This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sezonov, G.
Right arrow Articles by Guérineau, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sezonov, G.
Right arrow Articles by Guérineau, M.

 Previous Article  |  Next Article 

Journal of Bacteriology, March 2000, p. 1243-1250, Vol. 182, No. 5
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

KorSA from the Streptomyces Integrative Element pSAM2 Is a Central Transcriptional Repressor: Target Genes and Binding Sites

Guennadi Sezonov,dagger Christophe Possoz, Annick Friedmann, Jean-Luc Pernodet, and Michel Guérineau*

Laboratoire de Biologie et Génétique Moléculaire, Institut de Génétique et Microbiologie, UMR CNRS 8621, Université Paris-Sud, 91405 Orsay, France

Received 15 July 1999/Accepted 29 November 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

pSAM2, a 10.9-kb mobile integrative genetic element from Streptomyces ambofaciens, possesses, as do a majority of Streptomyces conjugative plasmids, a kil-kor system associated with its transfer. The kor function of pSAM2 was attributed to the korSA gene, but its direct role remained unclear. The present study was focused on the determination of the KorSA targets. It was shown that KorSA acts as a transcriptional repressor by binding to a conserved 17-nucleotide sequence found upstream of only two genes: its own gene, korSA, and pra, a gene positively controlling pSAM2 replication, integration, and excision. A unique feature of KorSA, compared to Kor proteins from other Streptomyces conjugative plasmids, is that it does not directly regulate pSAM2 transfer. KorSA does not bind to the pSAM2 genes coding for transfer and intramycelial spreading. Through the repression of pra, KorSA is able to negatively regulate pSAM2 functions activated by Pra and, consequently, to maintain pSAM2 integrated in the chromosome.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

A large number of mobile genetic elements, including plasmids and integrative elements capable of site-specific integration into the chromosome, have been identified in Streptomyces, Saccharopolyspora, Amycolatopsis, and other gram-positive bacteria belonging to the order Actinomycetales (12, 18). Most of the Streptomyces elements are self-transmissible and able to mobilize chromosomal markers. Transfer in Streptomyces is usually associated with pock formation characterized by a local inhibition of growth and development of the recipient strain in contact with the donor strain (1, 12). Bacterial plasmids often contain conditionally lethal genes (reviewed in reference 9). Certain genes (kil genes) specify functions lethal to either the host or the plasmid, while others (kor genes) encode products that control expression of the kil phenotype. It is impossible to obtain transformants with derivatives in which the kor gene is inactivated. The presence of a kil-kor system associated with transfer has been identified for all Streptomyces plasmids able to form pocks during conjugative transfer. The kil function was attributed to the tra genes (transfer genes), whose expression was lethal in the absence of the kor gene. Most of the identified kor genes code for proteins that belong to the GntR family of transcriptional regulators (8) and contain in their sequences a DNA binding motif. For all known cases, Kor directly regulates the expression of tra and also the transcription of its own gene. The best-studied Streptomyces plasmid, pIJ101, carries two kil-kor systems, kilA-korA and kilB-korB (16), and both KorA and KorB directly regulate the expression of the genes involved in transfer as well as their own synthesis (16, 26, 27). The different affinities of the processed form of KorB for its operators situated in the promoters of kilB and korB (34) allow it to maintain the repression established by KorB (29). For pSN22, the TraR (Kor) binding sites were located in the overlapping promoters of the traR gene and the traA-traB-spdB operon (14, 15). Conjugative plasmid pSG5 from Streptomyces ghanaensis, which is unable to form pocks during its transfer, is the only known example in which the tra gene (major transfer gene) does not represent a kil function. A gene similar to kor was found in its sequence, but its direct role remains unknown (17).

The organization of the kil-kor system for integrative elements follows the same pattern, with the Kor protein being indispensable for the transcriptional repression of the tra gene. The kil-kor systems of the integrative element pMEA300 from Amycolatopsis methanolica (31) and of SLP1 from Streptomyces coelicolor (4) are examples. ImpA (Kor) of SLP1, which is thought to be a regulator of SLP1 transfer, can bind to a 16-bp operator situated in the promoter of its own gene (24).

pSAM2 is present as one integrated copy in the chromosome of Streptomyces ambofaciens strain B2 (pSAM2B2) and is found simultaneously as one integrated copy and 5 to 10 replicating copies per genome in the independently obtained strains B3 and B4 (pSAM2B3 and pSAM2B4) (19). A kil-kor system associated with transfer seems to be present in pSAM2. The major transfer gene, traSA, as well as the genes spdA, -B, -C, and -D, which are possibly involved in intramycelial spreading, have been identified (7). The hypothesis about the direct role of korSA in the regulation of kil, based on the inability of the deletion derivatives lacking korSA and also pra to transform was reconsidered after the discovery that pra is indispensable for the establishment of pSAM2 in the new host, as it activates pSAM2 replication and integration (22).

In this study we demonstrate that the KorSA protein encoded by pSAM2 is a transcriptional repressor of its own gene, korSA, and of the pra gene, which was shown to code for an activator of pSAM2 replication, integration, and excision (22, 23). While the expression of traSA in pSAM2 seems to be under the control of KorSA, no binding sites could be detected in that region, contrary to the widely adopted model of the organization of the Streptomyces kil-kor systems. korSA seems to code for the pSAM2 major repressor controlling, via the pra gene, the main functions of this genetic element.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains and plasmids. Streptomyces lividans TK24 is the commonly used host strain for cloning experiments (13). S. ambofaciens strains have been described elsewhere (19). The plasmids used are listed in Table 1.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Plasmidsa

Culture and transformation conditions. General culture and genetic techniques for Streptomyces spp. were as described by Hopwood et al. (11), and those for Escherichia coli were as described by Sambrook et al. (21). Streptomyces transformants carrying the thiostrepton resistance (tsr) gene (30) were selected using 50 µg of nosiheptide per ml.

Recombinant clones of S. lividans TK24 containing derivatives of pIJ487/Hygro carrying the aph resistance gene transcribed from a heterologous promoter (pOS530 and pOS702) were selected on R2YE medium containing 80 µg of hygromycin B per ml. To determine the level of kanamycin resistance, spore suspensions of the recombinant clones were spread on minimal medium (11) containing increasing concentrations of kanamycin monosulfate (Sigma). For strains S. lividans/pOS699/pOS702 and S. lividans/pOS556/pOS530, the initial transformants were obtained after double selection on medium containing nosiheptide and hygromycin B.

DNA isolation. Plasmid DNA was isolated from E. coli and from Streptomyces spp. by alkaline lysis (11). Total DNA was isolated as described by Hopwood et al. (11).

Status of pSAM2 derivatives in S. lividans. Total DNAs of recombinant strains digested with EcoRI were checked for the presence of free and/or integrated pSAM2 sequences by Southern hybridization with the [alpha -32P]dATP-labeled EcoRI-EcoRI fragment of pSAM2 containing the attP site.

RNA isolation, Northern hybridization, and high-resolution S1 mapping. Total RNA from Streptomyces was isolated as described by Hopwood et al. (11). For Northern hybridization, total RNA (40 to 50 µg) was denatured with glyoxal and dimethyl sulfoxide and, after electrophoresis, was transferred to a Hybond-N filter (Amersham). The filter was hybridized with a radiolabeled probe corresponding to the korSA gene (the 0.8-kb PCR fragment synthesized with the oligonucleotides GS1 [5' GCGACGTGGCTTCCTGTGGTTGACT] and GS13 [5' CCCGGCCGTGGTGCGGGCTTCCCGG]).

Low- and high-resolution S1 mappings were performed as described by Hopwood et al. (11). For low-resolution S1 mapping, the 1.6-kb BamHI(154)/BamHI(1746) fragment was used as a probe. For high-resolution S1 mapping, the probe was prepared as described by Raibaud et al. (20), using the oligonucleotide GS9 (5' CACTTGGCACCATGTCGCCGGGCTT), which is situated 115 bp downstream of the presumed start codon of the korSA gene. The same oligonucleotide was used for sequencing.

pSAM2 sequence. All restriction sites and positions of the cloned fragments are numbered according to the sequence submitted previously to the EMBL data bank under accession number AJ005260.

Purification of the KorSA protein. The KorSA protein was produced in E. coli and purified as a maltose-binding protein (MBP)-KorSA fusion protein, using the cloning and purification kit of New England Biolabs. The korSA gene coding part was amplified by PCR and cloned in the expression vector pMAL-c2, where it is expressed under the control of the IPTG (isopropyl-beta -D-thiogalactopyranoside)-inducible tac promoter. The MBP-KorSA protein was purified by affinity chromatography using a column with amylose resin, as recommended by the kit producer. This method of purification allowed us to obtain MBP-KorSA protein that was electrophoretically pure.

Gel retardation assays. DNA fragments were incubated with the MBP-KorSA protein for 10 min at 30°C in binding buffer (5× binding buffer contains 50 mM Tris-HCl [pH 7.5], 50 mM MgCl2, 500 mM NaCl2, 1 mM dithiothreitol, and 50% glycerol). Protein-DNA complexes were separated by electrophoresis at 4°C on polyacrylamide (PAA) gels. The acrylamide concentration is indicated in the figure legends. The nondenaturating gel contained acrylamide-bis-acrylamide, 10% glycerol, and 0.25× Tris-borate-EDTA.

To determine the total number of KorSA binding sites in pSAM2, the entire set of unlabeled DNA fragments obtained after digestion of 1 µg of the circular form of pSAM2B3 was used in the gel shift assay. After migration, the PAA gel was colored with ethidium bromide. The DNA fragments bound with MBP-KorSA disappeared from their normal position in the gel, indicating the presence of KorSA binding sites in these regions of pSAM2, which were identified using the complete pSAM2 sequence.

Radiolabeled DNA fragments corresponding to these regions were used in the second round of the gel shift analysis. [gamma -32P]dATP-labeled fragments (0.05 pmol) of 125 bp and 174 bp were bound to MBP-KorSA and analyzed in a PAA gel.

DNase I footprinting. DNase I footprinting was performed as described by Holmes et al. (10). The DNA fragment containing the KorSA binding region was synthesized by PCR using the oligonucleotides Bam-kor-pr (5' ACGGGATCCTTCGCGCACCACCACTCCAGC) and Hind-Kor-pr (5' TTCAAGCTTGGTTCCCATAGTCCTTCTCTG). This 111-bp DNA fragment containing the korSA gene promoter (0.4 pmol) was radiolabeled with Klenow polymerase (BamHI site) and then incubated with the MBP-KorSA protein at 30°C for 10 min in binding buffer. Samples were diluted twofold with DNase I buffer (10 mM HEPES-HCl [pH 7.8], 5 mM MgCl2, 1 mM CaCl2, and 15 mM NaCl) and treated with 5 ng of DNase I for 1 min at room temperature. Samples were precipitated with ethanol in the presence of 0.3 M sodium acetate, resuspended in 95% formamide containing 20 mM EDTA, and loaded onto a 6% PAA sequencing gel. The gel was fixed in 10% acetic acid-10% methanol and dried, and radioactive bands were visualized by autoradiography.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Transcriptional analysis of korSA. To obtain data concerning transcription of the korSA gene in different pSAM2 derivatives, Northern hybridization and S1 low-resolution mapping were carried out with total RNA isolated from the strains S. lividans/pSAM2B2 and S. lividans/pSAM2B3. These experiments gave the same result. The korSA gene is constantly transcribed in both variants of pSAM2, either integrated only (pSAM2B2) or integrated and replicating (pSAM2B3). The presence in both strains of a 1-kb mRNA corresponding to the size of korSA (Fig. 1) indicates that it is a monocistronic transcript (data not shown).


View larger version (8K):
[in this window]
[in a new window]
 
FIG. 1.   Physical and genetic map of the pSAM2 region surrounding the korSA gene. The two rectangular blocks correspond to the positions of the KorSA binding regions. The two black bars correspond to the positions of the PCR fragments used in gel shift experiments (PCR 125bp and PCR 174bp). The double arrow represents the extent of the deletion inactivating korSA in pOS699.

The start point of korSA transcription was localized by high-resolution S1 mapping. Transcription is initiated from the adjacent A or T nucleotide situated 18 and 19 nucleotides (nt) upstream of the putative initiation codon ATG (data not shown) (see Fig. 5). These results allowed us to locate the korSA promoter. Its sequence does not show similarity to the consensus sequence proposed for Streptomyces promoters similar to those recognized by E. coli RNA polymerase containing the sigma 70 subunit (28).

The KorSA protein binds to two regions in pSAM2. The deduced protein KorSA belongs to the GntR family of transcriptional regulators (8) and contains a helix-turn-helix DNA binding motif (7). Determination of the positions of the KorSA binding sites in the pSAM2 sequence could give direct indications of the targets of this regulator. The protein KorSA was expressed in E. coli as a fusion with the N-terminal part of MBP (MBP-KorSA) and purified as described in Materials and Methods. The MBP-KorSA fusion protein was used for further analysis.

To determine the number and positions of all of the KorSA binding sites present in the sequence of pSAM2, we took advantage of the relatively small size of pSAM2 (10.9 kb) and of the knowledge of its whole nucleotide sequence (references 2, 3, 5-7, and 23 and our unpublished results; the published part of the pSAM2 sequence has been deposited in the EMBL database under accession number AJ005260). The total number of KorSA binding sites in pSAM2 was determined directly in gel shift experiments using the entire set of unlabeled DNA fragments obtained after digestion of the circular form of pSAM2B3 with restriction enzymes and separation of these DNA fragments on a PAA gel. If these fragments were mixed with the MBP-KorSA protein prior to gel electrophoresis, any fragment whose migration is retarded could be expected to bind to KorSA, and thus the binding region could be localized. The restriction enzymes (AatII, AccI, AvaII, DdeI, HindII, RsaI, StyI, and XhoII) were chosen because each cuts pSAM2 into 15 to 25 fragments that could be identified from the pSAM2 sequence. In addition, every region of pSAM2 is represented at least by a fragment that is of optimal size for gel shift experiments (100 to 1,000 bp) and well separated from the neighboring fragments. Typical results obtained after cutting with DdeI and StyI are shown in Fig. 2.


View larger version (75K):
[in this window]
[in a new window]
 
FIG. 2.   Gel shift experiments performed with the KorSA protein, using unlabeled fragments of pSAM2B3 obtained after restriction with DdeI and StyI. The fragments containing korSA, pra, and traSA promoters are indicated (PkorSA, Ppra, and PtraSA, respectively). The fragments were separated in a 3.5% nondenaturing PAA gel. The DNA fragments binding KorSA protein did not migrate compared to the control. Binding was specific when 30 to 300 ng of KorSA was added. m.w.s., molecular weight standards.

For every restriction enzyme used, no more than two fragments of pSAM2 were retarded (Fig. 2). Comparison of the results obtained using different endonucleases allowed us to identify the minimal fragments containing the binding regions. They were relatively short and located in the promoters of the korSA [the 204-bp HindII((948)/StyI(1152) fragment] and pra [the 106-bp HindII(1816)/HindII(1922) fragment] genes. Binding of the MBP-KorSA protein was not observed with the fragments containing the traSA gene or its promoter. This was unexpected, since in Streptomyces plasmids such as pIJ101 (26, 27) or pSN22 (15), Kor was shown to repress directly the expression of the intermycelial transfer genes by binding in their promoter regions.

The fragments corresponding to the regions localized after the preliminary gel shift experiments with the whole DNA of pSAM2 were synthesized by PCR, radioactively labeled, and tested in a new round of gel shift experiments with the MBP-KorSA protein. The first region, upstream of korSA, corresponds to the 125-bp fragment (positions 880 to 999 in Fig. 1 and in the AJ005260 sequence and additional nucleotides creating the BamHI and HindIII sites at the ends of the fragment). The second region, upstream of pra, corresponds to the 174-bp fragment (positions 1760 to 1922 in the same sequence and additional nucleotides creating the Asp718I and BamHI sites at the ends of the fragment). The results obtained confirmed and refined the first suggestion about the position of the KorSA protein binding sites. As shown in Fig. 3A, MBP-KorSA was able to bind efficiently to the 174-bp fragment corresponding to the pra gene promoter from the variants pSAM2B2, pSAM2B3, and pSAM2B4. This means that the mutations found in the pra promoter in pSAM2B3 and pSAM2B4, while strengthening pra expression, did not abolish the binding of KorSA.




View larger version (797147K):
[in this window]
[in a new window]
 
FIG. 3.   Gel shift experiments with KorSA. (A) Binding to the pra gene promoter (3.5% PAA gel). KorSA binds to the radioactively labeled 174-bp DNA fragment corresponding to the pra gene promoter from pSAM2B2, pSAM2B3, and pSAM2B4. (B) Identification of two subfragments binding KorSA in the praB2 promoter (10% PAA gel). KorSA binds to the radioactively labeled DNA subfragments obtained after digestion with ApaLI (lanes 4 to 7) or HindII (lanes 8 to 11) of the 174-bp fragment corresponding to the praB2 promoter (binding to the undigested fragment is shown in lanes 1 to 3). The positions of two subregions able to bind KorSA are shown on the right. (C) Comparison of the affinities of KorSA for the korSA and pra promoters (4.0% PAA gel). The same amount of DNA corresponding to the two promoters was labeled and used for binding with KorSA. For the fragment (125bp) corresponding to the korSA promoter (lanes 1 to 6), the same pattern of retardation as for the praB2 promoter (lanes 7 to 12) could be obtained in the presence of 10 to 20 times more KorSA.

To refine the analysis, the 174-bp fragment from pSAM2B2 corresponding to the pra gene promoter was cut with ApaLI (giving fragments of 88 and 86 bp) and with HindII (giving fragments of 69 and 105 bp). Both ApaLI subfragments were able to bind MBP-KorSA, but only the 105-bp HindII fragment was retarded (Fig. 3B). It was concluded that each ApaLI fragment contains at least one site for KorSA and that no functional site is situated on the 69-bp HindII fragment. It is interesting that the point substitution present in pSAM2B4 and located in the core sequence of binding site 2 (see Fig. 5) significantly decreases but does not abolish the binding of the 88-bp ApaLI DNA fragment to KorSA (data not shown). This indicates that this nucleotide (G) is important for KorSA binding, as predicted by the footprint experiment (see below). In addition it confirms the validity of the KorSA targets determined by gel retardation experiments.

Binding of KorSA to its own promoter was confirmed with the 125-bp fragment corresponding to the korSA gene promoter (Fig. 3C). The protein KorSA has 10 to 20 times more affinity for the pra gene promoter than for its own promoter, since, using equal amounts of DNA, 10 to 20 times more KorSA was required to obtain the same pattern of retardation with the korSA promoter as with the pra promoter (Fig. 3C).

To confirm the absence of binding sites for KorSA in the traSA gene sequence, three fragments corresponding to the promoter and 5' coding part, to the central part, and to the 3' coding part of the traSA gene were synthesized by PCR, radioactively labeled, and used in gel shift assays. None of these fragments were retarded in the presence of MBP-KorSA (data not shown). These results could also be considered to be a control of the specificity of the KorSA binding.

Determination of the KorSA binding site by footprint analysis. To determine the sequence recognized by KorSA, footprint analysis was performed. In the fragment containing the korSA promoter, the MBP-KorSA protein was able to protect against DNase I the 25- to 27-bp region situated immediately upstream of the korSA transcriptional start point (Fig. 4). The same type of experiment was performed with the fragment containing the pra promoter. In this case the MBP-KorSA protein protected two regions, upstream and downstream of the pra transcriptional start point (Fig. 5B). For this fragment, the position of the protected regions was in good agreement with the results obtained by the gel shift analysis, indicating the presence of two binding sites (Fig. 3B).


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 4.   Footprint analysis of KorSA binding to the korSA promoter. Different amounts of KorSA protein were added to the 111-bp PCR-synthesised DNA fragment corresponding to the korSA promoter. The DNA sequence corresponds to the MBP-KorSA protected region. The sequence was determined using the same DNA fragment with the oligonucleotide Bam-kor-pr (described in Materials and Methods).


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5.   Positions of the KorSA binding sites upstream of the korSA and pra genes. (A) DNA sequence upstream of the korSA gene translation initiation codon. (B) DNA sequence upstream of the praB2 gene translation initiation codon. (C) Alignment of the KorSA binding sites found in the pSAM2 sequence. The positions of the sequences corresponding to the KorSA binding sites are boxed. The positions of the point mutations found upstream of the pra gene in pSAM2B3 and pSAM2B4 are indicated as T (B3) and T (B4).

When the three protected sequences were aligned, it was possible to deduce a consensus sequence (Fig. 5C). Sequences identical to this 17-bp consensus sequence were searched for in the complete pSAM2 sequence and were only found in the three regions protected by MBP-KorSA. The presence of a 9-nt perfect inverted repeat was noted in the sequence of the KorSA binding site 3. Due to these repeats, the 17-bp consensus is present in both strands for site 3.

KorSA is a transcriptional repressor of the two genes pra and korSA. The KorSA protein, like other known Streptomyces Kor proteins, belongs to the GntR family of transcriptional repressors (8). To determine whether KorSA plays a similar role in pSAM2, the strengths of the pra and korSA promoters, in the presence or absence of KorSA, were compared using the promoter probe vector pIJ487 (32). In this vector the kanamycin resistance gene is transcribed from the inserted promoter. The level of transcription from a tested promoter was estimated by the level of resistance to kanamycin. It was observed that when the korSA gene is present in trans, the praB2 promoter (PpraB2) is repressed, demonstrating that KorSA acted as a transcriptional repressor of the pra gene. For example, at a kanamycin concentration of 3 µg/ml, the presence of korSA reduces survival about 10-fold (Fig. 6A). Surprisingly, in the presence of pOS699 with korSA disrupted, PpraB2 was found to be activated, indicating that pSAM2 codes for another, positive, regulator of pra expression. The PpraB3 promoter is much stronger than PpraB2. For instance, with PpraB3 cloned in pIJ487, survival was at least 50% with kanamycin at 100 µg/ml (23), while survival was about 5% with kanamycin at 5 µg/ml with PpraB2 (Fig. 6A). The repression of PpraB3 in the presence of korSA in trans was detectable only at kanamycin concentrations higher than 100 µg/ml (data not shown).


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6.   KorSA is a repressor of the korSA gene and pra gene promoters. The sensitivity to kanamycin (Km) of S. lividans TK24 harboring the plasmids pOS530 (A) and pOS702 (B) increases in the presence of the functional korSA gene (pOS556).

Using the same approach, it was demonstrated that KorSA is also a transcriptional repressor of its own gene (Fig. 6B). The korSA gene promoter is repressed only by KorSA, since in the presence of pOS699 containing the whole pSAM2 sequence, but with the korSA gene disrupted, no repression of the korSA promoter was observed.

Inactivation of the korSA gene. A variant, pOS699 (Fig. 1; Table 1), containing an internal deletion in the korSA gene was constructed from a derivative of pSAM2B3, pTS39, which has been used for the functional analysis of pSAM2 (25). pOS699 was able to transform S. lividans with the same efficiency as pTS39. For pTS39 the integrated and replicative forms coexist in S. lividans. However, pOS699 was present only as a replicative form (Fig. 7). The introduction of a copy of the korSA gene in trans in the strain S. lividans/pOS699 restored the presence of the pOS699 integrated form (Fig. 7) but, for unknown reasons, did not restore the usual proportion between the free and integrated forms for pSAM2B3. It should be emphasized that strong activation of pSAM2 excision was previously observed for the derivative pOS548, in which the pra gene was overexpressed under the control of an inducible and very strong heterologous promoter, ptipA (22). These results, together with the binding of KorSA to the praB3 promoter, allow us to conclude that KorSA is still able to repress the pra gene promoter in the mutant pSAM2B3.


View larger version (49K):
[in this window]
[in a new window]
 
FIG. 7.   Effect of korSA gene disruption on the status of pSAM2. Total DNA, restricted with EcoRI, was analyzed by Southern hybridization with the 32P-labeled 4.2-kb EcoRI-EcoRI fragment of pSAM2 containing the attP integration site. The two DNA bands of 6.7 and 5.2 kb correspond to integrated pSAM2, while the 4.2-kb band corresponds to the free form of pSAM2. DNA was extracted from S. lividans TK24 containing pOS699 clones 1 and 2 (lanes 2 and 3), pOS699 plus pOS556 clones 1 and 2 (lanes 4 and 5), pSAM2B2 (lane 6), and pTS39 (pSAM2B3 derivative) (lane 7). Lane 1, 1-kb ladder DNA.

The status of pOS699 could be explained by the absence of repression of pra. Nevertheless, it should be stressed that the role of KorSA cannot be limited only to the repression of pra. Inactivation of korSA had other consequences. S. lividans was transformed by pOS699 with the same efficiency as pTS39, but transformants appeared after more than 1 week, compared to 3 days for pTS39 transformants. Moreover, after 2 to 3 weeks, the clones obtained by transformation did not give progeny when picked on new plates. This phenotype was considered to be an attenuated Kil phenotype and was suppressed by complementation in trans with a single copy of the korSA gene in the strain S. lividans/pOS699/pOS556.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The conjugative S. ambofaciens integrative element pSAM2 possesses a kil-kor system. The korSA gene has been identified as a key element of this system, and the kil locus has been located in the region of traSA, the main transfer gene (7, 25), but the direct role of KorSA in the regulation of the kil locus remained unknown. In this study we characterized the targets of the KorSA protein in the pSAM2 sequence.

Considering the relatively small size of the pSAM2 genome and the availability of its complete sequence, gel shift experiments were performed with the totality of the DNA fragments obtained after pSAM2 digestion with restriction endonucleases. Using this new approach, it was possible to demonstrate directly that KorSA binds only to the promoter regions of two pSAM2 genes, pra and korSA, with no other binding sites detected. Unlike other known actinomycete mobile elements, KorSA did not bind either to traSA, the main pSAM2 transfer gene, or to the spdA, -B, -C, and -D genes involved in pSAM2 spreading. These conclusions were confirmed after determination by footprint analysis of the sequence recognized by KorSA. This 17-nt consensus sequence was found only upstream of the korSA and pra genes and not elsewhere in pSAM2. The promoters of these genes, cloned from the wild-type pSAM2B2 and studied in a Streptomyces promoter probe vector, were shown to be repressed in vivo in the presence of korSA in trans, thus confirming the in vitro studies.

These data allowed us to conclude that KorSA negatively regulates the expression of another regulator gene of pSAM2, pra, characterized to be essential for the expression of genes involved in integration-excision and replication of pSAM2. The presence of genes similar to pra has not been shown in any other exhaustively studied actinomycete mobile elements (a pra-like gene is present in the sequence of pSA1 of Streptomyces azureus ATCC 1421 [EMBL accession number AB010724]).

Although the presence of functional pSAM2 has never been observed in the S. coelicolor genome, several open reading frames exhibiting very high similarity with pSAM2 genes were recently found during the sequencing of the complete S. coelicolor chromosome. These sequences could be detected by hybridization of S. coelicolor total DNA with a pSAM2 probe. Nothing is known about the possible expression and role of these open reading frames in S. coelicolor. However, when hybridization of a pSAM2 probe was performed under the same conditions with total DNA of S. lividans, no hybridizing fragment could be detected (data not shown). Therefore, these open reading frames, which are highly similar to pSAM2 genes, are absent from S. lividans and could not interfere with the functional study of pSAM2 performed in this strain.

Functional analysis confirms the role of KorSA as the pra repressor. In the derivative pOS699, in which korSA is inactivated, strong activation of pSAM2 excision was observed, a phenomenon very similar to that obtained by overexpression in cis of the pra gene (22).

Another role discovered for KorSA, i.e., as a negative regulator of its own synthesis, is consistent with the data published for the kor genes of other actinomycetes conjugative elements (see the introduction). The affinity of KorSA for the korSA promoter, which is weaker than that for pra, probably allows this protein to maintain its concentration at a level sufficient to keep the pra gene constantly repressed. It should be noted that the affinity of the fused protein MBP-KorSA could be slightly different from that of KorSA, but unfortunately, the cleavage of the fused protein was extremely inefficient.

It has been demonstrated that pSAM2B3 is different from the wild-type form pSAM2B2 by the coexistence of replicative and integrated forms, while pSAM2B2 is present in the cells only as an integrated sequence. This difference is a consequence of the point substitution in the pra gene promoter (23). This mutation causes a more efficient transcription of praB3, whereas mRNA of praB2 was not detected. A plausible explanation of this phenomenon might have been the different affinities of KorSA for the mutated and nonmutated sequences. However, the mutation in the pra gene promoter is not located in the KorSA binding sites, and KorSA binds to the praB3 promoter with roughly the same affinity as it does to the praB2 promoter. These results indicate that the mutated praB3 promoter is still regulated by KorSA.

The absence of a direct connection between KorSA and the expression of the main transfer gene, traSA, presents a significant difference between the genetic organizations of transfer control in pSAM2 and in other well-studied conjugative elements of actinomycetes. The derivative of pSAM2B3 lacking functional korSA expressed an attenuated Kil phenotype. This raises the question of the mechanism by which KorSA regulates this determinant. Generally, the kil function is attributed to a transfer gene(s). KorSA did not bind to any region in the traSA gene. traSA is not cotranscribed with pra (23), and overexpression of pra from the tipA promoter, not controlled by KorSA, but in the presence of intact korSA (pOS548 [22]), does not cause the Kil phenotype. It could be supposed that either Pra or KorSA needs an unidentified partner to regulate traSA expression or that another regulatory gene is involved.

In pSAM2, KorSA exhibits unique properties: it regulates integration, excision, and replication through the control of pra but does not directly regulate the main pSAM2 transfer gene traSA. KorSA could be considered the main negative transcriptional regulator of pSAM2. This suggested that KorSA alone may be responsible for the silent status of the pSAM2 integrated form, and it should be noted that korSA was always expressed, even in pSAM2B2 which was found only integrated. Activation of the excision and replication of pSAM2, which are indispensable for transfer, should include a mechanism for relieving KorSA repression under conditions favorable for transfer.


    ACKNOWLEDGMENTS

We are grateful to M. J. Bibb and K. Flärdh for the information concerning the pSAM2-like sequence in the S. coelicolor genome. We thank R. d'Ari for helpful comments on the manuscript. We thank R. Morosoli for helpful and pleasant discussions during this work.

This work has been carried out as part of the "Bioavenir" program supported by Rhône-Poulenc with the participation of the French Ministères de la Recherche, et de l'Enseignement superieur, de l'Industrie et du Commerce Extérieur.


    FOOTNOTES

* Corresponding author. Mailing address: Laboratoire de Biologie et Génétique Moléculaire, Institut de Génétique et Microbiologie, UMR CNRS 8621, Bâtiment 400, Université Paris-Sud, 91405 Orsay, France. Phone: 33 (0) 1 69 15 69 17. Fax: 33 (0) 1 69 15 45 44. E-mail: michel.guerineau{at}igmors.u-psud.fr.

dagger Present address: Laboratoire de Génétique Microbienne, Institut Jacques Monod, UMR CNRS 7592, Université Paris VI, 75251, Paris, Cedex 05, France.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Bibb, M. J., R. F. Freeman, and D. A. Hopwood. 1977. Physical and genetical characterization of a second sex factor, SCP2, for Streptomyces coelicolor A3(2). Mol. Gen. Genet. 154:155-166[CrossRef].
2. Boccard, F., T. Smokvina, J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1989. The integrated conjugative plasmid pSAM2 of Streptomyces ambofaciens is related to temperate bacteriophages. EMBO J. 8:973-980[Medline].
3. Boccard, F., T. Smokvina, J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1989. Structural analysis of loci involved in pSAM2 site-specific integration in Streptomyces. Plasmid 21:59-70[CrossRef][Medline].
4. Grant, S. R., S. C. Lee, K. Kendall, and S. N. Cohen. 1989. Identification and characterization of a locus inhibiting extrachromosomal maintenance of the Streptomyces plasmid SLP1. Mol. Gen. Genet. 217:324-331[CrossRef][Medline].
5. Hagège, J., F. Boccard, T. Smokvina, J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1994. Identification of a gene encoding the replication initiator protein of the Streptomyces integrating element, pSAM2. Plasmid 31:166-183[CrossRef][Medline].
6. Hagège, J., J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1993. Mode and origin of replication of pSAM2, a conjugative integrating element of Streptomyces ambofaciens. Mol. Microbiol. 10:799-812[Medline].
7. Hagège, J., J.-L. Pernodet, G. Sezonov, C. Gerbaud, A. Friedmann, and M. Guérineau. 1993. Transfer function of the conjugative integrating element pSAM2 from Streptomyces ambofaciens: characterization of a kil-kor system associated with transfer. J. Bacteriol. 175:5529-5538[Abstract/Free Full Text].
8. Haydon, D. J., and J. R. Guest. 1991. A new family of bacterial regulatory proteins. FEMS Microbiol. Lett. 79:291-296[CrossRef].
9. Holcík, M., and V. N. Iyer. 1997. Conditionally lethal genes associated with bacterial plasmids. Microbiology 143:3403-3416[Free Full Text].
10. Holmes, D. J., J. L. Caso, and C. J. Thompson. 1993. Autogenous transcriptional activation of a thiostrepton-induced gene in Streptomyces lividans. EMBO J. 12:3183-3191[Medline].
11. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf. 1985. Genetic manipulation of Streptomyces. A laboratory manual. The John Innes Foundation, Norwich, United Kingdom.
12. Hopwood, D. A., T. Kieser, D. J. Lydiate, and M. J. Bibb. 1986. Streptomyces plasmids: their biology and use as cloning vectors, p. 159-220. In S. W. Queener, and L. E. Day (ed.), The bacteria: a treatise on structure and function, vol. IX. Academic Press, Orlando, Fla.
13. Hopwood, D. A., T. Kieser, H. M. Wright, and M. J. Bibb. 1983. Plasmids, recombination and chromosome mapping in Streptomyces lividans 66. J. Gen. Microbiol. 129:2257-2269[Abstract/Free Full Text].
14. Kataoka, M., Y. M. Kiyose, Y. Michisuji, T. Horiguchi, T. Seki, and T. Yoshida. 1994. Complete nucleotide sequence of the Streptomyces nigrifaciens plasmid, pSN22: genetic organization and correlation with genetic properties. Plasmid 32:55-69[CrossRef][Medline].
15. Kataoka, M., S. Kosono, T. Seki, and T. Yoshida. 1994. Regulation of the transfer genes of Streptomyces plasmid pSN22: in vivo and in vitro study of the interaction of TraR with promoter region. J. Bacteriol. 176:7291-7298[Abstract/Free Full Text].
16. Kendall, K. J., and S. N. Cohen. 1987. Plasmid transfer in Streptomyces lividans: identification of a kil-kor system associated with the transfer region of pIJ101. J. Bacteriol. 169:4177-4183[Abstract/Free Full Text].
17. Maas, R.-M., J. Götz, W. Wohlleben, and G. Muth. 1998. The conjugative plasmid pSG5 from Streptomyces ghanaensis DSM 2932 differs in its transfer functions from other Streptomyces rolling-circle-type plasmids. Microbiology 144:2809-2817[Abstract/Free Full Text].
18. Omer, C. A., and S. N. Cohen. 1989. SLP1: a paradigm for plasmids that site-specifically integrate in the Actinomycetes, p. 289-296. In D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C.
19. Pernodet, J.-L., J.-M. Simonet, and M. Guérineau. 1984. Plasmids in different strains of Streptomyces ambofaciens: free and integrated forms of plasmid pSAM2. Mol. Gen. Genet. 198:35-41[CrossRef][Medline].
20. Raibaud, A., M. Zalacain, T. G. Holt, R. Tizard, and C. J. Thompson. 1991. Nucleotide sequence analysis reveals linked N-acetyl hydrolase, thioesterase, transport, and regulatory genes encoded by the bialaphos biosynthetic gene cluster of Streptomyces hygroscopicus. J. Bacteriol. 173:4454-4463[Abstract/Free Full Text].
21. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
22. Sezonov, G., A.-M. Duchêne, A. Friedmann, M. Guérineau, and J.-L. Pernodet. 1998. Replicase, excisionase and intergase genes of the Streptomyces element pSAM2 constitute an operon positively regulated by the pra gene. J. Bacteriol. 180:3056-3061[Abstract/Free Full Text].
23. Sezonov, G., J. Hagège, J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1995. Characterization of pra, a gene for replication control in pSAM2, the integrating element of Streptomyces ambofaciens. Mol. Microbiol. 17:533-544[CrossRef][Medline].
24. Shiffman, D., and S. N. Cohen. 1993. Role of the imp operon of the Streptomyces coelicolor genetic element SLP1: two imp-encoded proteins interact to autoregulate imp expression and control plasmid maintenance. J. Bacteriol. 175:6767-6774[Abstract/Free Full Text].
25. Smokvina, T., F. Boccard, J.-L. Pernodet, A. Friedmann, and M. Guérineau. 1991. Functional analysis of the Streptomyces ambofaciens element pSAM2. Plasmid 25:40-52[CrossRef][Medline].
26. Stein, D. S., and S. N. Cohen. 1990. Mutational and functional analysis of the korA and korB gene products of Streptomyces plasmid pIJ101. Mol. Gen. Genet. 222:337-344[CrossRef][Medline].
27. Stein, D. S., K. J. Kendall, and S. N. Cohen. 1989. Identification and analysis of transcriptional regulatory signals for the kil and kor loci of Streptomyces plasmid pIJ101. J. Bacteriol. 171:5768-5775[Abstract/Free Full Text].
28. Strohl, W. R. 1992. Compilation and analysis of DNA sequences associated with apparent streptomycete promoters. Nucleic Acids Res. 20:961-974[Abstract/Free Full Text].
29. Tai, J. T.-N., and S. N. Cohen. 1993. The active form of the KorB protein encoded by the Streptomyces plasmid pIJ101 is a processed product that binds differentially to the two promoters it regulates. J. Bacteriol. 175:6996-7005[Abstract/Free Full Text].
30. Thompson, C. J., J. M. Ward, and D. A. Hopwood. 1980. DNA cloning in Streptomyces: resistance genes from antibiotic-producing species. Nature 286:525-527[CrossRef][Medline].
31. Vrijbloed, J. W., N. M. Put, G. I. Hessels, and L. Dijkhuizen. 1995. Identification and functional analysis of the transfer region of the plasmid pMEA300 of the methylotrophic actinomycete Amycolatopsis methanolica. J. Bacteriol. 177:6499-6505[Abstract/Free Full Text].
32. Ward, J. M., G. R. Janssen, T. Kieser, M. J. Bibb, M. J. Buttner, and M. J. Bibb. 1986. Construction and characterisation of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase gene from Tn5 as indicator. Mol. Gen. Genet. 203:468-475[CrossRef][Medline].
33. Zalacain, M., A. Gonzalez, M. C. Guerrero, R. J. Mattaliano, F. Malpartida, and A. Jiménez. 1986. Nucleotide sequence of the hygromycin B phosphotransferase gene from Streptomyces hygroscopicus. Nucleic Acids Res. 14:1565-1581[Abstract/Free Full Text].
34. Zaman, S., H. Richards, and J. M. Ward. 1992. Expression and characterisation of the korB gene product from Streptomyces lividans plasmid pIJ101 in Escherichia coli and determination of its binding site on the korB and kilB promoters. Nucleic Acids Res. 20:3693-3700[Abstract/Free Full Text].


Journal of Bacteriology, March 2000, p. 1243-1250, Vol. 182, No. 5
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Bellanger, X., Roberts, A. P., Morel, C., Choulet, F., Pavlovic, G., Mullany, P., Decaris, B., Guedon, G. (2009). Conjugative Transfer of the Integrative Conjugative Elements ICESt1 and ICESt3 from Streptococcus thermophilus. J. Bacteriol. 191: 2764-2775 [Abstract] [Full Text]  
  • Kataoka, M., Tanaka, T., Kohno, T., Kajiyama, Y. (2008). The Carboxyl-Terminal Domain of TraR, a Streptomyces HutC Family Repressor, Functions in Oligomerization. J. Bacteriol. 190: 7164-7169 [Abstract] [Full Text]  
  • Bellanger, X., Morel, C., Decaris, B., Guedon, G. (2007). Derepression of Excision of Integrative and Potentially Conjugative Elements from Streptococcus thermophilus by DNA Damage Response: Implication of a cI-Related Repressor. J. Bacteriol. 189: 1478-1481 [Abstract] [Full Text]  
  • Raynal, A., Karray, F., Tuphile, K., Darbon-Rongere, E., Pernodet, J.-L. (2006). Excisable cassettes: new tools for functional analysis of streptomyces genomes.. Appl. Environ. Microbiol. 72: 4839-4844 [Abstract] [Full Text]  
  • Lee, M. H., Scherer, M., Rigali, S., Golden, J. W. (2003). PlmA, a New Member of the GntR Family, Has Plasmid Maintenance Functions in Anabaena sp. Strain PCC 7120. J. Bacteriol. 185: 4315-4325 [Abstract] [Full Text]  
  • Grohmann, E., Muth, G., Espinosa, M. (2003). Conjugative Plasmid Transfer in Gram-Positive Bacteria. Microbiol. Mol. Biol. Rev. 67: 277-301 [Abstract] [Full Text]  
  • Rigali, S., Derouaux, A., Giannotta, F., Dusart, J. (2002). Subdivision of the Helix-Turn-Helix GntR Family of Bacterial Regulators in the FadR, HutC, MocR, and YtrA Subfamilies. J. Biol. Chem. 277: 12507-12515 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sezonov, G.
Right arrow Articles by Guérineau, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sezonov, G.
Right arrow Articles by Guérineau, M.