Journal of Bacteriology, March 2000, p. 1374-1382, Vol. 182, No. 5
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Department of Molecular Genetics, The Forsyth Institute, Boston, Massachusetts 02115
Received 27 September 1999/Accepted 7 December 1999
| |
ABSTRACT |
|---|
|
|
|---|
Viridans streptococci, which include Streptococcus gordonii, are pioneer oral bacteria that initiate dental plaque formation. Sessile bacteria in a biofilm exhibit a mode of growth that is distinct from that of planktonic bacteria. Biofilm formation of S. gordonii Challis was characterized using an in vitro biofilm formation assay on polystyrene surfaces. The same assay was used as a nonbiased method to screen isogenic mutants generated by Tn916 transposon mutagenesis for defective biofilm formation. Biofilms formed optimally when bacteria were grown in a minimal medium under anaerobic conditions. Biofilm formation was affected by changes in pH, osmolarity, and carbohydrate content of the growth media. Eighteen biofilm-defective mutants of S. gordonii Challis were identified based on Southern hybridization with a Tn916-based probe and DNA sequences of the Tn916-flanking regions. Molecular analyses of these mutants showed that some of the genes required for biofilm formation are involved in signal transduction, peptidoglycan biosynthesis, and adhesion. These characteristics are associated with quorum sensing, osmoadaptation, and adhesion functions in oral streptococci. Only nine of the biofilm-defective mutants had defects in genes of known function, suggesting that novel aspects of bacterial physiology may play a part in biofilm formation. Further identification and characterization of biofilm-associated genes will provide insight into the molecular mechanisms of biofilm formation of oral streptococci.
| |
INTRODUCTION |
|---|
|
|
|---|
Viridans streptococci, which include Streptococcus gordonii, are pioneer bacteria that initiate the formation of biofilms on tooth surfaces known as dental plaque. These ubiquitous initial colonizers constitute a majority of the cultivable bacteria found in dental plaque (46) and are the most frequent etiologic agents of bacterial endocarditis (16, 61). Over the last decade, viridans streptococci have become significant opportunistic pathogens and a major cause of bacteremia in immunocompromised patients, accounting for 40% of infections in neutropenic patients (26, 33).
Dental plaque forms by two distinct sequential steps: adhesion of early colonizers to host tissue components (24, 53) and then time-dependent accumulation of multi-layered cell clusters embedded in a matrix of bacterial and host constituents (4, 55, 62). Although numerous studies have elucidated the mechanisms of initial streptococcal adhesion (7, 13, 17, 22, 25, 31, 51, 52), the subsequent process of bacterial accumulation and proliferation leading to functionally heterogeneously organized sessile communities called dental plaque is poorly understood.
Genetic and molecular studies of dental plaque have predominantly used planktonic bacteria grown in batch culture. Although these studies have provided extensive and relevant information, dental plaque bacteria colonize and exist as sessile bacterial communities. Biofilm formation is initiated by interactions between planktonic bacteria and a surface in response to appropriate environmental signals. A fully developed, surface-attached dental biofilm is highly structured, with distinct architectural and physiochemical properties commonly observed with other biofilm communities (10, 11). Biofilm bacteria exhibit a distinct mode of growth which differs from that of planktonic cells and which is characterized by an increased resistance to antibiotics and differences in levels of gene expression and cellular physiology (10, 11, 29). Therefore, we hypothesize that novel, biofilm-associated genes are required for the development of dental biofilms after initial bacterium-surface contact is established. As sessile populations reflect conditions in vivo more accurately than planktonic bacteria, the genes expressed by biofilm bacteria are likely to play a role in the colonization of tooth surfaces and the increased virulence exhibited by viridans streptococci in susceptible hosts (16, 26, 33, 61). The aims of this study were to determine the influence of various environmental factors on the in vitro biofilm formation of S. gordonii Challis and to identify genes involved in the biofilm formation of this species of viridans streptococci.
The utility of polystyrene as a surface for attachment by marine pseudomonads under various physiological conditions was demonstrated by Fletcher (20). Microtiter plates made of polystyrene provide a convenient and sterile abiotic surface for studying bacterial biofilm formation. Studies using abiotic surfaces coupled with transposon mutagenesis have identified novel genes in the biofilm formation of Staphylococcus epidermidis (28, 43, 56), Escherichia coli (50), and Pseudomonas fluorescens (47, 48). Since tooth surfaces, generally covered by a thin pellicle layer of salivary origin, are abiotic, a similar strategy with Tn916 transposon mutagenesis was used in this study as a nonbiased method of isolating biofilm-defective mutants of S. gordonii Challis and identifying genetic loci that are associated with biofilm formation.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains, media, and chemicals.
S. gordonii
Challis 2, a rifamycin-resistant (500 µg/ml) strain of S. gordonii Challis (42), was used as the parent strain. Other oral streptococcal strains used were obtained from the American Type Culture Collection, except for Streptococcus
parasanguis FW213 (from P. Fives-Taylor, University of Vermont)
and Streptococcus oralis C104 (from P. Kolenbrander,
National Institute of Dental and Craniofacial Research). All strains
were grown in Todd-Hewitt broth with 0.2% yeast extract (THB+YE).
Antibiotics were added at the following concentrations: for E. coli, 100 µg of ampicillin ml
1 and 4 µg of
tetracycline ml
1, and for S. gordonii, 10 µg
of tetracycline ml
1. All enzymes for DNA manipulations
were purchased from Promega (Madison, Wis.).
Biofilm assay. The biofilm formation assay used is based on the method by O'Toole and Kolter (48). A minimal, defined medium modified from the work of Carlsson (6) and Jenkinson (30) was used as the biofilm medium (BM). The BM contained 58 mM K2HPO4, 15 mM KH2PO4, 10 mM (NH4)2SO4, 35 mM NaCl, 0.8% (wt/vol) glucose, 0.2% (wt/vol) Casamino Acids (CAA), and 100 mM MnCl2 · 4H2O (pH 7.4) and was supplemented with filter-sterilized vitamins (0.04 mM nicotinic acid, 0.1 mM pyridoxine HCl, 0.01 mM pantothenic acid, 1 µM riboflavin, 0.3 µM thiamin HCl, and 0.05 µM D-biotin), amino acids (4 mM L-glutamic acid, 1 mM L-arginine HCl, 1.3 mM L-cysteine HCl, and 0.1 mM L-tryptophan), and 2 mM MgSO2 · 7H2O.
Round-bottomed microtiter plates (Becton Dickinson Labware, Lincoln Park, N.J.) containing 100 µl of BM per well were inoculated with S. gordonii Challis (4.2 × 106 CFU per well) from a 16-h growth in THB+YE without agitation. After 16 h of incubation at 37°C, 25 µl of 1% (wt/vol) crystal violet (CV) solution was added to each well. After 15 min, wells were rinsed three times with 200 µl of distilled H2O and air dried. Bacterial growth and biofilm formation were quantified by measuring the absorbance at 575 nm (A575) of the bacterial culture and CV-stained biofilm, respectively. Each assay was performed in triplicate. Biofilm formation was examined on both polystyrene (Falcon 3918) and polyvinylchloride (Falcon 3911) microtiter plates under aerobic and anaerobic conditions to determine the optimum conditions for the assay. All the biofilm assays described below were performed on polystyrene plates under anaerobic conditions. Biofilm formation of S. gordonii Challis was examined in each of the following media: BM, BM without glucose, BM without CAA, THB, THB+YE, and Trypticase soy broth (TSB). Bacterial growth and biofilm formation of S. gordonii Challis were assayed over 16 h to determine the relationship between growth and biofilm formation. The effects of changes in osmolarity on S. gordonii Challis biofilm formation were assessed by supplementing BM with the osmolyte NaCl (0 to 0.4 M). In addition, the influence of changes in pH on biofilm formation was examined by using BM with a starting pH that ranged from 3 to 12. The effects of replacing the glucose in BM with an alternative carbohydrate at a final concentration of 0.8% (wt/vol) were examined. The carbohydrates tested were arabinose, fructose, fucose, galactose, lactose, maltose, maltotriose, mannose, raffinose, ribose, rhamnose, sucrose, and xylose. Biofilm formation of S. gordonii Challis and 15 other oral streptococci were assayed and categorized based on the A575 of the CV-stained biofilm. When the A575 of the CV-stained biofilm was greater than 2.0, the strain was categorized as a good biofilm former. Strains which produced CV-stained biofilms with an A575 of 1.0 to 2.0 were designated moderate biofilm formers, while those with CV-stained biofilms that had an A575 lower than 1.0 were categorized as poor biofilm formers.SEM. Biofilm formation of S. gordonii Challis on polystyrene surfaces coated with three different matrix proteins was assayed. Laminin (2 µg/cm2), type IV collagen (10 µg/cm2), and fibronectin (5 µg/cm2) were each used to coat polystyrene microtiter plates according to the instructions of the manufacturer (Sigma-Aldrich Co., St. Louis, Mo.). Plates were air dried under UV and used in the biofilm assay as described previously. Biofilms that formed were examined by scanning electron microscopy (SEM) to verify the quantitative results observed. The microtiter plates were fixed by adding an equal volume of formaldehyde-glutaraldehyde to the medium for 1 h, followed by addition of a full-strength fixative overnight. The wells were washed three times with 0.1 N cacodylate buffer, postfixed with 2% OsO4 in s-collidine buffer for 2 h, and rinsed with water. Following dehydration through a graded series of ethanol, the collars of the wells were cut away with a band saw. The wells were rinsed with ethanol and air dried. The 96-well plate was then cut into six equal parts, and the upper left corner of each section was marked for orientation of the wells. The sections were mounted on aluminum stubs, coated with palladium-gold, and examined in a JEOL 6400 scanning electron microscope. The sections were tilted 45° in order to examine the sides of wells. Wells for photography were randomly selected, but the area within the well for viewing was always measured to be 2 mm from the cut edge of the collar, thus avoiding the bacteria which may have settled at the bottom of the well during incubation. Polaroid photographs were taken of representative areas and digitized with a scanner (Agfa Corp., Ridgefield, N.J.) for reproduction.
Tn916 transposon mutagenesis. S. gordonii Challis grown in THB+YE was diluted (1:100) in streptococcal transformation medium (39). The medium consisted of 1% Proteose Peptone, 0.2% YE, and 0.2% glucose (pH 7.8) and was supplemented with 10% heat-inactivated horse serum (Sigma). After inoculation, the culture was incubated anaerobically at 37°C for 105 min for maximum transformation efficiency (39). After incubation, 2 to 3 µg of pAM120 (pGL101 containing pAD1EcoRIF::Tn916) plasmid DNA was mixed with 0.5 ml of the culture and the mixture was incubated for another 4 h under anaerobic conditions at 37°C. Cells were then plated on brain heart infusion agar (BBL Microbiology Systems, Cockeysville, Md.) containing tetracycline and incubated anaerobically for 48 h. The plasmid DNA for transformation was isolated from E. coli CG120 (23) using a maxi prep kit (Qiagen Inc., Valencia, Calif.). The transformation frequency was 3 × 105 transformants per µg of DNA. Each tetracycline-resistant colony was picked and transferred into a well on a microtiter plate containing 200 µl of BM with tetracycline. After the inoculum was mixed, 100 µl of the BM was transferred to another well on a new microtiter plate to create a duplicate. Both plates were then incubated anaerobically at 37°C for 24 to 48 h. After incubation, bacterial growth in each well was determined by recording the A575 of the culture, and one plate was stained with 1% CV. Bacteria from the duplicate plate corresponding to wells with equivalent levels of growth but poor CV staining were picked as putative biofilm formation-defective mutants. These putative mutants were streaked onto brain heart infusion agar containing tetracycline and retested for their ability to form biofilms to rule out false positives. Colonies that continued to show defective biofilm formation were designated biofilm-defective mutants.
Molecular techniques. Chromosomal DNA was isolated from the wild-type S. gordonii Challis and putative biofilm-defective mutants by the method described by Ganeshkumar et al. (22). DNA was digested with HindIII, separated by agarose gel electrophoresis, and transferred onto a nitrocellulose membrane for Southern hybridization. The probe used for hybridization was pAM120 labeled with digoxigenin (DIG) using the DIG DNA labeling system, according to the instructions of the manufacturer (Roche Molecular Biochemicals, Indianapolis, Ind.). After hybridization, the membrane was developed by enzyme immunoassay using a DIG nucleic acid detection kit (Roche Molecular Biochemicals).
DNA sequences flanking the transposon were determined by inverse PCR and DNA sequencing. Chromosomal DNAs from the mutants were digested with HindIII, self-ligated with T4 DNA ligase, and used as the PCR templates. Primers with EcoRV adapters (underlined) were designed using the published Tn916 sequence (19). Primer IPTNL3 (5' CGGATATCCGTAAAGTATCCGGAGAATA) was from positions 11990 to 12015 of the Tn916 coding strand, about 180 nucleotides upstream of a unique HindIII site, while primer IPTNR2 (5' CGGATATCCGTTTGAAGTGTCTACCTAT) was from positions 191 to 174 of the Tn916 antisense strand. PCR was carried out as follows. After initial denaturation for 2 min at 95°C, 36 cycles of amplification consisting of denaturation for 45 s at 94°C, annealing for 45 s at 53°C, and extension for 2 min at 72°C were performed. This procedure was followed by a final extension of 10 min at 72°C. The PCR products were analyzed by agarose gel electrophoresis, purified using a Qiagen PCR purification kit, and sequenced at the Molecular Genetics Core Sequencing Facility at The Forsyth Institute using a model 377 automated sequencer (Applied Biosystems, Foster City, Calif.). Each sequence obtained was compared with those in GenBank by using the BLASTX program (1).Nucleotide sequence accession numbers.
The nucleotide
sequences of the sites of Tn916 insertion in the different
biofilm mutants have been deposited in GenBank under accession
numbers AF207576 to AF207592 as indicated in Table 1.
|
| |
RESULTS |
|---|
|
|
|---|
S. gordonii biofilm formation is nutrient dependent. Motile, gram-negative bacteria have been used previously to study biofilm formation on abiotic surfaces (20, 47, 48, 50). In this study, the biofilm formation of a nonmotile gram-positive oral bacterium, S. gordonii Challis, was examined using an assay based on the method described in a previous study (48). In this assay, staining with 1% CV for 15 min enables the visualization of attached, sessile cells after bacterial biofilms have formed in microtiter plate wells for 16 h. Unattached, planktonic cells are removed by rinsing with water. Cells are stained purple with CV (A575 of 1 is equivalent to approximately 2 × 106 CFU/well), whereas abiotic surfaces are not stained. As this assay lasts only over 16 h, it is biased towards initial events, which might not allow identification of defects in late biofilm formation.
Biofilm assays were carried out under various conditions to determine the optimum experimental conditions. Biofilms were readily apparent on polystyrene but not polyvinylchloride surfaces, and both growth and biofilm formation were greater under anaerobic conditions (Fig. 1). Anaerobically grown cells were found to form heavier, more uniform biofilms on both surfaces than aerobically grown cells. As the bacteria were grown without agitation, the cells that did not form a biofilm settled to the bottom of U-shaped wells and were effectively removed by washing. The facultative anaerobe S. gordonii formed biofilms on the lower part of the wells on the U-shaped surfaces below the air-liquid interface, in contrast to aerobes such as P. aeruginosa and E. coli, which grow at the air-liquid interface (48, 50).
|
|
|
|
Screening for S. gordonii biofilm-defective
mutants.
A total of 18 (0.07%) biofilm-defective mutants were
isolated after 25,000 transposon mutants generated by Tn916
mutagenesis were screened using the biofilm assay described in this
study (Fig. 5). Only mutants exhibiting
an amount of growth similar to that of wild-type Challis were chosen
for further study, as a mutation that confers a nonspecific growth
defect can affect biofilm formation indirectly. The reduction in
biofilm formation ranged from 39% (the 8F9 mutant) to 91% (the 1C1
mutant), with a majority (14 of 18) of the mutants having more than
60% reduction in biofilm formation (Table 1). Southern hybridization
of HindIII-digested chromosomal DNA from each mutant
with DIG-labeled pAM120 confirmed the presence of Tn916. As
Tn916 has a single HindIII site, the presence
of two hybridizing bands is consistent with the mutant having only a
single transposon insertion. All the mutants isolated had single
insertions except for three with the mutations 11E5, 9F8, and 29F1,
which had three hybridizing bands, indicating the presence of two
transposon insertions. Hybridization results from nine of the
biofilm-defective mutants, which will be discussed in further detail,
are shown in Figure 6.
|
|
-amylase-binding protein in S. gordonii Challis
(51). In a previous study, the abpA gene was also
identified by Tn916 mutagenesis, with an insertion 15 nucleotides upstream of abpA (51). The second
insertion in 9F8 was in a region with no homology in the DNA database.
Either of these transpositions could be responsible for the
biofilm-defective phenotype of the 9F8 mutant.
The Tn916-flanking region of mutant 7 (29E5) has homology
with appC, which encodes a member of an oligopeptide (tetra-
or pentapeptide) transport system in B. subtilis. This
system may be a growth-monitoring communication system between cell
wall synthesis systems and the cytoplasm which senses the turnover rate
of cell wall peptides as a direct function of bacterial growth during
sporulation (35). Similar mechanisms may be involved in
modulating streptococcal growth during early dental plaque formation.
The Tn916-flanking region of mutant 8 (4B3) has homology
with mutT, a member of the DNA replication machinery that
prevents A · G mispairs. MutT is a nucleoside triphosphatase
which prevents A · T
C · G tranversions during
replication by removing an oxidized form of guanine, 8-oxo-dGTP, from
the nucleotide pool, thus preventing it from mispairing with template A
and maintaining replication fidelity (21). The
Tn916-flanking region of mutant 9 (13A12) has homology with
ytmP of B. subtilis. The function of this gene is
yet to be determined.
Nine of the biofilm-defective mutants isolated have genes homologous to
those in databases which may be important for the physiology of sessile
growth. The successful identification of biofilm-associated genes
indicates the utility of the polystyrene assay for studying bacterial
biofilms. In the remaining nine biofilm-defective mutants, the DNA
sequences flanking the transposon have no homology to genes in the DNA
databases. This suggests that the screening performed in this study has
identified previously unknown genes that are associated with biofilm formation.
The flanking regions of all the Tn916 insertions are
significantly AT rich, indicating that Tn916 has hotspots
for certain regions of the S. gordonii chromosome (Table 1).
These AT-rich regions contained significantly more T than A. The
presence of Tn916 preferred target sites which were AT rich
has also been noted in a review of conjugative transposons
(57).
| |
DISCUSSION |
|---|
|
|
|---|
Kolter and Losick (37) noted that until recently, even though most microorganisms grow as biofilms and the physical structures of different biofilms are well characterized, biofilms had not been studied using molecular genetic approaches. A well-studied, genetically amenable oral bacterium, S. gordonii Challis, was used in this study to identify genes that are required for biofilm formation on abiotic surfaces.
The observation that S. gordonii Challis biofilm formation was enhanced in a minimal medium but not in a nutritionally rich environment indicates that sessile growth may represent a survival strategy in a nutritionally limited environment, as surface colonization provides advantages such as increased capture of nutrients that may be adsorbed to surfaces (64). Starvation conditions have previously been reported to initiate adhesion as bacteria attempt to exploit a source of essential nutrients which may be in short supply in the surrounding environment (38). Oral surfaces in vivo also represent a nutritionally limited environment, and biofilm formation may be required for survival, as bacteria depend on degraded salivary constituents as nutrients (40).
Interspecies variation was observed in the ability of oral streptococci to form biofilm on abiotic surfaces, which may reflect differences in the mechanisms of colonization by different streptococcal species. For example, S. oralis C104, which demonstrated poor biofilm-forming ability, may lack effective colonization factors for binding to abiotic surfaces but still participate in plaque formation by binding to initial colonizing cells of other species. Most human viridans streptococci participate in intrageneric coaggregation, the cell-to-cell adherence among genetically distinct streptococci, and these interactions may foster the primary colonization of the tooth surfaces (36). Furthermore, an S. gordonii DL1 mutant that did not coaggregate with its streptococcal partner S. oralis C104 exhibited wild-type levels of coaggregation with actinomyces (8).
The oral environment experiences significant fluctuations in O2 tension, pH, and carbohydrate content due to variations in microflora, diet, and oral hygiene habits. The primary indicators of the two major dental diseases, periodontal disease and caries, are a shift in dental plaque flora from initial gram-positive facultative aerobes to mainly gram-negative anaerobes (58) and an increased acidogenicity due to bacterial metabolism of dietary sucrose (41), respectively. Some of these environmental changes, namely, in pH, osmolarity, and carbohydrate content, were found to influence streptococcal biofilm formation in vitro. As nutritional (48) and environmental (64) signals play a role in biofilm development, these observations may be useful in attempts to identify the cellular factors and molecular mechanisms involved in streptococcal biofilm formation.
Bacteria sense a large number of environmental signals and process this information into specific transcriptional responses. In gram-positive bacteria, cell-density-dependent gene expression regulatory modes appear to follow a common theme, in which the signal molecule is a posttranslationally processed peptide that is secreted by an ATP-binding cassette exporter. This peptide pheromone accumulates extracellularly in proportion to the total number of cells, providing an index of population densities (15), and functions as the input signal for the sensing component of a two-component signal transduction system (34). Therefore, these bacterial autoinduction systems represent cell-to-cell communication, which is also referred to as quorum sensing.
In S. gordonii, the sensing component of the two-component signal transduction system is ComD, an autophosphorylating histidine kinase. ComD is the receptor for the comC-encoded competence-stimulating peptide, a 50-amino-acid peptide pheromone that induces competence in the bacterial population at a critical extracellular concentration (27, 49). The second component, the cognate response regulator ComE, becomes activated after receiving the phosphoryl group from ComD at an aspartate residue and binds to specific promoter regions of appropriate target genes, therefore acting as a transcriptional factor (45).
One of the biofilm-defective mutants isolated had a transposon insertion within comD of S. gordonii, which encodes ComD (42). To our knowledge, this is the first report that cell-to-cell signaling is involved in the biofilm formation of a gram-positive species on an abiotic surface and is consistent with a previous report that the differentiation and integrity of P. aeruginosa biofilms are controlled by a specific quorum-sensing signal (12). A P. aeruginosa mutant defective in the production of N-(3-oxododecanoyl)-L-homoserine lactone, one of the acylhomoserine lactones that mediate quorum sensing, produced abnormal biofilms that were sensitive to the detergent biocide sodium dodecyl sulfate, indicating that a quorum-sensing signal is involved in biofilm differentiation and integrity (12). A recent study implicated cell density signaling in activation of the recovery process of nitrogen-starved Nitrosomonas europaea biofilms (3). Results from this study demonstrates that cell-to-cell signaling in biofilm formation may not be a characteristic restricted to P. aeruginosa or gram-negative bacteria.
PBPs are responsible for the assembly, maintenance, and regulation of peptidoglycan peptide structures. Identification of biofilm-associated genes that are involved in peptidoglycan biosynthesis indicates the importance of cell envelope integrity to the biofilm phenotype in streptococci, as mutations in peptidoglycan biosynthesis genes may result in cells with morphologies that lack a rigid cell envelope component.
Disruptions in genes regulating peptidoglycan synthesis are also likely to affect their ability to respond to environmental changes such as extracellular osmolarity, which is important during sessile growth. Change in environmental osmolarity can elicit structural alterations by cellular remodeling. Cellular remodeling has been shown to accompany long-term osmoadaptation, whereas the P-type ATPases are involved in acute-phase osmoadaptation (65). Identification of biofilm-associated genes that are involved in peptidoglycan biosynthesis suggest that osmoadaptation systems may play a role in biofilm formation.
One of the 18 biofilm-defective mutants (9F8) had two transposon
insertions, one of which is the 5' region of a salivary
-amylase-binding gene of S. gordonii (51).
This is the only adhesion-related gene of S. gordonii found
to have a potential role in biofilm formation. A previous study has
shown that the mannose-sensitive hemagglutination pilus of Vibrio
cholerae, which is involved in biofilm formation on abiotic
surfaces, is important for attachment but not pathogenicity
(63). The type IV pili of Pseudomonas aeruginosa,
which is required for biofilm formation on an abiotic surface, is also
important for bacterial adhesion to eukaryotic cell surfaces and
pathogenesis (47). These observations suggest that there may
be an overlap in the factors required for biofilm formation and those
for bacterial adhesion and/or pathogenesis in vivo. As the most
abundant enzyme in human saliva,
-amylase, binds with high affinity
to oral streptococci (14, 54), one of the multiple
amylase-binding proteins of S. gordonii Challis (51) may promote biofilm formation during early plaque
formation on nutritionally poor, saliva-coated tooth surfaces. This
potential role of
-amylase-binding protein in biofilm formation can
be determined only when the two transpositions in the biofilm-defective mutant are separated and analyzed for biofilm formation.
Although flagella and/or motility are important for biofilm formation in motile bacteria, nonmotile bacteria can also form biofilms, indicating that other genes may be involved (47, 48, 50). The successful isolation of biofilm-defective mutants clearly demonstrates the utility of the assay used. In addition, these mutants were used to identify genes that may be important in biofilm formation after initial adhesion. Nine of the 18 biofilm-defective mutants have disruptions in genetic loci that have no homology to genes in the databases. This polystyrene assay coupled with other assays such as flow cell and animal colonization studies will identify functions for some of these genes.
The relative proportion of the biofilm-deficient mutants isolated in this study (0.07%) was similar to the 0.08% obtained with Tn917 mutants of Staphylococcus epidermidis were screened for biofilm deficiency (28) but lower than the 0.3% obtained from Tn5-based mutants of P. aeruginosa (48). Results from this study, together with those of a previous report (57), indicate that Tn916 appears to preferentially transpose into AT-rich regions of the bacterial chromosome. Therefore, the biofilm-associated genes identified in this study may not represent the full complement of the genes necessary for the sessile growth of S. gordonii. Additional genes may be identified by insertion-duplication analysis or by using transposons from other gram-positive bacteria for mutagenesis.
In order to understand the processes involved in dental-plaque formation, different approaches, such as confocal scanning laser microscopy, which enables the study of biofilm communities without disturbance (9), and genetic approaches, need to be utilized. Two-component signal transduction systems (2) and other cell-to-cell signaling systems (18) have already become novel targets in the design of new types of microbial anti-infective therapy. Putative biofilm-associated genes may identify other processes important in sessile growth and facilitate the development of therapeutic agents that target the biofilm phenotype and cell-to-cell signaling agents and subsequently prevent the formation or promote the detachment of biofilms. Biofilm-associated genes will provide insight into the unique process of biofilm formation and may facilitate the development of therapeutic agents and strategies to control biofilm-mediated infections.
| |
ACKNOWLEDGMENTS |
|---|
We thank Z. Skobe of the Forsyth Institute for SEM analysis.
This work was supported by Public Health Service grants DE10969 and DE7009 from the National Institute of Dental and Craniofacial Research.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: The Forsyth Institute, Department of Molecular Genetics, 140 Fenway, Boston, MA 02115. Phone: (617) 262-5200, ext. 281. Fax: (617) 262-4021. E-mail: nganeshkumar{at}forsyth.org.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline]. |
| 2. |
Barrett, J. F., and J. A. Hoch.
1998.
Two-component signal transduction as a target for microbial anti-infective therapy.
Antimicrob. Agents Chemother.
42:1529-1536 |
| 3. | Batchelor, S. E., M. Cooper, S. R. Chhabra, L. A. Glover, G. S. Stewart, P. Williams, and J. I. Prosser. 1997. Cell density-regulated recovery of starved biofilm populations of ammonia-oxidizing bacteria. Appl. Environ. Microbiol. 63:2281-2286[Abstract]. |
| 4. |
Bloomquist, C. G.,
B. E. Reilly, and W. F. Liljemark.
1996.
Adherence, accumulation, and cell division of a natural adherent bacterial population.
J. Bacteriol.
178:1172-1177 |
| 5. |
Cain, B. D.,
P. J. Norton,
W. Eubanks,
H. S. Nick, and C. M. Allen.
1993.
Amplification of the bacA gene confers bacitracin resistance to Escherichia coli.
J. Bacteriol.
175:3784-3789 |
| 6. | Carlsson, J. 1972. Nutritional requirements of Streptococcus sanguis. Arch. Oral Biol. 17:1327-1332[CrossRef][Medline]. |
| 7. | Clemans, D. L., and P. E. Kolenbrander. 1995. Identification of a 100-kilodalton putative coaggregation-mediating adhesin of Streptococcus gordonii DL1 (Challis). Infect. Immun. 63:4890-4893[Abstract]. |
| 8. |
Clemans, D. L., and P. E. Kolenbrander.
1995.
Isolation and characterization of coaggregation-defective (Cog ) mutants of Streptococcus gordonii DL1 (Challis).
J. Ind. Microbiol.
15:193-197[CrossRef][Medline].
|
| 9. | Cook, G. S., J. W. Costerton, and R. J. Lamont. 1998. Biofilm formation by Porphyromonas gingivalis and Streptococcus gordonii. J. Periodontal Res. 33:323-327[CrossRef][Medline]. |
| 10. | Costerton, J. W., Z. Lewandowski, D. E. Caldwell, D. R. Korber, and H. M. Lappin-Scott. 1995. Microbial biofilms. Annu. Rev. Microbiol. 49:711-745[CrossRef][Medline]. |
| 11. |
Costerton, J. W.,
P. S. Stewart, and E. P. Greenberg.
1999.
Bacterial biofilms: a common cause of persistent infections.
Science
284:1318-1322 |
| 12. |
Davies, D. G.,
M. R. Parsek,
J. P. Pearson,
B. H. Iglewski,
J. W. Costerton, and E. P. Greenberg.
1998.
The involvement of cell-to-cell signals in the development of a bacterial biofilm.
Science
280:295-298 |
| 13. | Demuth, D. R., Y. Duan, W. Brooks, A. R. Holmes, R. McNab, and H. F. Jenkinson. 1996. Tandem genes encode cell-surface polypeptides SspA and SspB which mediate adhesion of the oral bacterium Streptococcus gordonii to human and bacterial receptors. Mol. Microbiol. 20:403-413[Medline]. |
| 14. | Douglas, C. W. 1983. The binding of human salivary alpha-amylase by oral strains of streptococcal bacteria. Arch. Oral Biol. 28:567-573[CrossRef][Medline]. |
| 15. | Dunny, G. M., and B. A. Leonard. 1997. Cell-cell communication in Gram-positive bacteria. Annu. Rev. Microbiol. 51:527-564[CrossRef][Medline]. |
| 16. |
Durack, D. T.
1995.
Prevention of infective endocarditis.
N. Engl. J. Med.
332:38-44 |
| 17. |
Fenno, J. C.,
D. J. LeBlanc, and P. Fives-Taylor.
1989.
Nucleotide sequence analysis of a type 1 fimbrial gene of Streptococcus sanguis FW213.
Infect. Immun.
57:3527-3533 |
| 18. |
Finch, R. G.,
D. I. Pritchard,
B. W. Bycroft,
P. Williams, and G. S. Stewart.
1998.
Quorum sensing: a novel target for anti-infective therapy.
J. Antimicrob. Chemother.
42:569-571 |
| 19. | Flannagan, S. E., L. A. Zitzow, Y. A. Su, and D. B. Clewell. 1994. Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32:350-354[CrossRef][Medline]. |
| 20. | Fletcher, M. 1977. The effects of culture concentration and age, time, and temperature on bacterial attachment to polystyrene. Can. J. Microbiol. 23:1-6. |
| 21. | Fowler, R. G., and R. M. Schaaper. 1997. The role of the mutT gene of Escherichia coli in maintaining replication fidelity. FEMS Microbiol. Rev. 21:43-54[CrossRef][Medline]. |
| 22. |
Ganeshkumar, N.,
M. Song, and B. C. McBride.
1988.
Cloning of a Streptococcus sanguis adhesin which mediates binding to saliva-coated hydroxyapatite.
Infect. Immun.
56:1150-1157 |
| 23. |
Gawron-Burke, C., and D. B. Clewell.
1984.
Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria.
J. Bacteriol.
159:214-221 |
| 24. |
Gibbons, R. J.
1989.
Bacterial adhesion to oral tissues: a model for infectious diseases.
J. Dent. Res.
68:750-760 |
| 25. | Gong, K., and M. C. Herzberg. 1997. Streptococcus sanguis expresses a 150-kilodalton two-domain adhesin: characterization of several independent adhesin epitopes. Infect. Immun. 65:3815-3821[Abstract]. |
| 26. | Gonzalez-Barca, E., A. Fernandez-Sevilla, J. Carratala, A. Granena, and F. Gudiol. 1996. Prospective study of 288 episodes of bacteremia in neutropenic cancer patients in a single institution. Eur. J. Clin. Microbiol. Infect. Dis. 15:291-296[CrossRef][Medline]. |
| 27. | Havarstein, L. S., P. Gaustad, I. F. Nes, and D. A. Morrison. 1996. Identification of the streptococcal competence-pheromone receptor. Mol. Microbiol. 21:863-869[CrossRef][Medline]. |
| 28. | Heilmann, C., C. Gerke, F. Perdreau-Remington, and F. Gotz. 1996. Characterization of Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm formation. Infect. Immun. 64:277-282[Abstract]. |
| 29. | Hoyle, B. D., and J. W. Costerton. 1991. Bacterial resistance to antibiotics: the role of biofilms. Prog. Drug. Res. 37:91-105[Medline]. |
| 30. | Jenkinson, H. F. 1986. Cell-surface proteins of Streptococcus sanguis associated with cell hydrophobicity and coaggregation properties. J. Gen. Microbiol. 132:1575-1589[Medline]. |
| 31. | Jenkinson, H. F. 1994. Cell surface protein receptors in oral streptococci. FEMS Microbiol. Lett. 121:133-140[CrossRef][Medline]. |
| 32. | Kanamaru, K., S. Kashiwagi, and T. Mizuno. 1993. The cyanobacterium, Synechococcus sp. PCC7942, possesses two distinct genes encoding cation-transporting P-type ATPases. FEBS Lett. 330:99-104[CrossRef][Medline]. |
| 33. | Kern, W., E. Kurrle, and T. Schmeiser. 1990. Streptococcal bacteremia in adult patients with leukemia undergoing aggressive chemotherapy. A review of 55 cases. Infection 18:138-145[CrossRef][Medline]. |
| 34. | Kleerebezem, M., L. E. Quadri, O. P. Kuipers, and W. M. de Vos. 1997. Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria. Mol. Microbiol. 24:895-904[CrossRef][Medline]. |
| 35. | Koide, A., and J. A. Hoch. 1994. Identification of a second oligopeptide transport system in Bacillus subtilis and determination of its role in sporulation. Mol. Microbiol. 13:417-426[CrossRef][Medline]. |
| 36. |
Kolenbrander, P. E.,
R. N. Andersen, and L. V. Moore.
1990.
Intrageneric coaggregation among strains of human oral bacteria: potential role in primary colonization of the tooth surface.
Appl. Environ. Microbiol.
56:3890-3894 |
| 37. |
Kolter, R., and R. Losick.
1998.
One for all and all for one.
Science
280:226-227 |
| 38. | Korber, D. R., J. R. Lawrence, H. M. Lappin-Scott, and J. W. Costerton. 1995. Growth of microorganisms on surfaces, p. 15-45. In H. M. Lappin-Scott, and J. W. Costerton (ed.), Microbial biofilms. Cambridge University Press, Cambridge, United Kingdom. |
| 39. |
LeBlanc, D. J., and F. P. Hassell.
1976.
Transformation of Streptococcus sanguis Challis by plasmid deoxyribonucleic acid from Streptococcus faecalis.
J. Bacteriol.
128:347-355 |
| 40. | Liljemark, W. F., C. G. Bloomquist, B. E. Reilly, C. J. Bernards, D. W. Townsend, A. T. Pennock, and J. L. LeMoine. 1997. Growth dynamics in a natural biofilm and its impact on oral disease management. Adv. Dent. Res. 11:14-23[Abstract]. |
| 41. |
Loesche, W. J.
1986.
Role of Streptococcus mutans in human dental decay.
Microbiol. Rev.
50:353-380 |
| 42. |
Lunsford, R. D., and J. London.
1996.
Natural genetic transformation in Streptococcus gordonii: comX imparts spontaneous competence on strain Wicky.
J. Bacteriol.
178:5831-5835 |
| 43. |
Mack, D.,
M. Nedelmann,
A. Krokotsch,
A. Schwarzkopf,
J. Heesemann, and R. Laufs.
1994.
Characterization of transposon mutants of biofilm-producing Staphylococcus epidermidis impaired in the accumulative phase of biofilm production: genetic identification of a hexosamine-containing polysaccharide intercellular adhesin.
Infect. Immun.
62:3244-3253 |
| 44. |
Mengin-Lecreulx, D., and J. van Heijenoort.
1996.
Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli.
J. Biol. Chem.
271:32-39 |
| 45. | Morrison, D. A. 1997. Streptococcal competence for genetic transformation: regulation by peptide pheromones. Microb. Drug Resist. 3:27-37[Medline]. |
| 46. | Nyvad, B., and M. Kilian. 1990. Comparison of the initial streptococcal microflora on dental enamel in caries-active and in caries-inactive individuals. Caries Res. 24:267-272[Medline]. |
| 47. | O'Toole, G. A., and R. Kolter. 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304[CrossRef][Medline]. |
| 48. | O'Toole, G. A., and R. Kolter. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signaling pathways: a genetic analysis. Mol. Microbiol. 28:449-461[CrossRef][Medline]. |
| 49. | Pestova, E. V., L. S. Havarstein, and D. A. Morrison. 1996. Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol. Microbiol. 21:853-862[CrossRef][Medline]. |
| 50. | Pratt, L. A., and R. Kolter. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol. Microbiol. 30:285-293[CrossRef][Medline]. |
| 51. | Rogers, J. D., E. M. Haase, A. E. Brown, C. W. Douglas, J. P. Gwynn, and F. A. Scannapieco. 1998. Identification and analysis of a gene (abpA) encoding a major amylase-binding protein in Streptococcus gordonii. Microbiology 144:1223-1233[Abstract]. |
| 52. | Rosan, B., C. T. Baker, G. M. Nelson, R. Berman, R. J. Lamont, and D. R. Demuth. 1989. Cloning and expression of an adhesin antigen of Streptococcus sanguis G9B in Escherichia coli. J. Gen. Microbiol. 135:531-538[Medline]. |
| 53. |
Scannapieco, F. A.
1994.
Saliva-bacterium interactions in oral microbial ecology.
Crit. Rev. Oral Biol. Med.
5:203-248 |
| 54. |
Scannapieco, F. A.,
E. J. Bergey,
M. S. Reddy, and M. J. Levine.
1989.
Characterization of salivary alpha-amylase binding to Streptococcus sanguis.
Infect. Immun.
57:2853-2863 |
| 55. |
Schilling, K. M., and W. H. Bowen.
1992.
Glucans synthesized in situ in experimental salivary pellicle function as specific binding sites for Streptococcus mutans.
Infect. Immun.
60:284-295 |
| 56. | Schumacher-Perdreau, F., C. Heilmann, G. Peters, F. Gotz, and G. Pulverer. 1994. Comparative analysis of a biofilm-forming Staphylococcus epidermidis strain and its adhesion-positive, accumulation-negative mutant M7. FEMS Microbiol. Lett. 117:71-78[CrossRef][Medline]. |
| 57. | Scott, J. R., and G. G. Churchward. 1995. Conjugative transposition. Annu. Rev. Microbiol. 49:367-397[CrossRef][Medline]. |
| 58. | Socransky, S. S., A. C. R. Tanner, A. D. Haffajee, J. D. Hillman, and J. M. Goodson. 1982. Present status of studies on microbial etiology of periodontal diseases, p. 1-12. In R. J. Genco, and S. E. Mergenhagen (ed.), Host-parasite interactions in periodontal disease. American Society for Microbiology, Washington, D.C. |
| 59. |
Switalski, L. M.,
H. Murchison,
R. Timpl,
R. Curtiss, III, and M. Hook.
1987.
Binding of laminin to oral and endocarditis strains of viridans streptococci.
J. Bacteriol.
169:1095-1101 |
| 60. |
Tart, R. C., and I. van de Rijn.
1991.
Analysis of adherence of Streptococcus defectivus and endocarditis-associated streptococci to extracellular matrix.
Infect. Immun.
59:857-862 |
| 61. | van der Meer, J. T., J. Thompson, H. A. Valkenburg, and M. F. Michel. 1992. Epidemiology of bacterial endocarditis in The Netherlands. I. Patient characteristics. Arch. Intern. Med. 152:1863-1868[Abstract]. |
| 62. |
Vickerman, M. M.,
D. B. Clewell, and G. W. Jones.
1991.
Sucrose-promoted accumulation of growing glucosyltransferase variants of Streptococcus gordonii on hydroxyapatite surfaces.
Infect. Immun.
59:3523-3530 |
| 63. |
Watnick, P. I.,
K. J. Fullner, and R. Kolter.
1999.
A role for the mannose-sensitive hemagglutinin in biofilm formation by Vibrio cholerae El Tor.
J. Bacteriol.
181:3606-3609 |
| 64. | Wimpenny, J. W. T., and R. A. Colasanti. 1997. A unifying hypothesis for the structure of microbial films based on cellular automation models. FEMS Microbiol. Ecol. 22:1-16. |
| 65. |
Wood, J. M.
1999.
Osmosensing by bacteria: signals and membrane-based sensors.
Microbiol. Mol. Biol. Rev.
63:230-262 |
This article has been cited by other articles: