histidine, L-lysine, L-ornithine, GABA, L-alanine, and L-proline. In all cases, single amino acids were incapable of supporting growth. This is in marked contrast to the observation that a wide range of amino acids and di- and tripeptides at a concentration of 2 to 5 mM are capable of supporting the growth of wild-type M. smegmatis in minimal medium as either the sole carbon or nitrogen source (9, 45).
Effect of exogenous arginine on wild-type BCG. Wild-type BCG was grown in Middlebrook 7H9 medium, containing glycerol and ammonium, in the presence of exogenous L-arginine at concentrations ranging from 0 to 40 mM (Fig. 6). Note that in this experiment, the primary sources of carbon and nitrogen (glycerol and ammonium, respectively) provided by Middlebrook medium are optimal for growth of the slow-growing mycobacteria (45). Surprisingly, at 15 mM arginine, there was some inhibition of growth, and at 20 mM, growth was completely inhibited. Structurally related amino substrates, such as L-ornithine (Fig. 6), L-lysine (results not shown), and GABA (results not shown), and unrelated amino acids (L-proline and L-alanine [results not shown]) at the same concentrations showed no inhibition of growth; therefore, this growth inhibition was specific for arginine. Furthermore, growth inhibition by L-arginine was reduced in AS1 (Fig. 6), as would be predicted from the reduced arginine transport in AS1 cells (Fig. 3A).
|
High concentrations of exogenous L-arginine are cytocidal. To determine whether the effect of exogenous arginine on the growth of wild-type BCG is cytostatic or cytocidal, the cultures described in Fig. 6 were plated to determine CFUs. There was no effect of 10 mM arginine on viability, but the culture containing 20 mM arginine contained no viable cells (data not shown). To confirm this observation, a labeling assay (14) was used to evaluate the metabolic activity of wild-type BCG exposed to exogenous arginine. [3H]uracil incorporation into precipitable macromolecules was inhibited by 50% in wild-type BCG growing in rich medium and incubated in 20 mM L-arginine for 24 h (data not shown). In contrast, the addition of 20 mM L-arginine to BCG resuspended in basal salts medium (starvation conditions) had little effect (10% inhibition) on [3H]uracil incorporation. Thus, the effect of exogenous L-arginine on [3H]uracil incorporation appears to depend on the nutritional state of the culture.
Survival of strain AS1 in cultured murine macrophages. Roles for genes involved in L-arginine transport (30) and metabolism (35) have been implicated in macrophage infection studies (see Discussion). Wild-type BCG, AS1, and AS2 were evaluated for survival in unactivated J774.1 macrophages. No differences were found among the three strains.
| |
DISCUSSION |
|---|
|
|
|---|
Little is known about the regulation of amino acid transport and metabolism in mycobacteria. As a first step to understanding L-arginine metabolism in BCG, we screened the Sanger database for ORFs with homology to the arginine permeases of E. coli, Pseudomonas spp., and B. subtilis. The highest homology pointed to Rv0522, which was homologous to the rocE arginine permease of B. subtilis. Rv0522 also showed 20% identity and 19% similarity to the B. subtilis gabP gene. The BCG homolog of Rv0522 was cloned, interrupted, and crossed onto the chromosome of BCG by gene replacement. The mutant thus constructed, AS1, showed decreased uptake of both L-[14C]arginine and [14C]GABA.
Arginine metabolism has been widely studied in bacteria (see the introduction), and a range of regulatory systems controls the arginine catabolic genes, including those encoding transporters. In the enterics, L-arginine uptake systems are either repressed or unaffected by exogenous L-arginine: the ArgR protein functions largely in the repression of the arginine biosynthetic operons (34). In P. aeruginosa and B. subtilis, exogenous L-arginine induces L-arginine uptake (7, 43).
There are no published reports of L-arginine or GABA transport by the slow-growing mycobacteria. L-arginine transport by the fast-growing species M. phlei has been measured as part of a larger study of the energetics of amino acid transport (45, 54). From our data, we estimate initial uptake rates of L-arginine in the range of only 0.014 nmol/mg/min, which is 10-fold lower than those measured in E. coli (48), P. aeruginosa (52), and Clostridium (50). In B. subtilis, the Km for GABA transport is 37 µM (10). The apparent Kms measured here (L-arginine, 250 µM; GABA, 165 µM) are significantly higher than those described in other systems. The absolute levels of uptake of amino acids described in the present study point to low uptake levels as one possible impediment to utilization of the substrates for growth. In Salmonella enterica serovar Typhimurium for example, L-arginine transport severely limits L-arginine catabolism (31).
Our studies indicate that BCG exhibits unusual patterns of regulation of uptake of both GABA and L-arginine. The GABA utilization genes of B. subtilis, including the permease gene gabP, are regulated independently by nitrogen starvation and amino acid availability, and the organisms can use GABA as the sole nitrogen source (21). Klebsiella aerogenes can use GABA as both a carbon and nitrogen source, and GABA genes are induced by GABA in the medium (22). In E. coli, however, the GABA genes are expressed constitutively at low levels, and this species is incapable of growing on GABA as a sole source of either carbon or nitrogen (20). E. coli mutants with increased expression of the gab regulator (gabC) or the GABA permease (gabP) can grow on GABA (20). Our study shows that BCG does not grow with GABA as the sole carbon and nitrogen source, even at concentrations as high as 50 mM. Furthermore, incubation of cells with GABA (20 mM) as the sole carbon and nitrogen source in a minimal salts medium for 2 h or overnight did not increase the uptake of GABA by BCG. Accumulation of GABA is probably not sufficient to support the cells in the absence of any other carbon and nitrogen sources.
In B. subtilis, nitrogen starvation causes a 26-fold induction of expression of the GABA permease, encoded by the gabP gene. Unlike B. subtilis, the uptake of GABA by BCG was decreased even under conditions of overnight starvation. BCG transported GABA most efficiently when the cells were grown in Middlebrook medium containing appropriate carbon and nitrogen sources. Therefore, this permease is probably expressed when cells are in balanced growth in Middlebrook medium.
After incubation in exogenous L-arginine, arginine uptake
by the mutant was dramatically increased to the levels seen in
wild-type cells incubated in L-arginine. These results
suggest that Rv052 may play a role in L-arginine efflux in
wild-type cells: in the
Rv052 mutant, this efflux
activity may be absent, leading to greatly increased
L-arginine uptake after incubation in exogenous L-arginine. Furthermore, these studies point to the
presence of another L-arginine-responsive permease(s)
expressed in the mutant. One candidate for this permease is a second
rocE homolog discovered in the Sanger database (Rv2320c).
Thus, as in the enterics (11, 53), L-arginine
uptake is carried by more than one permease in BCG. Analysis of the
regulation of expression of the two arginine transporters of M. tuberculosis and BCG (Rv0522 and Rv2320c) gene is under way.
It is puzzling that despite the array of L-arginine catabolic genes, both structural and regulatory, found in the M. tuberculosis databases, L-arginine and related amino acids are not utilized as sole carbon and nitrogen sources by BCG (this study) or M. tuberculosis (Erdman) (N. D. Connell, unpublished data). In addition, there are no previous reports of mycobacterial growth inhibition by any amino acids. Lyon et al. evaluated amino acid utilization by M. tuberculosis, and L-arginine was among the amino acids tested that were degraded, as measured by removal of L-arginine, supplied at 5 mM, from the culture supernatant (33). However, the study did not rely on the stringent test of utilization of these amino acids as the sole carbon or nitrogen source, since ammonium and glycerol were present in the media.
The mechanism by which exogenous L-arginine is growth inhibitory in BCG is not known. In S. enterica serovar Typhimurium, high concentrations of L-arginine (>5 mM) inhibit the enzyme ornithine carbamoyltransferase (ArgF) (1). High concentrations of L-arginine (15 mM) repress arginine biosynthetic enzymes 15-20 fold in Streptomyces coelicolor. In BCG, high concentrations of exogenous L-arginine may repress arginine biosynthesis. L-Arginine accumulation is probably not sufficient for growth but may be high enough to cause a complete repression of arginine biosynthesis. In many bacterial species, L-arginine as a corepressor binds to the ArgR repressor to repress L-arginine biosynthesis (34). Studies of ArgR regulation of L-arginine biosynthesis in BCG and M. tuberculosis are under way in our laboratory. Alternatively, since the enzymes involved in L-arginine synthesis are intimately involved in polyamine synthesis (24), excess L-arginine may lead to alterations in polyamine regulation in BCG.
Interestingly, L-arginine biosynthesis and transport have been shown in a number of pathogenic organisms to be important in intracellular metabolism. Early IVET studies in S. enterica serovar Typhimurium, revealed an L-arginine biosynthetic enzyme (carAB) (35). In Listeria monocytogenes, among the genes expressed preferentially in infected mammalian cells is arpJ, encoding an L-arginine transporter (30). No L-arginine biosynthetic mutants have been analyzed in mycobacterial host cell survival, although an L-arginine tRNA synthetase gene was specifically induced in M. marinum cells in infected macrophages (6). Thus, although shown in different bacterial systems, genes involved in L-arginine synthesis, transport, and incorporation into proteins are all increased during intracellular growth of bacteria. It is well established that L-arginine transport is stimulated in activated macrophages compared with resting macrophages, since L-arginine is absolutely required for the production of nitric oxide in the murine system (4, 8, 25, 29, 49). AS1 did not show a decrease in survival compared to wild-type BCG upon infection of J774.1 murine macrophages. It would be interesting to use multiple mutants of BCG in which more than one permease has been inactivated as probes for exploring possible interactions involving L-arginine between the host macrophage and the infecting mycobacterium.
| |
ACKNOWLEDGMENTS |
|---|
We thank Marty Pavelka for critical reading of the manuscript. We also thank the Molecular Resource Facility at the UMD/NJ Medical School for providing PCR primers and the sequencing facility.
This work was supported in part by Public Health Service Award 2R21AI34436-06A1 to N.D.C., by the Foundation of UMDNJ, and by the New Jersey Medical School National Tuberculosis Center.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, UMDNJ/New Jersey Medical School, 185 South Orange Ave., Newark, NJ 07103. Phone: (973) 972-3759. Fax: (973) 972-3644. E-mail: connell{at}umdnj.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Abdelal, A. T. H.,
E. H. Kennedy, and O. Nainan.
1977.
Ornithine transcarbamylase from Salmonella typhimurium: purification, subunit composition, kinetic analysis and immunological cross-reactivity.
J. Bacteriol.
129:1387-1396 |
| 2. | Ahmad, S., R. K. Bhatnagar, and T. A. Venkitasubramanian. 1984. Influence of carbon and nitrogen sources on arginine biosynthesis in Mycobacterium smegmatis ATCC 14468. Ann. Microbiol. (Paris) 135B:137-146. |
| 3. | Ahmad, S., R. K. Bhatnagar, and T. A. Venkitasubramanian. 1986. Ornithine transcarbamylase from Mycobacterium smegmatis ATCC 14468: purification, properties, and reaction mechanism. Biochem. Cell Biol. 64:1349-1355[Medline]. |
| 4. |
Albina, J. E.,
M. D. Caldwell,
W. L. Henry, Jr., and C. D. Mills.
1989.
Regulation of macrophage functions by L-arginine.
J. Exp. Med.
169:1021-1029 |
| 5. | Balasundaram, D., and A. K. Tyagi. 1989. Modulation of arginine decarboxylase activity from Mycobacterium smegmatis. Evidence for pyridoxal-5'-phosphate-mediated conformational changes in the enzyme. Eur. J. Biochem. 183:339-345[Medline]. |
| 6. | Barker, L. P., D. M. Brooks, and P. L. Small. 1998. The identification of Mycobacterium marinum genes differentially expressed in macrophage phagosomes using promoter fusions to green fluorescent protein. Mol. Microbiol. 29:1167-1177[CrossRef][Medline]. |
| 7. |
Baumberg, S., and C. R. Harwood.
1979.
Carbon and nitrogen repression of arginine catabolic enzymes in Bacillus subtilis.
J. Bacteriol.
137:189-196 |
| 8. | Baydoun, A. R., R. G. Bogle, J. D. Pearson, and G. E. Mann. 1993. Arginine uptake and metabolism in cultured murine macrophages. Agents Actions 38:127-129[CrossRef]. |
| 9. |
Bhatt, A.,
R. Green,
R. Coles,
M. Condon, and N. D. Connell.
1998.
A mutant of Mycobacterium smegmatis defective in dipeptide transport.
J. Bacteriol.
180:6773-6775 |
| 10. | Brechtel, C., and S. King. 1998. 4-Aminobutyrate (GABA) transport from the amine-polyamine-choline superfamily: substrate specificity and ligand recognition profile of the 4-aminobutyrate permease from Bacillus subtilis. Biochem. J. 333:565-571. |
| 11. |
Celis, R.,
H. J. Rosenfeld, and W. K. Maas.
1973.
Mutants of Escherichia coli K-12 defective in the transport of basic amino acids.
J. Bacteriol.
116:619-626 |
| 12. |
Celis, R. T. F.
1981.
Chain-terminating mutants affecting a periplasmic binding protein involved in the active transport of arginine and ornithine in Escherichia coli.
J. Biol. Chem.
256:773-779 |
| 13. | Celis, R. T. F. 1984. Mapping of two loci affecting the synthesis and structure of a periplasmic protein involved in arginine and ornithine transport in Escherichia coli K-12. J. Bacteriol. 151:1314-1319. |
| 14. |
Chan, J.,
Y. Xing,
R. S. Magliozzo, and B. R. Bloom.
1992.
Killing of virulent Mycobacterium tuberculosis by reactive nitrogen intermediates produced by activated murine macrophages.
J. Exp. Med.
175:1111-1122 |
| 15. |
Clemens, D. L.,
B. Y. Lee, and M. A. Horwitz.
1995.
Purification, characterization, and genetic analysis of Mycobacterium tuberculosis urease, a potentially critical determinant of host-pathogen interaction.
J. Bacteriol.
177:5644-5652 |
| 16. | Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544[CrossRef][Medline]. |
| 17. | Connell, N. D. 1994. Mycobacterium: isolation, maintenance, transformation and mutant selection. Methods Cell Biol. 45:107-125[Medline]. |
| 18. | Connell, N. D., and H. Nikaido. 1994. Membrane permeability and transport, p. 333-352. In B. R. Bloom (ed.), Tuberculosis: pathogenesis, protection and control. ASM Press, Washington, D.C. |
| 19. | Donnelly, M. I., and R. A. Cooper. 1981. Succinic semialdehyde dehydrogenases of Escherichia coli. Eur. J. Biochem. 113:555-561[Medline]. |
| 20. |
Dover, S., and Y. S. Halpern.
1972.
Utilization of -aminobutyric acid by Escherichia coli K-12 mutants.
J. Bacteriol.
109:835-843 |
| 21. | Ferson, A. E., L. V. Wray, Jr., and S. H. Fisher. 1996. Expression of the Bacillus subtilis gabP gene is regulated independently in response to nitrogen and amino acid availability. Mol. Microbiol. 22:693-701[CrossRef][Medline]. |
| 22. |
Friedrich, B., and B. Magasanik.
1978.
Utilization of arginine by Klebsiella aerogenes.
J. Bacteriol.
133:680-685 |
| 23. | Gardan, R., G. Rapoport, and M. Debarbouille. 1995. Expression of the rocDEF operon involved in arginine catabolism in Bacillus subtilis. J. Mol. Biol. 23:843-856. |
| 24. | Glansdorff, N. 1996. Biosynthesis of arginine and polyamines. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, A. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. ASM Press, Washington, D.C. |
| 25. | Granger, D. L., J. B. Hibbs, Jr., J. R. Perfect, and D. T. Durack. 1990. Metabolic fate of L-arginine in relation to microbiostatic capability of murine macrophages. J. Clin. Investig. 85:264-273. |
| 26. | Hanahan, D. 1983. Studies of transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580[Medline]. |
| 27. | Jacobs, W. R., Jr., G. V. Kalpana, J. D. Cirillo, L. Pascopella, S. B. Snapper, R. A. Udani, W. Jones, R. G. Barletta, and B. R. Bloom. 1991. Genetic systems for mycobacteria. Methods Enzymol. 204:537-555[Medline]. |
| 28. |
Jarlier, V., and H. Nikaido.
1990.
Permeability barrier to hydrophilic solutes in Mycobacterium chelonae.
J. Bacteriol.
172:1418-1423 |
| 29. | Keller, R., R. Gehri, R. Keist, E. Huf, and F. H. Kayser. 1991. The interaction of macrophages and bacteria: a comparative study of the induction of tumoricidal activity and of reactive nitrogen intermediates. Cell. Immunol. 134:249-256[CrossRef][Medline]. |
| 30. | Klarsfeld, A. D., P. L. Goossens, and P. Cossart. 1994. Five Listeria monocytogenes gene preferentially expressed in infected mammalian cells: plcA, purH, purD, pyrE, and an arginine ABC transporter, argJ. Mol. Microbiol. 13:585-597[Medline]. |
| 31. |
Kustu, S. G.,
N. C. McFarland,
S. P. Hui,
B. Esmon, and G. F.-L. Ames.
1979.
Nitrogen control in Salmonella typhimurium: coregulation of synthesis of glutamine synthetase and amino acid transport systems.
J. Bacteriol.
138:218-234 |
| 32. |
Lee, M. H.,
L. Pascopella,
W. R. J. Jacobs, and G. F. Hatfull.
1991.
Site-specific integration of mycobacteriophage L5: integration-proficient vectors for Mycobacterium smegmatis, BCG and M. tuberculosis.
Proc. Natl. Acad. Sci. USA
88:3111-3115 |
| 33. |
Lyon, R. H.,
W. H. Hall, and C. Costas-Martinez.
1970.
Utilization of amino acids during growth of Mycobacterium tuberculosis in rotary cultures.
Infect. Immun.
1:513-520 |
| 34. |
Maas, W. K.
1994.
The arginine repressor of Escherichia coli.
Microbiol. Rev.
58:631-640 |
| 35. |
Mahan, M. J.,
J. M. Slauch, and J. J. Mekalanos.
1993.
Selection of bacterial virulence genes that are specifically induced in host tissues.
Science
259:686-688 |
| 36. | Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 37. | Marger, M. D., and M. H. Saier, Jr. 1993. A major superfamily of transmembrane facilitators that catalyze uniport, symport and antiport. Trends Biochem. Sci. 18:13-20[CrossRef][Medline]. |
| 38. | Marinus, M. 1973. Location of DNA methylation genes on the Escherichia coli K-12 genetic map. Mol. Gen. Genet. 127:47-55[CrossRef][Medline]. |
| 39. |
Marquis, H.,
H. G. A. Bouwer,
D. J. Hinrichs, and D. A. Portnoy.
1993.
Intracytoplasmic growth and virulence of Listeria monocytogenes auxotrophic mutants.
Infect. Immun.
61:3756-3760 |
| 40. | Masood, R., and T. A. Venkitasubramanian. 1987. Role of various carbon and nitrogen sources in the regulation of enzymes of pyrimidine biosynthesis in Mycobacterium smegmatis TMC 1546. Ann. Inst. Pasteur Microbiol. 138:501-507[CrossRef][Medline]. |
| 41. | McNeil, M. R., G. S. Besra, and P. J. Brennan. 1996. Chemistry of the mycobacterial cell wall, p. 171-186. In W. N. Rom, and S. M. Garay (ed.), Tuberculosis. Little, Brown & Co., New York, N.Y. |
| 42. | Mountain, A., and S. Baumberg. 1980. Map mutations of some mutations conferring resistance to arginine hydroxamate in Bacillus subtilis. Mol. Gen. Genet. 178:691-701[CrossRef][Medline]. |
| 43. |
Nishijyo, T.,
S. Park,
C. Lu,
Y. Itoh, and A. Abdelal.
1998.
Molecular characterization and regulation of an operon encoding a system for transport of arginine and ornithine and the ArgR regulatory protein in Pseudomonas aeruginosa.
J. Bacteriol.
180:5559-5566 |
| 44. |
Prasad, R.,
V. K. Kalra, and A. F. Brodie.
1976.
Different mechanisms of energy coupling for transport of various amino acids in cells of Mycobacterium phlei.
J. Biol. Chem.
251:2493-2498 |
| 45. | Ratledge, C. 1982. Nutrition, growth and metabolism, p. 186-212. In C. Ratledge, and J. Stanford (ed.), The biology of the mycobacteria, vol. I. Academic Press, London, United Kingdom. |
| 46. |
Reyrat, J. M.,
F. X. Berthet, and B. Gicquel.
1995.
The urease locus of Mycobacterium tuberculosis and its utilization for the demonstration of allelic exchange in Mycobacterium bovis bacillus Calmette-Guerin.
Proc. Natl. Acad. Sci. USA
92:8768-8772 |
| 47. | Reyrat, J. M., G. Lopez-Ramirez, C. Ofredo, B. Gicquel, and N. Winter. 1996. Urease activity does not contribute dramatically to persistence of Mycobacterium bovis bacillus Calmette-Guerin. Infect. Immun. 64:3934-3936[Abstract]. |
| 48. |
Rosen, B. P.
1973.
Basic amino acid transport in Escherichia coli: properties of canavanine-resistant mutants.
J. Bacteriol.
116:627-635 |
| 49. | Shibazaki, T., M. Fujiwara, H. Sato, K. Fujiwara, K. Abe, and S. Bannai. 1996. Relevance of the arginine transport activity to the nitric oxide synthesis in mouse peritoneal macrophages stimulated with bacterial lipopolysaccharide. Biochim. Biophys. Acta. 1311:150-154[Medline]. |
| 50. |
Speelmans, G.,
G. Poolman, and W. Konings.
1993.
Amino acid transport in the thermophilic anaerobe Clostridium fervidus is driven by an electrochemical sodium gradient.
J. Bacteriol.
175:2060-2066 |
| 51. | Stover, C. K., V. F. de la Cruz, T. R. Fuerst, J. E. Burlein, L. A. Benson, L. T. Bennet, G. P. Bansal, J. F. Young, M. H. Lee, G. F. Hatfull, S. B. Snapper, R. G. Barletta, J. Jacobs, W. R., and B. R. Bloom. 1991. New use of BCG for recombinant vaccines. Nature 351:456-460[CrossRef][Medline]. |
| 52. |
Verhoogt, H. J. C.,
H. Smit,
T. Abee,
M. Gamper,
A. J. M. Driessen,
D. Haas, and W. N. Konings.
1992.
arcD, the first gene of the arc operon for anaerobic arginine catabolism in Pseudomonas aeruginosa, encodes an arginine-ornithine exchanger.
J. Bacteriol.
174:1568-1573 |
| 53. | Wissenbach, U., S. Six, J. Bongaerts, D. Ternes, S. Steinwachs, and G. Unden. 1995. A third periplasmic transport system for L-arginine in Escherichia coli: molecular characterization of the artPIQMJ genes, arginine binding and transport. Mol. Microbiol. 17:675-686[CrossRef][Medline]. |
| 54. |
Yabu, K.
1970.
Amino acid transport in Mycobacterium smegmatis.
J. Bacteriol.
102:6-13 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»