INTRODUCTION

Top Abstract Introduction Materials and Methods Results and Discussion References

NBUs (nonreplicating Bacteroides units) are 10- to 12-kbp integrated elements that can be excised and mobilized in trans by tetracycline-inducible Bacteroides conjugative transposons. Two regions of NBU1, the best studied of the NBUs, have been characterized. The NBU1 integrase gene, intN1, is located near one end of the element and is transcribed away from the end. This gene and the upstream NBU1 integration region, attN1, are necessary and sufficient for integration. IntN1 is a member of the phage lambda family of site-specific integrases, although it is only distantly related to the phage lambda integrase (26). In Bacteroides species, NBU1 integration is site specific and the primary target site contains a 14-bp sequence that is located in the 3' end of the Leu-tRNA gene. NBU1 also integrates in Escherichia coli, but the integration is less specific and the target site sequences have only partial identity to the Bacteroides 14-bp target site sequence (26, 27). In both Bacteroides and E. coli, the integration of NBU1 is independent of RecA (6).

A second region of NBU1 has been characterized previously, a 2-kbp region near the center of the element which is necessary for mobilization of the circular form. This region contains the transfer origin (oriT) and the mobN1 gene, which encodes the protein that nicks at the oriT during mobilization (15, 16). MobN1 is a distant relative of the IncP TraI (16, 30). Genes similar to mobN1 have also been found on the mobilizable Bacteroides transposon Tn4555, the mobilizable Bacteroides plasmids pBI143 and pIP421, and the mobilizable gram-positive bacterial plasmid pMV158 (9, 30, 31, 33, 40). All of the small Bacteroides plasmids and the 10- to 12-kbp integrated elements are mobilized not only by Bacteroides conjugative transposons but also by the IncP plasmids of the enterics (15-17, 24, 28, 30, 40, 41). Smith and Parker (31) have located the nic site in the oriT on Tn4555. Since the DNA sequence of NBU1 is 86% identical to Tn4555 in this region, the NBU1 nic site is probably in the same place. Although NBU1 and Tn4555 have high DNA sequence identity in the oriT-mob region (78%), they appear to be quite different outside this region (16, 26, 39).

We report here the complete sequence of NBU1 and define the region of NBU1 that is necessary for its excision and for formation of the circular transfer intermediate. This region proved to be unexpectedly large and contains six open reading frames. By contrast, phage lambda needs only its integrase and one small basic protein, Xis, for excision (1). However, lambda does not have an oriT. The gram-positive bacterial conjugative transposon Tn916 does have an internal oriT, but the promoter for the transfer functions and the operon for the transfer genes are separated when the element is integrated. The transfer functions that nick at the oriT of Tn916 are not made until the element has excised and circularized (4). We propose that the more complex excision system of NBU1 may be needed because the transfer functions are provided in trans by the conjugative transposons. The efficient excision of NBU1 requires the coordination of excision (nicking at the ends) with the nicking at the internal oriT, the step that initiates the transfer of the circular intermediate.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results and Discussion References

Bacterial strains and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. E. coli DH5MCR (Gibco BRL) was used for most of the cloning and vector construction. E. coli strains S17-1 (29) and DH5MCR were used as host strains for the donors, and DH5MCR was the E. coli recipient in Bacteroides-to-E. coli matings. These strains were grown aerobically on Luria-Bertani broth or agar. The following antibiotic concentrations were used unless otherwise noted: ampicillin, 100 µg/ml; chloramphenicol, 20 µg/ml; and kanamycin, 50 µg/ml.

Bacterial conjugations. The procedures for filters matings between E. coli and Bacteroides strains have been previously described (6, 24, 41). Mating conditions were used which favored the donor: aerobic for E. coli donors and anaerobic for Bacteroides donors. Insertional and replicative shuttle vectors were mobilized from E. coli donors either by one of the IncP plasmids, R751 or RP4, or by transfer functions of RP4 integrated in the chromosome of S17-1 (29). The transfer functions of the conjugative transposon CTnERL were used to mobilize vectors out of Bacteroides donors to either Bacteroides or E. coli recipients.

DNA isolation and Southern blot analysis. Plasmids were isolated from E. coli and Bacteroides strains by using the Ish Horowitz modification of the alkaline lysis prodedure (21). Total DNA was isolated by a modification of the method described by Saito and Miura (20). Following the phenol extraction step, 0.8 volume of isopropanol was added all at once instead of gradually. After allowing at least 1 h for precipitation at room temperature, the precipitated nucleic acids were centrifuged. The pellet was washed with cold 70% ethanol, dried, and resuspended in TE (0.01M Tris, 0.001 M EDTA [pH 8]) containing 50 µg of RNase per ml. The preparation contained chromosomal DNA (usually observed as a clump in the isopropanol step), plasmids, and the tetracycline-induced excised closed circular forms of NBU1.

GUS assays of transcriptional fusions. The -glucuronidase (GUS) gene (uidA) from E. coli was cloned into insertional or replicative vectors to detect transcription of the genes in NBU1. The NBU1 open reading frames (ORFs) determined from the sequencing results were checked for transcription strength by using an internal fragment cloned in the insertional vector, pCQW1 (8), and by cloning the upstream region or possible promoter region into the replicative vector pMJF2 (8). The assays were done as previously described (8).

PCR analysis of NBU1 excision. PCR was used to determine if the target site of NBU1 following excision was intact or whether a copy of NBU1 remained in the site. The target was re-formed, and the PCR product was sequenced. The primers used were FT1-5' (TCTAAATACAGAAGCCTTTGGA) and RT1-5' (TCGAAAACCTTCTGGTAGTGCA), and they produced a 295-bp product. A 2-µl volume of a DNA preparation from a tetracycline-induced B. thetaiotaomicron strain containing a derivative of NBU1 integrated in the chromosome and CTnERL was used as the template for the PCR. The cycling conditions were as follows: (i) 5 min at 95°C followed by addition of Taq polymerase; (ii) 25 to 30 cycles of 1 min at 94°C, 1 min at 60°C, and 2 min at 72°C; and (iii) final extension of 10 min at 72°C. The PCR products were sequenced directly following purification using the Promega PCR cleanup kit or were cloned into the Promega PCR cloning vector, p-GEM-T, for sequencing.

Cloning of the minimal region of NBU1 required for insertion and excision. The insertional vector, pNV19 (26), which was constructed previously for use in studies to determine the minimal region of NBU1 required for integration, was used to clone additional regions of NBU1 to determine the sequences required for both integration and excision. This vector contains the mobilization region of pB8-51 that is recognized by the IncP plasmids and by CTnERL for mobilization of the vector. The pNV19::NBU1 constructs (Table 1) were mobilized from E. coli to Bacteroides recipients, and excised forms of the vector could be mobilized by CTnERL from Bacteroides to E. coli. The integration of the constructs (pNV19::NBU1) into the primary target site was verified by Southern blots. The possible excision of the pNV19::NBU1 constructs was determined by tetracycline induction of the regulatory region of CTnERL followed by Southern blot or PCR analysis as described above. When the oriT-mobN1 region was shown to be included in the region required for excision, a second vector with no mobilization region recognized by Bacteroides was used and several of the NBU1 fragments were retested for excision. The vector, pGERM, is pUC19 with the RK2 oriT 782-bp HaeII fragment (L27758; bp 50590 to 51377), which allows mobilization by IncP plasmids in E. coli hosts, and the ermG of CTn7853 (L42817), which provides a selectable erythromycin resistance marker in Bacteroides spp. The 7.7-kbp Sph1 fragment from pNW18 containing the NBU1 sequences was cloned into pGERM(pG-Sph18) and was shown by Southern blotting and PCR analysis to excise normally. Various deletions of the 7.7-kbp SphI fragment were made, cloned into pGERM, and used to determine the minimal region required for excision. Internal deletions of prmN1 and orf3 were also constructed and tested for their effect on excision (Table 1; also see Fig. 2).

DNA sequencing and analysis. Various regions of NBU1 were cloned into pUC19 derivatives. The DNA was sequenced at the University of Illinois Biotechnology Facility using the Applied Biosystems model 373A version 2.0.1S dye terminator sequencing system. The sequencing was completed by primer walking and by sequencing of PCR products across restriction sites. The resulting nucleotide and amino acid sequences were used to search the various databases by using Gapped Blast and Psi-Blast programs (2). The GenBank accession numbers for the oriT-mobN1 region (15) and the attN1-intN1 (26) are L13840 and U51917, respectively. The entire NBU1 sequence has been submitted.

	RESULTS AND DISCUSSION

Top Abstract Introduction Materials and Methods Results and Discussion References

Sequence analysis of NBU1. Previously, about 3.5 kbp of NBU1 had been sequenced. We have now completed the entire NBU1 sequence. The analysis of the sequence revealed that NBU1 is 10,276 bp in size and that it contains 12 possible ORFs (Figs. 1 and 2). There were no Sau3A (GATC) sites in the entire element. The lack of GATC sites in Bacteroides sequences has been noted before and may be one of the reasons why large clones of Bacteroides DNA are difficult to maintain in E. coli hosts such as cosmid clones (23, 33; unpublished data). The lack of GATC sites in NBU1 suggests that NBU1 originated in Bacteroides or has been in Bacteroides spp. long enough to acquire the trait. This is consistent with the G+C content of most of the ORFs on NBU1, which were close to the range of 40 to 43% seen in Bacteroides spp. genomes. Some exceptions were orf6, orf7, and orf8, which had lower G+C contents and could thus have come from outside the Bacteroides spp. As will be evident from a later section, these ORFs play no role in excision or transfer.

View larger version (29K): [in this window] [in a new window]   FIG. 1.   Excised circular form of NBU1. When NBU1 is induced to excise out of the Bacteroides chromosomal target site, it forms the double-stranded circular form shown in the map. The circular form is the transfer intermediate of the element. The regions required for integration, attN1 and intN1, and mobilization, oriT and mobN1, are indicated by the arcs. The possible ORFs and the locations of the known genes are labeled and are described in Table 2. The sites are numbered relative to the PvuII site. Y5, Y11, and Y17 are the sites where the mobilization-defective vector, pEG920, integrated into the circular form of NBU1. The excision and formation of the circular form of NBU1 are detected on Southern blots by using the 1.7-kbp HincII fragment (bp 2697 to 4359) that contains the NBU1 joined ends as the probe. XRS is the extended region between prmN1 and Y17 that is necessary in cis for the excision of NBU1.

View larger version (24K): [in this window] [in a new window]   FIG. 2.   Regions of NBU1 required for excision. NBU1 is shown integrated in the Bacteroides target site. The chromosomal Leu-tRNA gene in the chromosomal target site is located upstream of attN-L. The possible ORFs and known genes are labeled, and the locations of the integrated forms of pEG920 insertion vectors, pY5D in orf3, pY11D in prmN1, and pY17 in mobN1, are indicated. The insertion sites and orientations of the uidA reporter vector, pCQW1, are indicated by the arrows above the map. The insertions were tested for their effect on the excision of NBU1 and the level of transcription of the ORFs as measured by the production of GUS from the pCQW1 insertions. Excision was determined by the detection of the NBU1 joined ends on Southern blots, and the results are expressed relative to the intensity observed for wild-type NBU1: wild excision (++) and weak but detectable excision (+/). Transcription levels of the various pCQW insertions are relative to the GUS activity for the insertion in intN1: 7 U/mg of protein (++) and <0.2 U/mg of protein (). Transcription could not be measured for the pY5D and pY11D insertions (not applicable [na]). The subcloned region of NBU1 required for both integration and excision on pNW18 and subcloned on a 7.7-kbp SphI fragment into pGERM, pG-Sph18, is indicated below the map. None of the ORFs between PvuII and attN-L are required for either integration or for excision. Other NBU1 subclones of the 7.7-kbp SphI fragment in pGERM used to determine the region required for excision are also shown: SphI-AvaI, Sph-HindIII, and pG-Sph18 with deletions in prmN1 (prm, pG-Sph18prm) and orf3 (orf3, pG-Sph18orf3). The 220-bp oriT, required in cis for mobilization, is also part of the XRS between prmN1 and Y17 that is required in cis for NBU1 excision. The excision (+) or lack of excision () of each subclone is shown to the right.

Genes essential for excision. Previously we showed that the region consisting of the NBU1 closed ends (attN1) and the intN1 gene were sufficient for integration into the primary NBU1 target site but were not sufficient for excision (Fig. 1) (26). IntN1 is a member of the lambda integrase family, although the amino acid similarity is relatively low and is confined to the C-terminal end. The integrases of the gram-positive bacterial conjugative transposons Tn916 and Tn5276 are also members of the lambda integrase family (18, 38). Like lambda, both Tn916 and Tn5276 have a small gene downstream of the integrase gene that has characteristics similar to those of lambda Xis, a protein essential for excision of phage lambda from the chromosome. The function of the cognate gene on Tn916 has been shown in in vitro assays to facilitate the excision of Tn916 (19). Accordingly, we expected a similar int-xis gene organization on NBU1. This proved not to be the case.

Minimum region required for NBU1 excision. To determine whether any DNA other than intN1, orf2, orf3, and prmN1 was required for excision, subcloning was used to determine the minimum size of an excision-proficient element. A 9.3-kbp region of NBU1 was cloned to produce pNW17 (Table 1). pNW17 replicates in E. coli but not in Bacteroides spp. and can be mobilized by both IncP plasmids and Bacteroides conjugative transposons (CTns). pNW17 was transferred into B. thetaiotaomicron BT4104, where it integrated into the primary target site of NBU1 via the ends of NBU1 to produce BT4104pNW17. When BT4104pNW17, which contained a copy of CTnERL as well as integrated pNW17, was grown in the presence of tetracycline, pNW17 excised at levels similar to that seen for wild-type NBU1. Since excised pNW17 could be mobilized back to E. coli by CTnERL, the level of excision could be semiquantitated by a mating-out assay. The excision and transfer of pNW17 to E. coli and Bacteroides recipients occurred at frequencies of 10⁵ to 10⁶ per recipient, frequencies similar to that estimated previously for wild-type NBU1 (6, 28). The excision of pNW17 could also be demonstrated directly by Southern blot analysis using a probe containing the joined ends of the circular-form NBU1 similar to that seen in Fig. 3B below. The fact that the joined ends of NBU1 could be detected in the circular form also confirmed that pNW17 was excising like NBU1. This was further confirmed by the DNA sequence of the PCR amplified product of the joined ends. Using the mating-out assay, we found that the excision and transfer frequencies of both pY5D and pY11D (Fig. 2) from BT4104 to E. coli recipients were 50- to 100-fold lower than that observed for pNW17, which correlated to the decreased excision observed by Southern blot analysis.

Attempt to detect transcription of orf2, orf3, and prmN1. In an attempt to detect transcription of the ORFs downstream of intN1, disruptions were made in each of the ORFs in this region by using pCQW1 (Table 1) (6), a suicide vector that has the promoterless E. coli GUS uidA gene downstream of the cloning site. The results are summarized in Figure 2. Although expression of intN1 was easily detectable, no GUS activity was detected in any of the other fusions. In our experience, GUS is not a very sensitive indicator of gene expression, and so expression could well have been below the level of detection. Clearly, however, if the intN1 promoter is running downstream genes, there is a significant shutdown of transcripts after the end of intN1. An interesting feature of the pCQW1 insertion in the middle of the prmN1 (made with a 377-bp internal fragment, bp 7712 to 8089) was that this disruption mutant excised as efficiently as the wild type. This disruption cut about 300 bp off the 3' end of the gene. This is further evidence that the N-terminal part of PrmN1 is responsible for most or all of its activity. Another conclusion from this experiment is that prmN1 does not have to be immediately adjacent to the oriT in order to function, because inserting a large (7.8-kbp) DNA segment in this region can be done without impairing excision.

Excision is conservative and restores the integration site. Although evidence cited in previous sections suggested that PrmN1 was not functioning as a DNA primase, there was one remaining possible role for a primase. Previously, on the basis of Southern blot analysis, we assumed that excision was a conservative rather than a replicative process, which completely removed the NBU1 from its integration site and restored the integration site. This assumption had not, however, been tested directly. To test it, PCR primers were used to amplify the integration site after NBU1 had been induced to excise by exposing the cells to tetracycline. When wild-type NBU1, pNW17, pNW18, and pG-Sph18 were induced for excision, PCR products of the regenerated target sites were observed (data not shown). The sequences of these target site PCR products were identical to the sequence of the site before NBU1 integrated. Thus, excision is conservative rather than replicative and restores the integration site. Taken together with other evidence, this suggests strongly that PrmN1 is not functioning as a primase.

Some segments of NBU1 inhibit excision. Attempts to complement some of the insertion and deletion mutants were unsuccessful. That is, no excision was detected when the cloned region was provided in trans. It was possible that the apparent failure to complement mutations in NBU1, especially the clones that contained the region downstream of intN1, resulted from inhibition of NBU1 excision due to the presence of the cloned regions in multiple copies. DNA sequences that bind regulatory proteins or other factors made in limiting concentrations in the cell can titrate such factors when cloned on multicopy vectors. This was observed for regulated promoter regions in the starch utilization operon of B. thetaiotaomicron 5482 (7). Overproduction of gene products could also interfere with carefully regulated operations, for example factors necessary for the excision of NBU1, by changing the stoichiometry of the excision complex. Several of the pNLY1, pLYL05, and pLYL7 vectors (Table 1) containing cloned regions of NBU1 were tested for their effect on the excision of a wild-type NBU1 in BT4104N1-3 (Fig. 3). Fragments 1 (4.5-kbp HindIII fragment, bp 4502 to 9056) and 5 (2-kbp fragment, SstI on pY5D to HindIII bp 9056) completely inhibited the excision of wild-type NBU1. Fragment 5 was separated into two overlapping clones: fragment 6, containing prmN1-oriT (SstI pY5D to AvaI), and fragment 7, containing XRS_HIII (HindIII of pY11D to HindIII bp 9056). Neither fragment 6 nor fragment 7 had any effect on the excision of NBU1 (Fig. 3B, lanes 6 and 7). Thus, PrmN1 plus the XRS_HIII were required for the inhibition of excision observed with fragment 5. Fragment 4 (mobN1-XRS) reduced excision by about 70% but did not entirely eliminate it (lane 4a). A deletion of the oriT portion of XRS on fragment 4, leaving the XRS through mobN1 region from AvaI to PvuII, no longer reduced the NBU1 excision (data not shown). This suggests that interaction of MobN1 with the oriT part of XRS was involved in the partial inhibition of excision by fragment 4. Fragment 3 contained all three of the regions, prmN1-XRS-mobN1, on pLYL7 (15) (Table 1), but this clone did not reduce excision like fragment 4 and did not inhibit excision like fragment 5. Thus, the inclusion of mobN1 on fragment 3 prevented the inhibition of NBU1 excision observed with fragment 5. Functions on CTn that must interact with MobN1 and oriT for transfer of the circular intermediate are probably not required for excision. However, the interactions of CTn functions with MobN1 and/or oriT may be contributing to the differences observed between fragment 3 and fragment 5 on NBU1 excision.

View larger version (23K): [in this window] [in a new window]   FIG. 3.   Effects of fragments cloned in trans on NBU1 excision. Regions of NBU1 (A) were cloned onto shuttle vectors and transferred into Bacteroides strain BT4104N1-3, which contained the conjugative transposon, CTn-ERL, and an integrated copy of NBU1. The effect of the cloned fragments on the excision of the wild-type copy of NBU1 was determined by Southern blotting (B) and indicated as Yes for excision and No for no excision at the right. (B) Southern blot of the HincII-digested DNA preparations of the strains containing the various cloned fragments shown in panel A. Wild-type NBU1 excision is shown in the strain that contained vector with no insert (None). The probe was the 1.7-kbp HincII fragment of NBU1 containing the joined ends (Fig. 1). Excision of NBU1 was observed as the appearance of the 1.7-kbp HincII fragment containing the joined ends of the NBU1 circular form, indicated by the arrow. The positions of the attN-L and attN-R junctions are indicated. The HindIII size standards of lambda are in the left lane (stds). No excision was detected without induction of the CTnERL regulatory operon containing rteA and rteB by growth of the strains in tetracycline (Tc + versus Tc ). The effect of additional RteA and RteB provided by the coresident plasmid, pAMS9, is shown for fragments 4 and 5 in lanes 4b and 5b, respectively. Note that fragment 3 allowed NBU1 excision in BT4104N1-3 at wild-type levels but later experiments showed that it completely inhibited NBU1 excision like fragment 5 if only the regulatory region of the CTn was present in strain BT4100N1-S1(pAMS9).

Preliminary model for CTn-regulated NBU1 excision and transfer. A model that accounts for all of the data provided here is shown in Fig. 4. The basic premise of the model is that for efficient transfer of an intact NBU1 to a recipient, it is important that the MobN1 is prevented from nicking at the internal oriT prior to the completion of the excision and circularization of NBU1. If nicking at the oriT and strand transfer begins before excision is completed, the element could function like an F-mediated Hfr and only part of the element would be transferred. Conversely, after the circular intermediate has been formed, it is equally important that the oriT then become available for interaction with the MobN1 so that transfer functions furnished by the conjugative transposon can interact with the MobN1-oriT complex for conjugal transfer of the element. The model in Fig. 4A posits that the NBU1 monitors its excision status by the protein-protein complex that forms on the integrated form and on the circular form. The protein complex that forms on the integrated NBU1 both excises the element and blocks oriT until excision is complete. Once the NBU1 has circularized, the protein complex disassociates so that no nicking occurs at the joined ends of the circular form and nicking by Mob can occur at oriT.

View larger version (29K): [in this window] [in a new window]   FIG. 4.   Model for the NBU1 excision process. (A) The normal process for NBU1 excision. The regulatory factors RteA and RteB on the conjugative transposon are induced by growth of the strain in tetracycline. The mechanism of the interaction(s) between RteA and RteB and NBU1 is not known. IntN1 is shown forming complexes with the junctions of NBU1, attN-L, and attN-R. Orf2 is also required for excision and may be involved in the complexes. Host factors such as integration host factor (IHF) are also suspected to be involved. PrmN1 is shown binding to the XRS region. The extent of the XRS which includes both the oriT region and the N-terminal region of mobN1 strongly suggests the possibility that MobN1 is also involved in this complex. The PrmN1-XRS complex interacts with the junction complexes, possibly sequentially, and aligns the ends in a conformation required for excision of NBU1. (B) Effect of multiple copies of the PrmN1-XRS region produced from fragment 5 on the excision of NBU1. The extra PrmN1-XRS complexes produced by the plasmid copies interact with the two IntN1-junction complexes and prevent the correct alignment of the ends of the element dictated by the single copy of the PrmN1-XRS in cis. Disruption of the stoichiometry of the reaction prevents NBU1 excision.