Previous Article | Next Article 
Journal of Bacteriology, March 2000, p. 1374-1382, Vol. 182, No. 5
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Streptococcus gordonii Biofilm
Formation: Identification of Genes that Code for Biofilm
Phenotypes
C. Y.
Loo,
D. A.
Corliss, and
N.
Ganeshkumar*
Department of Molecular Genetics, The Forsyth
Institute, Boston, Massachusetts 02115
Received 27 September 1999/Accepted 7 December 1999
 |
ABSTRACT |
Viridans streptococci, which include Streptococcus
gordonii, are pioneer oral bacteria that initiate dental plaque
formation. Sessile bacteria in a biofilm exhibit a mode of growth that
is distinct from that of planktonic bacteria. Biofilm formation of S. gordonii Challis was characterized using an in vitro
biofilm formation assay on polystyrene surfaces. The same assay was
used as a nonbiased method to screen isogenic mutants generated
by Tn916 transposon mutagenesis for defective biofilm
formation. Biofilms formed optimally when bacteria were grown in
a minimal medium under anaerobic conditions. Biofilm formation was
affected by changes in pH, osmolarity, and carbohydrate
content of the growth media. Eighteen biofilm-defective mutants of
S. gordonii Challis were identified based on Southern
hybridization with a Tn916-based probe and DNA sequences of
the Tn916-flanking regions. Molecular analyses of these
mutants showed that some of the genes required for biofilm
formation are involved in signal transduction, peptidoglycan
biosynthesis, and adhesion. These characteristics are associated
with quorum sensing, osmoadaptation, and adhesion functions in oral
streptococci. Only nine of the biofilm-defective mutants
had defects in genes of known function, suggesting that novel
aspects of bacterial physiology may play a part in biofilm formation. Further identification and characterization of
biofilm-associated genes will provide insight into the
molecular mechanisms of biofilm formation of oral streptococci.
 |
INTRODUCTION |
Viridans streptococci, which include
Streptococcus gordonii, are pioneer bacteria that initiate
the formation of biofilms on tooth surfaces known as dental plaque.
These ubiquitous initial colonizers constitute a majority of the
cultivable bacteria found in dental plaque (46) and
are the most frequent etiologic agents of bacterial endocarditis
(16, 61). Over the last decade, viridans streptococci have
become significant opportunistic pathogens and a major cause of
bacteremia in immunocompromised patients, accounting for 40% of
infections in neutropenic patients (26, 33).
Dental plaque forms by two distinct sequential steps: adhesion of early
colonizers to host tissue components (24, 53) and then
time-dependent accumulation of multi-layered cell clusters embedded in
a matrix of bacterial and host constituents (4, 55, 62).
Although numerous studies have elucidated the mechanisms of initial
streptococcal adhesion (7, 13, 17, 22, 25, 31, 51, 52), the
subsequent process of bacterial accumulation and proliferation leading
to functionally heterogeneously organized sessile communities called
dental plaque is poorly understood.
Genetic and molecular studies of dental plaque have predominantly used
planktonic bacteria grown in batch culture. Although these studies have
provided extensive and relevant information, dental plaque bacteria
colonize and exist as sessile bacterial communities. Biofilm formation
is initiated by interactions between planktonic bacteria and a surface
in response to appropriate environmental signals. A fully developed,
surface-attached dental biofilm is highly structured, with distinct
architectural and physiochemical properties commonly observed with
other biofilm communities (10, 11). Biofilm bacteria exhibit
a distinct mode of growth which differs from that of planktonic cells
and which is characterized by an increased resistance to antibiotics
and differences in levels of gene expression and cellular physiology
(10, 11, 29). Therefore, we hypothesize that novel,
biofilm-associated genes are required for the development of dental
biofilms after initial bacterium-surface contact is established. As
sessile populations reflect conditions in vivo more accurately than
planktonic bacteria, the genes expressed by biofilm bacteria are likely
to play a role in the colonization of tooth surfaces and the increased
virulence exhibited by viridans streptococci in susceptible hosts
(16, 26, 33, 61). The aims of this study were to determine
the influence of various environmental factors on the in vitro biofilm formation of S. gordonii Challis and to identify genes
involved in the biofilm formation of this species of viridans streptococci.
The utility of polystyrene as a surface for attachment by marine
pseudomonads under various physiological conditions was demonstrated by
Fletcher (20). Microtiter plates made of polystyrene provide a convenient and sterile abiotic surface for studying bacterial biofilm
formation. Studies using abiotic surfaces coupled with transposon
mutagenesis have identified novel genes in the biofilm formation of
Staphylococcus epidermidis (28, 43, 56),
Escherichia coli (50), and Pseudomonas
fluorescens (47, 48). Since tooth surfaces, generally
covered by a thin pellicle layer of salivary origin, are abiotic, a
similar strategy with Tn916 transposon mutagenesis was used
in this study as a nonbiased method of isolating biofilm-defective
mutants of S. gordonii Challis and identifying genetic loci
that are associated with biofilm formation.
 |
MATERIALS AND METHODS |
Bacterial strains, media, and chemicals.
S. gordonii
Challis 2, a rifamycin-resistant (500 µg/ml) strain of S. gordonii Challis (42), was used as the parent strain. Other oral streptococcal strains used were obtained from the American Type Culture Collection, except for Streptococcus
parasanguis FW213 (from P. Fives-Taylor, University of Vermont)
and Streptococcus oralis C104 (from P. Kolenbrander,
National Institute of Dental and Craniofacial Research). All strains
were grown in Todd-Hewitt broth with 0.2% yeast extract (THB+YE).
Antibiotics were added at the following concentrations: for E. coli, 100 µg of ampicillin ml
1 and 4 µg of
tetracycline ml
1, and for S. gordonii, 10 µg
of tetracycline ml
1. All enzymes for DNA manipulations
were purchased from Promega (Madison, Wis.).
Biofilm assay.
The biofilm formation assay used is based on
the method by O'Toole and Kolter (48). A minimal, defined
medium modified from the work of Carlsson (6) and Jenkinson
(30) was used as the biofilm medium (BM). The BM contained
58 mM K2HPO4, 15 mM
KH2PO4, 10 mM
(NH4)2SO4, 35 mM NaCl, 0.8%
(wt/vol) glucose, 0.2% (wt/vol) Casamino Acids (CAA), and 100 mM
MnCl2 · 4H2O (pH 7.4) and was supplemented with filter-sterilized vitamins (0.04 mM nicotinic acid,
0.1 mM pyridoxine HCl, 0.01 mM pantothenic acid, 1 µM riboflavin, 0.3 µM thiamin HCl, and 0.05 µM D-biotin), amino acids (4 mM L-glutamic acid, 1 mM L-arginine HCl, 1.3 mM
L-cysteine HCl, and 0.1 mM L-tryptophan), and 2 mM MgSO2 · 7H2O.
Round-bottomed microtiter plates (Becton Dickinson Labware, Lincoln
Park, N.J.) containing 100 µl of BM per well were inoculated with
S. gordonii Challis (4.2 × 106 CFU per
well) from a 16-h growth in THB+YE without agitation. After 16 h
of incubation at 37°C, 25 µl of 1% (wt/vol) crystal violet (CV)
solution was added to each well. After 15 min, wells were rinsed three
times with 200 µl of distilled H2O and air dried. Bacterial growth and biofilm formation were quantified by measuring the
absorbance at 575 nm (A575) of the bacterial
culture and CV-stained biofilm, respectively. Each assay was performed
in triplicate. Biofilm formation was examined on both polystyrene
(Falcon 3918) and polyvinylchloride (Falcon 3911) microtiter plates
under aerobic and anaerobic conditions to determine the optimum
conditions for the assay.
All the biofilm assays described below were performed on polystyrene
plates under anaerobic conditions. Biofilm formation
of
S. gordonii Challis was examined in each of the following media:
BM,
BM without glucose, BM without CAA, THB, THB+YE, and Trypticase
soy
broth
(TSB).
Bacterial growth and biofilm formation of
S. gordonii
Challis were assayed over 16 h to determine the relationship
between
growth and biofilm formation. The effects of changes in
osmolarity
on
S. gordonii Challis biofilm formation were
assessed by supplementing
BM with the osmolyte NaCl (0 to 0.4 M). In
addition, the influence
of changes in pH on biofilm formation was
examined by using BM
with a starting pH that ranged from 3 to 12. The
effects of replacing
the glucose in BM with an alternative carbohydrate
at a final
concentration of 0.8% (wt/vol) were examined. The
carbohydrates
tested were arabinose, fructose, fucose, galactose,
lactose, maltose,
maltotriose, mannose, raffinose, ribose, rhamnose,
sucrose, and
xylose.
Biofilm formation of
S. gordonii Challis and 15 other oral
streptococci were assayed and categorized based on the
A575 of
the CV-stained biofilm. When the
A575 of the CV-stained biofilm
was greater than
2.0, the strain was categorized as a good biofilm
former. Strains which
produced CV-stained biofilms with an
A575 of 1.0 to 2.0 were designated moderate biofilm formers, while
those with
CV-stained biofilms that had an
A575 lower than
1.0
were categorized as poor biofilm
formers.
SEM.
Biofilm formation of S. gordonii Challis on
polystyrene surfaces coated with three different matrix proteins was
assayed. Laminin (2 µg/cm2), type IV collagen (10 µg/cm2), and fibronectin (5 µg/cm2) were
each used to coat polystyrene microtiter plates according to the
instructions of the manufacturer (Sigma-Aldrich Co., St. Louis, Mo.).
Plates were air dried under UV and used in the biofilm assay as
described previously. Biofilms that formed were examined by scanning
electron microscopy (SEM) to verify the quantitative results observed.
The microtiter plates were fixed by adding an equal volume of
formaldehyde-glutaraldehyde to the medium for 1 h, followed by
addition of a full-strength fixative overnight. The wells were washed
three times with 0.1 N cacodylate buffer, postfixed with 2%
OsO4 in s-collidine buffer for 2 h, and
rinsed with water. Following dehydration through a graded series of
ethanol, the collars of the wells were cut away with a band saw. The
wells were rinsed with ethanol and air dried. The 96-well plate was then cut into six equal parts, and the upper left corner of each section was marked for orientation of the wells. The sections were
mounted on aluminum stubs, coated with palladium-gold, and examined in
a JEOL 6400 scanning electron microscope. The sections were tilted
45° in order to examine the sides of wells. Wells for photography
were randomly selected, but the area within the well for viewing was
always measured to be 2 mm from the cut edge of the collar, thus
avoiding the bacteria which may have settled at the bottom of the well
during incubation. Polaroid photographs were taken of representative
areas and digitized with a scanner (Agfa Corp., Ridgefield, N.J.) for reproduction.
Tn916 transposon mutagenesis.
S. gordonii
Challis grown in THB+YE was diluted (1:100) in streptococcal
transformation medium (39). The medium consisted of 1%
Proteose Peptone, 0.2% YE, and 0.2% glucose (pH 7.8) and was
supplemented with 10% heat-inactivated horse serum (Sigma). After
inoculation, the culture was incubated anaerobically at 37°C for 105 min for maximum transformation efficiency (39). After
incubation, 2 to 3 µg of pAM120 (pGL101 containing
pAD1EcoRIF::Tn916) plasmid DNA was
mixed with 0.5 ml of the culture and the mixture was incubated for
another 4 h under anaerobic conditions at 37°C. Cells were then
plated on brain heart infusion agar (BBL Microbiology Systems,
Cockeysville, Md.) containing tetracycline and incubated anaerobically
for 48 h. The plasmid DNA for transformation was isolated from
E. coli CG120 (23) using a maxi prep kit (Qiagen Inc., Valencia, Calif.). The transformation frequency was 3 × 105 transformants per µg of DNA. Each
tetracycline-resistant colony was picked and transferred into a well on
a microtiter plate containing 200 µl of BM with tetracycline. After
the inoculum was mixed, 100 µl of the BM was transferred to another
well on a new microtiter plate to create a duplicate. Both plates were
then incubated anaerobically at 37°C for 24 to 48 h. After
incubation, bacterial growth in each well was determined by recording
the A575 of the culture, and one plate was
stained with 1% CV. Bacteria from the duplicate plate corresponding to
wells with equivalent levels of growth but poor CV staining were picked
as putative biofilm formation-defective mutants. These putative mutants
were streaked onto brain heart infusion agar containing tetracycline
and retested for their ability to form biofilms to rule out false
positives. Colonies that continued to show defective biofilm formation
were designated biofilm-defective mutants.
Molecular techniques.
Chromosomal DNA was isolated from the
wild-type S. gordonii Challis and putative biofilm-defective
mutants by the method described by Ganeshkumar et al. (22).
DNA was digested with HindIII, separated by agarose gel
electrophoresis, and transferred onto a nitrocellulose membrane for
Southern hybridization. The probe used for hybridization was pAM120
labeled with digoxigenin (DIG) using the DIG DNA labeling system,
according to the instructions of the manufacturer (Roche Molecular
Biochemicals, Indianapolis, Ind.). After hybridization, the membrane
was developed by enzyme immunoassay using a DIG nucleic acid detection
kit (Roche Molecular Biochemicals).
DNA sequences flanking the transposon were determined by inverse PCR
and DNA sequencing. Chromosomal DNAs from the mutants
were digested
with
HindIII, self-ligated with T4 DNA ligase, and
used
as the PCR templates. Primers with
EcoRV adapters
(underlined)
were designed using the published Tn
916
sequence (
19). Primer
IPTNL3 (5'
CG
GATATCCGTAAAGTATCCGGAGAATA) was from positions
11990
to 12015 of the Tn
916 coding strand, about 180 nucleotides upstream
of a unique
HindIII site, while
primer IPTNR2 (5' CG
GATATCCGTTTGAAGTGTCTACCTAT)
was from positions 191 to 174 of the Tn
916 antisense
strand. PCR
was carried out as follows. After initial denaturation for
2 min
at 95°C, 36 cycles of amplification consisting of denaturation
for 45 s at 94°C, annealing for 45 s at 53°C, and
extension for
2 min at 72°C were performed. This procedure was
followed by a
final extension of 10 min at 72°C. The PCR products
were analyzed
by agarose gel electrophoresis, purified using a Qiagen
PCR purification
kit, and sequenced at the Molecular Genetics Core
Sequencing Facility
at The Forsyth Institute using a model 377 automated sequencer
(Applied Biosystems, Foster City, Calif.). Each
sequence obtained
was compared with those in GenBank by using the
BLASTX program
(
1).
Nucleotide sequence accession numbers.
The nucleotide
sequences of the sites of Tn916 insertion in the different
biofilm mutants have been deposited in GenBank under accession
numbers AF207576 to AF207592 as indicated in Table 1.
 |
RESULTS |
S. gordonii biofilm formation is nutrient
dependent.
Motile, gram-negative bacteria have been used
previously to study biofilm formation on abiotic surfaces (20, 47,
48, 50). In this study, the biofilm formation of a nonmotile
gram-positive oral bacterium, S. gordonii Challis, was
examined using an assay based on the method described in a previous
study (48). In this assay, staining with 1% CV for 15 min
enables the visualization of attached, sessile cells after bacterial
biofilms have formed in microtiter plate wells for 16 h.
Unattached, planktonic cells are removed by rinsing with water. Cells
are stained purple with CV (A575 of 1 is
equivalent to approximately 2 × 106 CFU/well),
whereas abiotic surfaces are not stained. As this assay lasts only over
16 h, it is biased towards initial events, which might not allow
identification of defects in late biofilm formation.
Biofilm assays were carried out under various conditions to
determine the optimum experimental conditions. Biofilms were readily
apparent on polystyrene but not polyvinylchloride surfaces, and
both
growth and biofilm formation were greater under anaerobic
conditions
(Fig.
1). Anaerobically grown cells were
found to form
heavier, more uniform biofilms on both surfaces than
aerobically
grown cells. As the bacteria were grown without agitation,
the
cells that did not form a biofilm settled to the bottom of U-shaped
wells and were effectively removed by washing. The facultative
anaerobe
S. gordonii formed biofilms on the lower part of the
wells
on the U-shaped surfaces below the air-liquid interface,
in contrast to
aerobes such as
P. aeruginosa and
E. coli, which
grow at the air-liquid interface (
48,
50).

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 1.
Bacterial growth and biofilm formation of S. gordonii Challis under different growth conditions. Bacteria were
grown in either BM, BM without glucose, BM without CAA, THB, THB+YE, or
TSB. Growth and biofilm formation were measured under aerobic (#) and
anaerobic conditions. All assays were performed in triplicate, and mean
values and standard deviations are shown.
|
|
When different media were used in the biofilm assay, only BM produced
uniform biofilms (Fig.
1). No growth occurred when glucose
or CAA was
omitted from BM. In enriched media, such as THB, THB+YE,
and TSB,
bacteria grew as well as in BM but failed to attach to
the surface
evenly, instead forming pellets at the bottom of the
well. It appears
that a nutritionally rich environment does not
favor
S. gordonii biofilm formation on polystyrene but that a
nutritionally
limited environment increases sessile
growth.
When bacterial growth and biofilm formation of
S. gordonii
Challis were assayed over 16 h, a typical exponential growth curve
was observed whereas biofilm formation increased linearly up to
10 h, at which time the CV-stained biofilm plateaued (at an
A575 of ~2.5). Although growth was minimal up
to 6 h, biofilm formation
increased steadily during this time
(data not shown). Due to these
preliminary observations, subsequent
biofilm assays were performed
on polystyrene microtiter plates
containing BM (the defined, minimal
medium containing glucose and CAA),
which resulted in distinct
biofilms after 16 h of anaerobic
incubation at 37°C.
When the osmolarity of the BM was increased (Fig.
2), an initial increase in bacterial
growth (at 0.1 to 0.3 M NaCl) was followed
by a decrease in growth (at
0.4 M NaCl). In contrast, biofilm
formation was reduced when osmolarity
was increased from 0.1 to
0.4 M NaCl. When the starting pH of the BM
was altered, biofilm
formation was reduced at pH levels below 6 or
above 8 while growth
was reduced only when the pH was below 6 or above
10.5. Generally,
biofilm formation was more sensitive to pH changes
than bacterial
growth. Maltose, mannose, sucrose, fructose, galactose,
lactose,
and maltotriose were found to be viable alternative carbon
sources
which could be used without adversely affecting growth or
biofilm
formation. The remaining carbohydrates examined, xylose,
ribose,
fucose, arabinose, raffinose, and rhamnose, did not support
bacterial
growth; therefore, no biofilm formation was seen.

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 2.
Bacterial growth and biofilm formation of S. gordonii Challis in BM with different levels of osmolarity. The
NaCl supplement in BM varied from 0 to 0.4 M. Assays were performed
using BM and polystyrene plates under anaerobic conditions. A
representative row of CV-stained microtiter plate wells is shown above
the graph.
|
|
Biofilm formation of
S. gordonii Challis and 15 other oral
streptococci were assayed and categorized based on the
A575 of
the CV-stained biofilm (Fig.
3). Four of the 16 strains tested,
namely,
S. gordonii Challis,
S. gordonii 12396 and 33399, and
Streptococcus sanguis 10556, were good
biofilm formers. Three
of the tested strains were moderate biofilm
formers, consisting
of
S. gordonii 10558,
S. oralis 11427, and
S. parasanguis 15909,
while 9 of the
16 strains (the largest group) were poor biofilm
formers, consisting of
Streptococcus anginosus 10713,
Streptococcus constellatus 2226,
Streptococcus mitis 4212 and 99456,
S. oralis 10557 and C104,
S. parasanguis FW213
and 15911, and
Streptococcus intermedius 27335. The biofilm
medium used was optimized for
S. gordonii; hence, other oral
streptococcal species such as
S. anginosus 10713,
S. intermedius 27335,
S. parasanguis FW213, and
S. oralis 11427 were found to grow poorly in this medium. At the same
time,
S. oralis C104 grew very well in BM but was unable to
form biofilm
on polystyrene surfaces. These results indicate a wide
variation
in the abilities of oral streptococci grown in BM to form
biofilms
on polystyrene. Variation in the ability to form biofilms was
also observed within the same species.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
Bacterial growth and biofilm formation of various oral
streptococci. Assays were performed using BM and polystyrene plates
under anaerobic conditions.
|
|
In order to determine whether mammalian matrix proteins affect the
biofilm formation of
S. gordonii Challis, polystyrene
surfaces
coated with laminin, type IV collagen, and fibronectin were
used.
Polystyrene plates coated with laminin and fibronectin had a
slight
reduction in biofilm formation, while uncoated polystyrene and
the collagen-coated polystyrene exhibited no difference in biofilm
formation (data not shown). As the results from both the quantitative
assay and SEM (Fig.
4) demonstrate that
biofilm formation on coated
surfaces did not differ significantly from
that on uncoated polystyrene,
the latter could be justifiably used to
screen for biofilm phenotypes.
Interestingly, coated surfaces showed
some structural differences,
with more cell clusters, whereas uncoated
polystyrene showed a
uniform distribution of biofilm bacteria. The use
of surfaces
coated with matrix proteins can facilitate the isolation of
mutants
that are defective in binding to proteins on damaged heart
valves
and subsequent identification of bacterium-host interactions
that
are important in biofilm formation and the pathogenesis of
endocarditis
(
59,
60).

View larger version (162K):
[in this window]
[in a new window]
|
FIG. 4.
SEM micrographs of S. gordonii Challis
biofilm formation on uncoated and coated polystyrene surfaces. (A)
Uncoated polystyrene; (B) laminin; (C) type IV collagen; (D)
fibronectin. Magnification is shown by the bar (10 µm). Two different
magnifications are shown for each surface (×1,000 for the upper images
and ×3,000 for the lower images).
|
|
Screening for S. gordonii biofilm-defective
mutants.
A total of 18 (0.07%) biofilm-defective mutants were
isolated after 25,000 transposon mutants generated by Tn916
mutagenesis were screened using the biofilm assay described in this
study (Fig. 5). Only mutants exhibiting
an amount of growth similar to that of wild-type Challis were chosen
for further study, as a mutation that confers a nonspecific growth
defect can affect biofilm formation indirectly. The reduction in
biofilm formation ranged from 39% (the 8F9 mutant) to 91% (the 1C1
mutant), with a majority (14 of 18) of the mutants having more than
60% reduction in biofilm formation (Table 1). Southern hybridization
of HindIII-digested chromosomal DNA from each mutant
with DIG-labeled pAM120 confirmed the presence of Tn916. As
Tn916 has a single HindIII site, the presence
of two hybridizing bands is consistent with the mutant having only a
single transposon insertion. All the mutants isolated had single
insertions except for three with the mutations 11E5, 9F8, and 29F1,
which had three hybridizing bands, indicating the presence of two
transposon insertions. Hybridization results from nine of the
biofilm-defective mutants, which will be discussed in further detail,
are shown in Figure 6.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Bacterial growth and biofilm formation of wild-type
S. gordonii Challis and biofilm-defective mutants. Assays
were performed using BM and polystyrene plates under anaerobic
conditions.
|
|

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 6.
Southern hybridization of
HindIII-digested chromosomal DNAs from nine
representative biofilm-defective mutants with a DIG-labeled pAM120
probe containing Tn916. Lanes: 1, 8F9 mutant; 2, 1C1 mutant;
3, 11E5 mutant; 4, 11B4 mutant; 5, 15B3 mutant; 6, 9F8 mutant; 7, 29E5
mutant; 8, 4B3 mutant; 9, 13A12 mutant. DNA sizes are shown on the
right.
|
|
The DNA sequence flanking each Tn
916 insertion was
determined in order to identify the gene(s) disrupted in each mutant.
The
number of nucleotides sequenced from the various mutants ranged
from 53 to 886. Each sequence obtained was analyzed using the
BLASTX
program (
1), which translates the DNA sequences in all
six
reading frames and compares these predicted protein sequences
with
those in GenBank. Eighteen biofilm-defective mutants of
S. gordonii Challis were identified based on Southern hybridization
and analyses of sequences of the Tn
916-flanking regions
(Table
1). The number of PCR products obtained from the mutants
confirmed
the number of transposon insertions indicated by the Southern
hybridization
results.
Biofilm-defective mutant 1 (8F9) had an insertion within the
comD gene (65 nucleotides into the open reading frame
[ORF])
in the competence locus (
comCDE operon) of
S. gordonii Challis
(
42). ComD is a histidine kinase that
can act as an environmental
sensor, and its activity is regulated in
response to specific
stimuli.
Bacterial cell wall peptidoglycan is a covalently closed, net-like
polymer in which glycan strands are linked by peptides.
Its structure
is determined by many biosynthetic and autolytic
reactions. The DNA
sequences of Tn
916-flanking regions in biofilm-defective
mutants 2 (1C1), 3 (11E5), 4 (11B4), and 5 (15B3) identified
homologs
in peptidoglycan biosynthesis genes, including genes
that encode
penicillin-binding proteins (PBPs), which are active-site
serine
transferases. Mutant 2 (1C1) has a transposon insertion in an
ORF that is homologous to the gene encoding PBP 2B of
S. pneumoniae,
a transpeptidase from the class B
high-molecular-weight
PBPs.
Mutant 3 (11E5) had two transpositions that were separated after
inverse PCR by agarose gel electrophoresis. The lower fragment,
designated 11E5L, has a transposon insertion in an ORF homologous
to
the gene for PBP 5 of
Bacillus subtilis, a
DD-carboxypeptidase
from the class A low-molecular-weight
PBPs. The Tn
916-flanking
region in the higher fragment,
designated 11E5U, has homology
with a putative cation-transporting
ATPase from
Mycobacterium tuberculosis. This P-type (or E1
E2-type) ATPase belongs to a
large family of prokaryotic and eukaryotic
proteins that transport
a variety of cations in various cellular
processes. An insertion
mutant of a P-type prokaryotic ATPase gene in
Synechococcus sp.
strain PCC7942 has demonstrated
hypersensitivity to osmotic stress
upon addition of NaCl or sorbitol to
the medium (
32), suggesting
a possible role in
osmoadaptation. Osmoadaptation is an adaptive
response to changes in
external turgor pressure and is mediated
by a primary ATP-dependent
(K
+-ATPase) transport system, since the accumulation of
potassium
ions is known to be the primary response to hypertonic stress
in eubacteria. Either the 11E5L or the 11E5U transposition could
be
responsible for mutant 3 displaying the biofilm-defective
phenotype.
The Tn
916-flanking region of mutant 4 (11B4) has homology
with
glmM, a phosphoglucomutase gene in
E. coli.
GlmM catalyzes
the formation of glucosamine-1-phosphate from
glucosamine-6-phosphate,
the first step in the biosynthetic pathway
leading to the essential
peptidoglycan precursor
UDP-
N-acetylglucosamine (
44).
The Tn
916-flanking region of mutant 5 (15B3) has homology
with
bacA, which encodes an undecaprenyl kinase involved in
the
lipid phosphorylation that confers bacitracin resistance in
E. coli. The resistance is due to the tight binding of
bacitracin
to a complex of undecaprenyl diphosphate and a metal ion.
This
tight binding prevents undecaprenyl diphosphate from functioning
as a membrane-associated carrier of intermediates during peptidoglycan
biosynthesis (
5).
Mutant 6 (9F8) had two transposon insertions, one of which is 23 nucleotides upstream of
abpA, which encodes AbpA, an

-amylase-binding
protein in
S. gordonii Challis
(
51). In a previous study, the
abpA gene was also
identified by Tn
916 mutagenesis, with an insertion
15 nucleotides upstream of
abpA (
51). The second
insertion in
9F8 was in a region with no homology in the DNA database.
Either
of these transpositions could be responsible for the
biofilm-defective
phenotype of the 9F8
mutant.
The Tn
916-flanking region of mutant 7 (29E5) has homology
with
appC, which encodes a member of an oligopeptide (tetra-
or
pentapeptide) transport system in
B. subtilis. This
system may
be a growth-monitoring communication system between cell
wall
synthesis systems and the cytoplasm which senses the turnover
rate
of cell wall peptides as a direct function of bacterial growth
during
sporulation (
35). Similar mechanisms may be involved
in
modulating streptococcal growth during early dental plaque
formation.
The Tn
916-flanking region of mutant 8 (4B3) has homology
with
mutT, a member of the DNA replication machinery that
prevents
A · G mispairs. MutT is a nucleoside triphosphatase
which prevents
A · T

C · G tranversions during
replication by removing an oxidized
form of guanine, 8-oxo-dGTP, from
the nucleotide pool, thus preventing
it from mispairing with template A
and maintaining replication
fidelity (
21). The
Tn
916-flanking region of mutant 9 (13A12)
has homology with
ytmP of
B. subtilis. The function of this gene
is
yet to be
determined.
Nine of the biofilm-defective mutants isolated have genes homologous to
those in databases which may be important for the
physiology of sessile
growth. The successful identification of
biofilm-associated genes
indicates the utility of the polystyrene
assay for studying bacterial
biofilms. In the remaining nine biofilm-defective
mutants, the DNA
sequences flanking the transposon have no homology
to genes in the DNA
databases. This suggests that the screening
performed in this study has
identified previously unknown genes
that are associated with biofilm
formation.
The flanking regions of all the Tn
916 insertions are
significantly AT rich, indicating that Tn
916 has hotspots
for certain
regions of the
S. gordonii chromosome (Table
1).
These AT-rich
regions contained significantly more T than A. The
presence of
Tn
916 preferred target sites which were AT rich
has also been
noted in a review of conjugative transposons
(
57).
 |
DISCUSSION |
Kolter and Losick (37) noted that until recently, even
though most microorganisms grow as biofilms and the physical structures of different biofilms are well characterized, biofilms had not been
studied using molecular genetic approaches. A well-studied, genetically
amenable oral bacterium, S. gordonii Challis, was used in
this study to identify genes that are required for biofilm formation on
abiotic surfaces.
The observation that S. gordonii Challis biofilm formation
was enhanced in a minimal medium but not in a nutritionally rich environment indicates that sessile growth may represent a survival strategy in a nutritionally limited environment, as surface
colonization provides advantages such as increased capture of nutrients
that may be adsorbed to surfaces (64). Starvation conditions
have previously been reported to initiate adhesion as bacteria attempt to exploit a source of essential nutrients which may be in short supply
in the surrounding environment (38). Oral surfaces in vivo
also represent a nutritionally limited environment, and biofilm formation may be required for survival, as bacteria depend on degraded
salivary constituents as nutrients (40).
Interspecies variation was observed in the ability of oral streptococci
to form biofilm on abiotic surfaces, which may reflect differences in
the mechanisms of colonization by different streptococcal species. For
example, S. oralis C104, which demonstrated poor biofilm-forming ability, may lack effective colonization factors for
binding to abiotic surfaces but still participate in plaque formation
by binding to initial colonizing cells of other species. Most human
viridans streptococci participate in intrageneric coaggregation, the
cell-to-cell adherence among genetically distinct streptococci, and
these interactions may foster the primary colonization of the tooth
surfaces (36). Furthermore, an S. gordonii DL1
mutant that did not coaggregate with its streptococcal partner S. oralis C104 exhibited wild-type levels of coaggregation with
actinomyces (8).
The oral environment experiences significant fluctuations in
O2 tension, pH, and carbohydrate content due to variations
in microflora, diet, and oral hygiene habits. The primary indicators of
the two major dental diseases, periodontal disease and caries, are a
shift in dental plaque flora from initial gram-positive facultative
aerobes to mainly gram-negative anaerobes (58) and an
increased acidogenicity due to bacterial metabolism of dietary sucrose
(41), respectively. Some of these environmental changes, namely, in pH, osmolarity, and carbohydrate content, were found to
influence streptococcal biofilm formation in vitro. As nutritional (48) and environmental (64) signals play a role
in biofilm development, these observations may be useful in attempts to
identify the cellular factors and molecular mechanisms involved in
streptococcal biofilm formation.
Bacteria sense a large number of environmental signals and process this
information into specific transcriptional responses. In gram-positive
bacteria, cell-density-dependent gene expression regulatory modes
appear to follow a common theme, in which the signal molecule is a
posttranslationally processed peptide that is secreted by an
ATP-binding cassette exporter. This peptide pheromone accumulates
extracellularly in proportion to the total number of cells, providing
an index of population densities (15), and functions as the
input signal for the sensing component of a two-component signal
transduction system (34). Therefore, these bacterial
autoinduction systems represent cell-to-cell communication, which is
also referred to as quorum sensing.
In S. gordonii, the sensing component of the two-component
signal transduction system is ComD, an autophosphorylating histidine kinase. ComD is the receptor for the comC-encoded
competence-stimulating peptide, a 50-amino-acid peptide pheromone that
induces competence in the bacterial population at a critical
extracellular concentration (27, 49). The second component,
the cognate response regulator ComE, becomes activated after receiving
the phosphoryl group from ComD at an aspartate residue and binds to
specific promoter regions of appropriate target genes, therefore acting
as a transcriptional factor (45).
One of the biofilm-defective mutants isolated had a transposon
insertion within comD of S. gordonii, which
encodes ComD (42). To our knowledge, this is the first
report that cell-to-cell signaling is involved in the biofilm formation
of a gram-positive species on an abiotic surface and is consistent with
a previous report that the differentiation and integrity of P. aeruginosa biofilms are controlled by a specific quorum-sensing
signal (12). A P. aeruginosa mutant defective in
the production of
N-(3-oxododecanoyl)-L-homoserine lactone, one of
the acylhomoserine lactones that mediate quorum sensing, produced
abnormal biofilms that were sensitive to the detergent biocide sodium
dodecyl sulfate, indicating that a quorum-sensing signal is involved in
biofilm differentiation and integrity (12). A recent study
implicated cell density signaling in activation of the recovery process
of nitrogen-starved Nitrosomonas europaea biofilms
(3). Results from this study demonstrates that cell-to-cell signaling in biofilm formation may not be a characteristic restricted to P. aeruginosa or gram-negative bacteria.
PBPs are responsible for the assembly, maintenance, and regulation of
peptidoglycan peptide structures. Identification of biofilm-associated
genes that are involved in peptidoglycan biosynthesis indicates the
importance of cell envelope integrity to the biofilm phenotype in
streptococci, as mutations in peptidoglycan biosynthesis genes may
result in cells with morphologies that lack a rigid cell envelope component.
Disruptions in genes regulating peptidoglycan synthesis are also likely
to affect their ability to respond to environmental changes such as
extracellular osmolarity, which is important during sessile growth.
Change in environmental osmolarity can elicit structural
alterations by cellular remodeling. Cellular remodeling has been shown
to accompany long-term osmoadaptation, whereas the P-type ATPases are
involved in acute-phase osmoadaptation (65). Identification
of biofilm-associated genes that are involved in peptidoglycan
biosynthesis suggest that osmoadaptation systems may play a role in
biofilm formation.
One of the 18 biofilm-defective mutants (9F8) had two transposon
insertions, one of which is the 5' region of a salivary
-amylase-binding gene of S. gordonii (51).
This is the only adhesion-related gene of S. gordonii found
to have a potential role in biofilm formation. A previous study has
shown that the mannose-sensitive hemagglutination pilus of Vibrio
cholerae, which is involved in biofilm formation on abiotic
surfaces, is important for attachment but not pathogenicity
(63). The type IV pili of Pseudomonas aeruginosa,
which is required for biofilm formation on an abiotic surface, is also
important for bacterial adhesion to eukaryotic cell surfaces and
pathogenesis (47). These observations suggest that there may
be an overlap in the factors required for biofilm formation and those
for bacterial adhesion and/or pathogenesis in vivo. As the most
abundant enzyme in human saliva,
-amylase, binds with high affinity
to oral streptococci (14, 54), one of the multiple
amylase-binding proteins of S. gordonii Challis (51) may promote biofilm formation during early plaque
formation on nutritionally poor, saliva-coated tooth surfaces. This
potential role of
-amylase-binding protein in biofilm formation can
be determined only when the two transpositions in the biofilm-defective mutant are separated and analyzed for biofilm formation.
Although flagella and/or motility are important for biofilm formation
in motile bacteria, nonmotile bacteria can also form biofilms,
indicating that other genes may be involved (47, 48, 50).
The successful isolation of biofilm-defective mutants clearly demonstrates the utility of the assay used. In addition, these mutants
were used to identify genes that may be important in biofilm formation
after initial adhesion. Nine of the 18 biofilm-defective mutants have
disruptions in genetic loci that have no homology to genes in the
databases. This polystyrene assay coupled with other assays such as
flow cell and animal colonization studies will identify functions for
some of these genes.
The relative proportion of the biofilm-deficient mutants isolated in
this study (0.07%) was similar to the 0.08% obtained with
Tn917 mutants of Staphylococcus epidermidis were
screened for biofilm deficiency (28) but lower than the
0.3% obtained from Tn5-based mutants of P. aeruginosa (48). Results from this study, together with
those of a previous report (57), indicate that
Tn916 appears to preferentially transpose into AT-rich
regions of the bacterial chromosome. Therefore, the biofilm-associated genes identified in this study may not represent the full complement of
the genes necessary for the sessile growth of S. gordonii. Additional genes may be identified by insertion-duplication analysis or
by using transposons from other gram-positive bacteria for mutagenesis.
In order to understand the processes involved in dental-plaque
formation, different approaches, such as confocal scanning laser
microscopy, which enables the study of biofilm communities without
disturbance (9), and genetic approaches, need to be utilized. Two-component signal transduction systems (2) and other cell-to-cell signaling systems (18) have already
become novel targets in the design of new types of microbial
anti-infective therapy. Putative biofilm-associated genes may identify
other processes important in sessile growth and facilitate the
development of therapeutic agents that target the biofilm phenotype and
cell-to-cell signaling agents and subsequently prevent the formation or
promote the detachment of biofilms. Biofilm-associated genes will
provide insight into the unique process of biofilm formation and may
facilitate the development of therapeutic agents and strategies to
control biofilm-mediated infections.
 |
ACKNOWLEDGMENTS |
We thank Z. Skobe of the Forsyth Institute for SEM analysis.
This work was supported by Public Health Service grants DE10969 and
DE7009 from the National Institute of Dental and Craniofacial Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The
Forsyth Institute, Department of Molecular Genetics, 140 Fenway,
Boston, MA 02115. Phone: (617) 262-5200, ext. 281. Fax: (617) 262-4021. E-mail: nganeshkumar{at}forsyth.org.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 2.
|
Barrett, J. F., and J. A. Hoch.
1998.
Two-component signal transduction as a target for microbial anti-infective therapy.
Antimicrob. Agents Chemother.
42:1529-1536[Free Full Text].
|
| 3.
|
Batchelor, S. E.,
M. Cooper,
S. R. Chhabra,
L. A. Glover,
G. S. Stewart,
P. Williams, and J. I. Prosser.
1997.
Cell density-regulated recovery of starved biofilm populations of ammonia-oxidizing bacteria.
Appl. Environ. Microbiol.
63:2281-2286[Abstract/Free Full Text].
|
| 4.
|
Bloomquist, C. G.,
B. E. Reilly, and W. F. Liljemark.
1996.
Adherence, accumulation, and cell division of a natural adherent bacterial population.
J. Bacteriol.
178:1172-1177[Abstract/Free Full Text].
|
| 5.
|
Cain, B. D.,
P. J. Norton,
W. Eubanks,
H. S. Nick, and C. M. Allen.
1993.
Amplification of the bacA gene confers bacitracin resistance to Escherichia coli.
J. Bacteriol.
175:3784-3789[Abstract/Free Full Text].
|
| 6.
|
Carlsson, J.
1972.
Nutritional requirements of Streptococcus sanguis.
Arch. Oral Biol.
17:1327-1332[CrossRef][Medline].
|
| 7.
|
Clemans, D. L., and P. E. Kolenbrander.
1995.
Identification of a 100-kilodalton putative coaggregation-mediating adhesin of Streptococcus gordonii DL1 (Challis).
Infect. Immun.
63:4890-4893[Abstract/Free Full Text].
|
| 8.
|
Clemans, D. L., and P. E. Kolenbrander.
1995.
Isolation and characterization of coaggregation-defective (Cog ) mutants of Streptococcus gordonii DL1 (Challis).
J. Ind. Microbiol.
15:193-197[CrossRef][Medline].
|
| 9.
|
Cook, G. S.,
J. W. Costerton, and R. J. Lamont.
1998.
Biofilm formation by Porphyromonas gingivalis and Streptococcus gordonii.
J. Periodontal Res.
33:323-327[CrossRef][Medline].
|
| 10.
|
Costerton, J. W.,
Z. Lewandowski,
D. E. Caldwell,
D. R. Korber, and H. M. Lappin-Scott.
1995.
Microbial biofilms.
Annu. Rev. Microbiol.
49:711-745[CrossRef][Medline].
|
| 11.
|
Costerton, J. W.,
P. S. Stewart, and E. P. Greenberg.
1999.
Bacterial biofilms: a common cause of persistent infections.
Science
284:1318-1322[Abstract/Free Full Text].
|
| 12.
|
Davies, D. G.,
M. R. Parsek,
J. P. Pearson,
B. H. Iglewski,
J. W. Costerton, and E. P. Greenberg.
1998.
The involvement of cell-to-cell signals in the development of a bacterial biofilm.
Science
280:295-298[Abstract/Free Full Text].
|
| 13.
|
Demuth, D. R.,
Y. Duan,
W. Brooks,
A. R. Holmes,
R. McNab, and H. F. Jenkinson.
1996.
Tandem genes encode cell-surface polypeptides SspA and SspB which mediate adhesion of the oral bacterium Streptococcus gordonii to human and bacterial receptors.
Mol. Microbiol.
20:403-413[Medline].
|
| 14.
|
Douglas, C. W.
1983.
The binding of human salivary alpha-amylase by oral strains of streptococcal bacteria.
Arch. Oral Biol.
28:567-573[CrossRef][Medline].
|
| 15.
|
Dunny, G. M., and B. A. Leonard.
1997.
Cell-cell communication in Gram-positive bacteria.
Annu. Rev. Microbiol.
51:527-564[CrossRef][Medline].
|
| 16.
|
Durack, D. T.
1995.
Prevention of infective endocarditis.
N. Engl. J. Med.
332:38-44[Free Full Text].
|
| 17.
|
Fenno, J. C.,
D. J. LeBlanc, and P. Fives-Taylor.
1989.
Nucleotide sequence analysis of a type 1 fimbrial gene of Streptococcus sanguis FW213.
Infect. Immun.
57:3527-3533[Abstract/Free Full Text].
|
| 18.
|
Finch, R. G.,
D. I. Pritchard,
B. W. Bycroft,
P. Williams, and G. S. Stewart.
1998.
Quorum sensing: a novel target for anti-infective therapy.
J. Antimicrob. Chemother.
42:569-571[Free Full Text].
|
| 19.
|
Flannagan, S. E.,
L. A. Zitzow,
Y. A. Su, and D. B. Clewell.
1994.
Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis.
Plasmid
32:350-354[CrossRef][Medline].
|
| 20.
|
Fletcher, M.
1977.
The effects of culture concentration and age, time, and temperature on bacterial attachment to polystyrene.
Can. J. Microbiol.
23:1-6.
|
| 21.
|
Fowler, R. G., and R. M. Schaaper.
1997.
The role of the mutT gene of Escherichia coli in maintaining replication fidelity.
FEMS Microbiol. Rev.
21:43-54[CrossRef][Medline].
|
| 22.
|
Ganeshkumar, N.,
M. Song, and B. C. McBride.
1988.
Cloning of a Streptococcus sanguis adhesin which mediates binding to saliva-coated hydroxyapatite.
Infect. Immun.
56:1150-1157[Abstract/Free Full Text].
|
| 23.
|
Gawron-Burke, C., and D. B. Clewell.
1984.
Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria.
J. Bacteriol.
159:214-221[Abstract/Free Full Text].
|
| 24.
|
Gibbons, R. J.
1989.
Bacterial adhesion to oral tissues: a model for infectious diseases.
J. Dent. Res.
68:750-760[Abstract/Free Full Text].
|
| 25.
|
Gong, K., and M. C. Herzberg.
1997.
Streptococcus sanguis expresses a 150-kilodalton two-domain adhesin: characterization of several independent adhesin epitopes.
Infect. Immun.
65:3815-3821[Abstract/Free Full Text].
|
| 26.
|
Gonzalez-Barca, E.,
A. Fernandez-Sevilla,
J. Carratala,
A. Granena, and F. Gudiol.
1996.
Prospective study of 288 episodes of bacteremia in neutropenic cancer patients in a single institution.
Eur. J. Clin. Microbiol. Infect. Dis.
15:291-296[CrossRef][Medline].
|
| 27.
|
Havarstein, L. S.,
P. Gaustad,
I. F. Nes, and D. A. Morrison.
1996.
Identification of the streptococcal competence-pheromone receptor.
Mol. Microbiol.
21:863-869[CrossRef][Medline].
|
| 28.
|
Heilmann, C.,
C. Gerke,
F. Perdreau-Remington, and F. Gotz.
1996.
Characterization of Tn917 insertion mutants of Staphylococcus epidermidis affected in biofilm formation.
Infect. Immun.
64:277-282[Abstract/Free Full Text].
|
| 29.
|
Hoyle, B. D., and J. W. Costerton.
1991.
Bacterial resistance to antibiotics: the role of biofilms.
Prog. Drug. Res.
37:91-105[Medline].
|
| 30.
|
Jenkinson, H. F.
1986.
Cell-surface proteins of Streptococcus sanguis associated with cell hydrophobicity and coaggregation properties.
J. Gen. Microbiol.
132:1575-1589[Abstract/Free Full Text].
|
| 31.
|
Jenkinson, H. F.
1994.
Cell surface protein receptors in oral streptococci.
FEMS Microbiol. Lett.
121:133-140[CrossRef][Medline].
|
| 32.
|
Kanamaru, K.,
S. Kashiwagi, and T. Mizuno.
1993.
The cyanobacterium, Synechococcus sp. PCC7942, possesses two distinct genes encoding cation-transporting P-type ATPases.
FEBS Lett.
330:99-104[CrossRef][Medline].
|
| 33.
|
Kern, W.,
E. Kurrle, and T. Schmeiser.
1990.
Streptococcal bacteremia in adult patients with leukemia undergoing aggressive chemotherapy. A review of 55 cases.
Infection
18:138-145[CrossRef][Medline].
|
| 34.
|
Kleerebezem, M.,
L. E. Quadri,
O. P. Kuipers, and W. M. de Vos.
1997.
Quorum sensing by peptide pheromones and two-component signal-transduction systems in Gram-positive bacteria.
Mol. Microbiol.
24:895-904[CrossRef][Medline].
|
| 35.
|
Koide, A., and J. A. Hoch.
1994.
Identification of a second oligopeptide transport system in Bacillus subtilis and determination of its role in sporulation.
Mol. Microbiol.
13:417-426[CrossRef][Medline].
|
| 36.
|
Kolenbrander, P. E.,
R. N. Andersen, and L. V. Moore.
1990.
Intrageneric coaggregation among strains of human oral bacteria: potential role in primary colonization of the tooth surface.
Appl. Environ. Microbiol.
56:3890-3894[Abstract/Free Full Text].
|
| 37.
|
Kolter, R., and R. Losick.
1998.
One for all and all for one.
Science
280:226-227[Abstract/Free Full Text].
|
| 38.
|
Korber, D. R.,
J. R. Lawrence,
H. M. Lappin-Scott, and J. W. Costerton.
1995.
Growth of microorganisms on surfaces, p. 15-45.
In
H. M. Lappin-Scott, and J. W. Costerton (ed.), Microbial biofilms. Cambridge University Press, Cambridge, United Kingdom.
|
| 39.
|
LeBlanc, D. J., and F. P. Hassell.
1976.
Transformation of Streptococcus sanguis Challis by plasmid deoxyribonucleic acid from Streptococcus faecalis.
J. Bacteriol.
128:347-355[Abstract/Free Full Text].
|
| 40.
|
Liljemark, W. F.,
C. G. Bloomquist,
B. E. Reilly,
C. J. Bernards,
D. W. Townsend,
A. T. Pennock, and J. L. LeMoine.
1997.
Growth dynamics in a natural biofilm and its impact on oral disease management.
Adv. Dent. Res.
11:14-23[Abstract/Free Full Text].
|
| 41.
|
Loesche, W. J.
1986.
Role of Streptococcus mutans in human dental decay.
Microbiol. Rev.
50:353-380[Free Full Text].
|
| 42.
|
Lunsford, R. D., and J. London.
1996.
Natural genetic transformation in Streptococcus gordonii: comX imparts spontaneous competence on strain Wicky.
J. Bacteriol.
178:5831-5835[Abstract/Free Full Text].
|
| 43.
|
Mack, D.,
M. Nedelmann,
A. Krokotsch,
A. Schwarzkopf,
J. Heesemann, and R. Laufs.
1994.
Characterization of transposon mutants of biofilm-producing Staphylococcus epidermidis impaired in the accumulative phase of biofilm production: genetic identification of a hexosamine-containing polysaccharide intercellular adhesin.
Infect. Immun.
62:3244-3253[Abstract/Free Full Text].
|
| 44.
|
Mengin-Lecreulx, D., and J. van Heijenoort.
1996.
Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli.
J. Biol. Chem.
271:32-39[Abstract/Free Full Text].
|
| 45.
|
Morrison, D. A.
1997.
Streptococcal competence for genetic transformation: regulation by peptide pheromones.
Microb. Drug Resist.
3:27-37[Medline].
|
| 46.
|
Nyvad, B., and M. Kilian.
1990.
Comparison of the initial streptococcal microflora on dental enamel in caries-active and in caries-inactive individuals.
Caries Res.
24:267-272[Medline].
|
| 47.
|
O'Toole, G. A., and R. Kolter.
1998.
Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development.
Mol. Microbiol.
30:295-304[CrossRef][Medline].
|
| 48.
|
O'Toole, G. A., and R. Kolter.
1998.
Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signaling pathways: a genetic analysis.
Mol. Microbiol.
28:449-461[CrossRef][Medline].
|
| 49.
|
Pestova, E. V.,
L. S. Havarstein, and D. A. Morrison.
1996.
Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system.
Mol. Microbiol.
21:853-862[CrossRef][Medline].
|
| 50.
|
Pratt, L. A., and R. Kolter.
1998.
Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili.
Mol. Microbiol.
30:285-293[CrossRef][Medline].
|
| 51.
|
Rogers, J. D.,
E. M. Haase,
A. E. Brown,
C. W. Douglas,
J. P. Gwynn, and F. A. Scannapieco.
1998.
Identification and analysis of a gene (abpA) encoding a major amylase-binding protein in Streptococcus gordonii.
Microbiology
144:1223-1233[Abstract/Free Full Text].
|
| 52.
|
Rosan, B.,
C. T. Baker,
G. M. Nelson,
R. Berman,
R. J. Lamont, and D. R. Demuth.
1989.
Cloning and expression of an adhesin antigen of Streptococcus sanguis G9B in Escherichia coli.
J. Gen. Microbiol.
135:531-538[Abstract/Free Full Text].
|
| 53.
|
Scannapieco, F. A.
1994.
Saliva-bacterium interactions in oral microbial ecology.
Crit. Rev. Oral Biol. Med.
5:203-248[Abstract/Free Full Text].
|
| 54.
|
Scannapieco, F. A.,
E. J. Bergey,
M. S. Reddy, and M. J. Levine.
1989.
Characterization of salivary alpha-amylase binding to Streptococcus sanguis.
Infect. Immun.
57:2853-2863[Abstract/Free Full Text].
|
| 55.
|
Schilling, K. M., and W. H. Bowen.
1992.
Glucans synthesized in situ in experimental salivary pellicle function as specific binding sites for Streptococcus mutans.
Infect. Immun.
60:284-295[Abstract/Free Full Text].
|
| 56.
|
Schumacher-Perdreau, F.,
C. Heilmann,
G. Peters,
F. Gotz, and G. Pulverer.
1994.
Comparative analysis of a biofilm-forming Staphylococcus epidermidis strain and its adhesion-positive, accumulation-negative mutant M7.
FEMS Microbiol. Lett.
117:71-78[CrossRef][Medline].
|
| 57.
|
Scott, J. R., and G. G. Churchward.
1995.
Conjugative transposition.
Annu. Rev. Microbiol.
49:367-397[CrossRef][Medline].
|
| 58.
|
Socransky, S. S.,
A. C. R. Tanner,
A. D. Haffajee,
J. D. Hillman, and J. M. Goodson.
1982.
Present status of studies on microbial etiology of periodontal diseases, p. 1-12.
In
R. J. Genco, and S. E. Mergenhagen (ed.), Host-parasite interactions in periodontal disease. American Society for Microbiology, Washington, D.C.
|
| 59.
|
Switalski, L. M.,
H. Murchison,
R. Timpl,
R. Curtiss, III, and M. Hook.
1987.
Binding of laminin to oral and endocarditis strains of viridans streptococci.
J. Bacteriol.
169:1095-1101[Abstract/Free Full Text].
|
| 60.
|
Tart, R. C., and I. van de Rijn.
1991.
Analysis of adherence of Streptococcus defectivus and endocarditis-associated streptococci to extracellular matrix.
Infect. Immun.
59:857-862[Abstract/Free Full Text].
|
| 61.
|
van der Meer, J. T.,
J. Thompson,
H. A. Valkenburg, and M. F. Michel.
1992.
Epidemiology of bacterial endocarditis in The Netherlands. I. Patient characteristics.
Arch. Intern. Med.
152:1863-1868[Abstract/Free Full Text].
|
| 62.
|
Vickerman, M. M.,
D. B. Clewell, and G. W. Jones.
1991.
Sucrose-promoted accumulation of growing glucosyltransferase variants of Streptococcus gordonii on hydroxyapatite surfaces.
Infect. Immun.
59:3523-3530[Abstract/Free Full Text].
|
| 63.
|
Watnick, P. I.,
K. J. Fullner, and R. Kolter.
1999.
A role for the mannose-sensitive hemagglutinin in biofilm formation by Vibrio cholerae El Tor.
J. Bacteriol.
181:3606-3609[Abstract/Free Full Text].
|
| 64.
|
Wimpenny, J. W. T., and R. A. Colasanti.
1997.
A unifying hypothesis for the structure of microbial films based on cellular automation models.
FEMS Microbiol. Ecol.
22:1-16.
|
| 65.
|
Wood, J. M.
1999.
Osmosensing by bacteria: signals and membrane-based sensors.
Microbiol. Mol. Biol. Rev.
63:230-262[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2000, p. 1374-1382, Vol. 182, No. 5
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Musken, M., Di Fiore, S., Dotsch, A., Fischer, R., Haussler, S.
(2010). Genetic determinants of Pseudomonas aeruginosa biofilm establishment. Microbiology
156: 431-441
[Abstract]
[Full Text]
-
Margolis, J. J., El-Etr, S., Joubert, L.-M., Moore, E., Robison, R., Rasley, A., Spormann, A. M., Monack, D. M.
(2010). Contributions of Francisella tularensis subsp. novicida Chitinases and Sec Secretion System to Biofilm Formation on Chitin. Appl. Environ. Microbiol.
76: 596-608
[Abstract]
[Full Text]
-
Liu, Y., Burne, R. A.
(2009). Multiple Two-Component Systems Modulate Alkali Generation in Streptococcus gordonii in Response to Environmental Stresses. J. Bacteriol.
191: 7353-7362
[Abstract]
[Full Text]
-
Hojo, K., Nagaoka, S., Ohshima, T., Maeda, N.
(2009). Bacterial Interactions in Dental Biofilm Development. JDR
88: 982-990
[Abstract]
[Full Text]
-
Nobbs, A. H., Lamont, R. J., Jenkinson, H. F.
(2009). Streptococcus Adherence and Colonization. Microbiol. Mol. Biol. Rev.
73: 407-450
[Abstract]
[Full Text]
-
Senty Turner, L., Das, S., Kanamoto, T., Munro, C. L., Kitten, T.
(2009). Development of genetic tools for in vivo virulence analysis of Streptococcus sanguinis. Microbiology
155: 2573-2582
[Abstract]
[Full Text]
-
Amarasinghe, J. J., Scannapieco, F. A., Haase, E. M.
(2009). Transcriptional and Translational Analysis of Biofilm Determinants of Aggregatibacter actinomycetemcomitans in Response to Environmental Perturbation. Infect. Immun.
77: 2896-2907
[Abstract]
[Full Text]
-
Zhang, J., Biswas, I.
(2009). 3'-Phosphoadenosine-5'-Phosphate Phosphatase Activity Is Required for Superoxide Stress Tolerance in Streptococcus mutans. J. Bacteriol.
191: 4330-4340
[Abstract]
[Full Text]
-
Ahn, S.-J., Ahn, S.-J., Browngardt, C. M., Burne, R. A.
(2009). Changes in Biochemical and Phenotypic Properties of Streptococcus mutans during Growth with Aeration. Appl. Environ. Microbiol.
75: 2517-2527
[Abstract]
[Full Text]
-
Abranches, J., Martinez, A. R., Kajfasz, J. K., Chavez, V., Garsin, D. A., Lemos, J. A.
(2009). The Molecular Alarmone (p)ppGpp Mediates Stress Responses, Vancomycin Tolerance, and Virulence in Enterococcus faecalis. J. Bacteriol.
191: 2248-2256
[Abstract]
[Full Text]
-
Kajfasz, J. K., Martinez, A. R., Rivera-Ramos, I., Abranches, J., Koo, H., Quivey, R. G. Jr., Lemos, J. A.
(2009). Role of Clp Proteins in Expression of Virulence Properties of Streptococcus mutans. J. Bacteriol.
191: 2060-2068
[Abstract]
[Full Text]
-
Zhang, Y., Whiteley, M., Kreth, J., Lei, Y., Khammanivong, A., Evavold, J. N., Fan, J., Herzberg, M. C.
(2009). The two-component system BfrAB regulates expression of ABC transporters in Streptococcus gordonii and Streptococcus sanguinis. Microbiology
155: 165-173
[Abstract]
[Full Text]
-
Van Dellen, K. L., Houot, L., Watnick, P. I.
(2008). Genetic Analysis of Vibrio cholerae Monolayer Formation Reveals a Key Role for {Delta}{Psi} in the Transition to Permanent Attachment. J. Bacteriol.
190: 8185-8196
[Abstract]
[Full Text]
-
Munoz-Elias, E. J., Marcano, J., Camilli, A.
(2008). Isolation of Streptococcus pneumoniae Biofilm Mutants and Their Characterization during Nasopharyngeal Colonization. Infect. Immun.
76: 5049-5061
[Abstract]
[Full Text]
-
Islam, B., Khan, S. N., Haque, I., Alam, M., Mushfiq, M., Khan, A. U.
(2008). Novel anti-adherence activity of mulberry leaves: inhibition of Streptococcus mutans biofilm by 1-deoxynojirimycin isolated from Morus alba. J Antimicrob Chemother
62: 751-757
[Abstract]
[Full Text]
-
Ahn, S.-J., Ahn, S.-J., Wen, Z. T., Brady, L. J., Burne, R. A.
(2008). Characteristics of Biofilm Formation by Streptococcus mutans in the Presence of Saliva. Infect. Immun.
76: 4259-4268
[Abstract]
[Full Text]
-
Lemos, J. A., Nascimento, M. M., Lin, V. K., Abranches, J., Burne, R. A.
(2008). Global Regulation by (p)ppGpp and CodY in Streptococcus mutans. J. Bacteriol.
190: 5291-5299
[Abstract]
[Full Text]
-
Chong, P., Drake, L., Biswas, I.
(2008). Modulation of covR Expression in Streptococcus mutans UA159. J. Bacteriol.
190: 4478-4488
[Abstract]
[Full Text]
-
Ge, X., Kitten, T., Chen, Z., Lee, S. P., Munro, C. L., Xu, P.
(2008). Identification of Streptococcus sanguinis Genes Required for Biofilm Formation and Examination of Their Role in Endocarditis Virulence. Infect. Immun.
76: 2551-2559
[Abstract]
[Full Text]
-
Biswas, I., Drake, L., Erkina, D., Biswas, S.
(2008). Involvement of Sensor Kinases in the Stress Tolerance Response of Streptococcus mutans. J. Bacteriol.
190: 68-77
[Abstract]
[Full Text]
-
Sztajer, H., Lemme, A., Vilchez, R., Schulz, S., Geffers, R., Yip, C. Y. Y., Levesque, C. M., Cvitkovitch, D. G., Wagner-Dobler, I.
(2008). Autoinducer-2-Regulated Genes in Streptococcus mutans UA159 and Global Metabolic Effect of the luxS Mutation. J. Bacteriol.
190: 401-415
[Abstract]
[Full Text]
-
Nobbs, A. H., Vajna, R. M., Johnson, J. R., Zhang, Y., Erlandsen, S. L., Oli, M. W., Kreth, J., Brady, L. J., Herzberg, M. C.
(2007). Consequences of a sortase A mutation in Streptococcus gordonii. Microbiology
153: 4088-4097
[Abstract]
[Full Text]
-
Lebeer, S., Verhoeven, T. L. A., Perea Velez, M., Vanderleyden, J., De Keersmaecker, S. C. J.
(2007). Impact of Environmental and Genetic Factors on Biofilm Formation by the Probiotic Strain Lactobacillus rhamnosus GG. Appl. Environ. Microbiol.
73: 6768-6775
[Abstract]
[Full Text]
-
Biswas, I., Drake, L., Biswas, S.
(2007). Regulation of gbpC Expression in Streptococcus mutans. J. Bacteriol.
189: 6521-6531
[Abstract]
[Full Text]
-
Ahn, S.-J., Burne, R. A.
(2007). Effects of Oxygen on Biofilm Formation and the AtlA Autolysin of Streptococcus mutans. J. Bacteriol.
189: 6293-6302
[Abstract]
[Full Text]
-
Lemos, J. A., Luzardo, Y., Burne, R. A.
(2007). Physiologic Effects of Forced Down-Regulation of dnaK and groEL Expression in Streptococcus mutans. J. Bacteriol.
189: 1582-1588
[Abstract]
[Full Text]
-
Moscoso, M., Garcia, E., Lopez, R.
(2006). Biofilm Formation by Streptococcus pneumoniae: Role of Choline, Extracellular DNA, and Capsular Polysaccharide in Microbial Accretion. J. Bacteriol.
188: 7785-7795
[Abstract]
[Full Text]
-
Nakao, R., Senpuku, H., Watanabe, H.
(2006). Porphyromonas gingivalis galE Is Involved in Lipopolysaccharide O-Antigen Synthesis and Biofilm Formation. Infect. Immun.
74: 6145-6153
[Abstract]
[Full Text]
-
Ahn, S.-J., Burne, R. A.
(2006). The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis.. J. Bacteriol.
188: 6877-6888
[Abstract]
[Full Text]
-
Motegi, M., Takagi, Y., Yonezawa, H., Hanada, N., Terajima, J., Watanabe, H., Senpuku, H.
(2006). Assessment of Genes Associated with Streptococcus mutans Biofilm Morphology. Appl. Environ. Microbiol.
72: 6277-6287
[Abstract]
[Full Text]
-
Wen, Z. T., Baker, H. V., Burne, R. A.
(2006). Influence of BrpA on Critical Virulence Attributes of Streptococcus mutans.. J. Bacteriol.
188: 2983-2992
[Abstract]
[Full Text]
-
Ahn, S.-J., Wen, Z. T., Burne, R. A.
(2006). Multilevel Control of Competence Development and Stress Tolerance in Streptococcus mutans UA159. Infect. Immun.
74: 1631-1642
[Abstract]
[Full Text]
-
Biswas, S., Biswas, I.
(2006). Regulation of the Glucosyltransferase (gtfBC) Operon by CovR in Streptococcus mutans. J. Bacteriol.
188: 988-998
[Abstract]
[Full Text]
-
Joshua, G. W. P, Guthrie-Irons, C., Karlyshev, A. V., Wren, B. W.
(2006). Biofilm formation in Campylobacter jejuni. Microbiology
152: 387-396
[Abstract]
[Full Text]
-
Jakubovics, N. S., Kerrigan, S. W., Nobbs, A. H., Stromberg, N., van Dolleweerd, C. J., Cox, D. M., Kelly, C. G., Jenkinson, H. F.
(2005). Functions of Cell Surface-Anchored Antigen I/II Family and Hsa Polypeptides in Interactions of Streptococcus gordonii with Host Receptors. Infect. Immun.
73: 6629-6638
[Abstract]
[Full Text]
-
Biswas, S., Biswas, I.
(2005). Role of HtrA in Surface Protein Expression and Biofilm Formation by Streptococcus mutans. Infect. Immun.
73: 6923-6934
[Abstract]
[Full Text]
-
Tomlin, K. L., Malott, R. J., Ramage, G., Storey, D. G., Sokol, P. A., Ceri, H.
(2005). Quorum-Sensing Mutations Affect Attachment and Stability of Burkholderia cenocepacia Biofilms. Appl. Environ. Microbiol.
71: 5208-5218
[Abstract]
[Full Text]
-
Paik, S., Senty, L., Das, S., Noe, J. C., Munro, C. L., Kitten, T.
(2005). Identification of Virulence Determinants for Endocarditis in Streptococcus sanguinis by Signature-Tagged Mutagenesis. Infect. Immun.
73: 6064-6074
[Abstract]
[Full Text]
-
Petersen, F. C., Tao, L., Scheie, A. A.
(2005). DNA Binding-Uptake System: a Link between Cell-to-Cell Communication and Biofilm Formation. J. Bacteriol.
187: 4392-4400
[Abstract]
[Full Text]
-
van der Ploeg, J. R.
(2005). Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence. J. Bacteriol.
187: 3980-3989
[Abstract]
[Full Text]
-
Senadheera, M. D., Guggenheim, B., Spatafora, G. A., Huang, Y.-C. C., Choi, J., Hung, D. C. I., Treglown, J. S., Goodman, S. D., Ellen, R. P., Cvitkovitch, D. G.
(2005). A VicRK Signal Transduction System in Streptococcus mutans Affects gtfBCD, gbpB, and ftf Expression, Biofilm Formation, and Genetic Competence Development. J. Bacteriol.
187: 4064-4076
[Abstract]
[Full Text]
-
Brown, T. A. Jr., Ahn, S.-J., Frank, R. N., Chen, Y.-Y. M., Lemos, J. A., Burne, R. A.
(2005). A Hypothetical Protein of Streptococcus mutans Is Critical for Biofilm Formation. Infect. Immun.
73: 3147-3151
[Abstract]
[Full Text]
-
Ahn, S.-J., Lemos, J. A. C., Burne, R. A.
(2005). Role of HtrA in Growth and Competence of Streptococcus mutans UA159. J. Bacteriol.
187: 3028-3038
[Abstract]
[Full Text]
-
Wen, Z. T., Suntharaligham, P., Cvitkovitch, D. G., Burne, R. A.
(2005). Trigger Factor in Streptococcus mutans Is Involved in Stress Tolerance, Competence Development, and Biofilm Formation. Infect. Immun.
73: 219-225
[Abstract]
[Full Text]
-
Merritt, J., Qi, F., Shi, W.
(2005). A unique nine-gene comY operon in Streptococcus mutans. Microbiology
151: 157-166
[Abstract]
[Full Text]
-
Loo, C. Y., Mitrakul, K., Jaafar, S., Gyurko, C., Hughes, C. V., Ganeshkumar, N.
(2004). Role of a nosX Homolog in Streptococcus gordonii in Aerobic Growth and Biofilm Formation. J. Bacteriol.
186: 8193-8206
[Abstract]
[Full Text]
-
Tamesada, M., Kawabata, S., Fujiwara, T., Hamada, S.
(2004). Synergistic Effects of Streptococcal Glucosyltransferases on Adhesive Biofilm Formation. JDR
83: 874-879
[Abstract]
[Full Text]
-
Tendolkar, P. M., Baghdayan, A. S., Gilmore, M. S., Shankar, N.
(2004). Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis. Infect. Immun.
72: 6032-6039
[Abstract]
[Full Text]
-
Petersen, F. C., Pecharki, D., Scheie, A. A.
(2004). Biofilm Mode of Growth of Streptococcus intermedius Favored by a Competence-Stimulating Signaling Peptide. J. Bacteriol.
186: 6327-6331
[Abstract]
[Full Text]
-
Kilic, A. O., Tao, L., Zhang, Y., Lei, Y., Khammanivong, A., Herzberg, M. C.
(2004). Involvement of Streptococcus gordonii Beta-Glucoside Metabolism Systems in Adhesion, Biofilm Formation, and In Vivo Gene Expression. J. Bacteriol.
186: 4246-4253
[Abstract]
[Full Text]
-
Welin, J., Wilkins, J. C., Beighton, D., Svensater, G.
(2004). Protein Expression by Streptococcus mutans during Initial Stage of Biofilm Formation. Appl. Environ. Microbiol.
70: 3736-3741
[Abstract]
[Full Text]
-
Zhang, Y., Lei, Y., Khammanivong, A., Herzberg, M. C.
(2004). Identification of a Novel Two-Component System in Streptococcus gordonii V288 Involved in Biofilm Formation. Infect. Immun.
72: 3489-3494
[Abstract]
[Full Text]
-
Mohamed, J. A., Huang, W., Nallapareddy, S. R., Teng, F., Murray, B. E.
(2004). Influence of Origin of Isolates, Especially Endocarditis Isolates, and Various Genes on Biofilm Formation by Enterococcus faecalis. Infect. Immun.
72: 3658-3663
[Abstract]
[Full Text]
-
Wen, Z. T., Burne, R. A.
(2004). LuxS-Mediated Signaling in Streptococcus mutans Is Involved in Regulation of Acid and Oxidative Stress Tolerance and Biofilm Formation. J. Bacteriol.
186: 2682-2691
[Abstract]
[Full Text]
-
Lemos, J. A. C., Brown, T. A. Jr., Burne, R. A.
(2004). Effects of RelA on Key Virulence Properties of Planktonic and Biofilm Populations of Streptococcus mutans. Infect. Immun.
72: 1431-1440
[Abstract]
[Full Text]
-
McNeill, K., Hamilton, I. R.
(2004). Effect of acid stress on the physiology of biofilm cells of Streptococcus mutans. Microbiology
150: 735-742
[Abstract]
[Full Text]
-
Kristich, C. J., Li, Y.-H., Cvitkovitch, D. G., Dunny, G. M.
(2004). Esp-Independent Biofilm Formation by Enterococcus faecalis. J. Bacteriol.
186: 154-163
[Abstract]
[Full Text]
-
Scheie, A. A., Petersen, F. C.
(2004). THE BIOFILM CONCEPT: CONSEQUENCES FOR FUTURE PROPHYLAXIS OF ORAL DISEASES?. CROBM
15: 4-12
[Abstract]
[Full Text]
-
Loo, C. Y., Mitrakul, K., Voss, I. B., Hughes, C. V., Ganeshkumar, N.
(2003). Involvement of an Inducible Fructose Phosphotransferase Operon in Streptococcus gordonii Biofilm Formation. J. Bacteriol.
185: 6241-6254
[Abstract]
[Full Text]
-
Kharazmi, M., Sczesny, S., Blaut, M., Hammes, W. P., Hertel, C.
(2003). Marker Rescue Studies of the Transfer of Recombinant DNA to Streptococcus gordonii In Vitro, in Foods and Gnotobiotic Rats. Appl. Environ. Microbiol.
69: 6121-6127
[Abstract]
[Full Text]
-
Kuramitsu, H. K.
(2003). MOLECULAR GENETIC ANALYSIS OF THE VIRULENCE OF ORAL BACTERIAL PATHOGENS: AN HISTORICAL PERSPECTIVE. CROBM
14: 331-344
[Abstract]
[Full Text]
-
Idone, V., Brendtro, S., Gillespie, R., Kocaj, S., Peterson, E., Rendi, M., Warren, W., Michalek, S., Krastel, K., Cvitkovitch, D., Spatafora, G.
(2003). Effect of an Orphan Response Regulator on Streptococcus mutans Sucrose-Dependent Adherence and Cariogenesis. Infect. Immun.
71: 4351-4360
[Abstract]
[Full Text]
-
Loo, C. Y., Mitrakul, K., Voss, I. B., Hughes, C. V., Ganeshkumar, N.
(2003). Involvement of the adc Operon and Manganese Homeostasis in Streptococcus gordonii Biofilm Formation. J. Bacteriol.
185: 2887-2900
[Abstract]
[Full Text]
-
Merritt, J., Qi, F., Goodman, S. D., Anderson, M. H., Shi, W.
(2003). Mutation of luxS Affects Biofilm Formation in Streptococcus mutans. Infect. Immun.
71: 1972-1979
[Abstract]
[Full Text]
-
McNab, R., Ford, S. K., El-Sabaeny, A., Barbieri, B., Cook, G. S., Lamont, R. J.
(2003). LuxS-Based Signaling in Streptococcus gordonii: Autoinducer 2 Controls Carbohydrate Metabolism and Biofilm Formation with Porphyromonas gingivalis. J. Bacteriol.
185: 274-284
[Abstract]
[Full Text]
-
Yoshida, A., Kuramitsu, H. K.
(2002). Multiple Streptococcus mutans Genes Are Involved in Biofilm Formation. Appl. Environ. Microbiol.
68: 6283-6291
[Abstract]
[Full Text]
-
Li, Y.-H., Lau, P. C. Y., Tang, N., Svensater, G., Ellen, R. P., Cvitkovitch, D. G.
(2002). Novel Two-Component Regulatory System Involved in Biofilm Formation and Acid Resistance in Streptococcus mutans. J. Bacteriol.
184: 6333-6342
[Abstract]
[Full Text]
-
Lemos, J. A. C., Burne, R. A.
(2002). Regulation and Physiological Significance of ClpC and ClpP in Streptococcus mutans. J. Bacteriol.
184: 6357-6366
[Abstract]
[Full Text]
-
Munson, M.A., Pitt-Ford, T., Chong, B., Weightman, A., Wade, W.G.
(2002). Molecular and Cultural Analysis of the Microflora Associated with Endodontic Infections. JDR
81: 761-766
[Abstract]
[Full Text]
-
Kolenbrander, P. E., Andersen, R. N., Blehert, D. S., Egland, P. G., Foster, J. S., Palmer, R. J. Jr.
(2002). Communication among Oral Bacteria. Microbiol. Mol. Biol. Rev.
66: 486-505
[Abstract]
[Full Text]
-
Oosthuizen, M. C., Steyn, B., Theron, J., Cosette, P., Lindsay, D., von Holy, A., Brozel, V. S.
(2002). Proteomic Analysis Reveals Differential Protein Expression by Bacillus cereus during Biofilm Formation. Appl. Environ. Microbiol.
68: 2770-2780
[Abstract]
[Full Text]
-
Li, Y.-H., Tang, N., Aspiras, M. B., Lau, P. C. Y., Lee, J. H., Ellen, R. P., Cvitkovitch, D. G.
(2002). A Quorum-Sensing Signaling System Essential for Genetic Competence in Streptococcus mutans Is Involved in Biofilm Formation. J. Bacteriol.
184: 2699-2708
[Abstract]
[Full Text]
-
Wen, Z. T., Burne, R. A.
(2002). Functional Genomics Approach to Identifying Genes Required for Biofilm Development by Streptococcus mutans. Appl. Environ. Microbiol.
68: 1196-1203
[Abstract]
[Full Text]
-
Taylor, C. M., Beresford, M., Epton, H. A. S., Sigee, D. C., Shama, G., Andrew, P. W., Roberts, I. S.
(2002). Listeria monocytogenes relA and hpt Mutants Are Impaired in Surface-Attached Growth and Virulence. J. Bacteriol.
184: 621-628
[Abstract]
[Full Text]
-
Mattos-Graner, R. O., Jin, S., King, W. F., Chen, T., Smith, D. J., Duncan, M. J.
(2001). Cloning of the Streptococcus mutans Gene Encoding Glucan Binding Protein B and Analysis of Genetic Diversity and Protein Production in Clinical Isolates. Infect. Immun.
69: 6931-6941
[Abstract]
[Full Text]
-
Rogers, J. D., Palmer, R. J. Jr., Kolenbrander, P. E., Scannapieco, F. A.
(2001). Role of Streptococcus gordonii Amylase-Binding Protein A in Adhesion to Hydroxyapatite, Starch Metabolism, and Biofilm Formation. Infect. Immun.
69: 7046-7056
[Abstract]
[Full Text]
-
Huber, B., Riedel, K., Hentzer, M., Heydorn, A., Gotschlich, A., Givskov, M., Molin, S., Eberl, L.
(2001). The cep quorum-sensing system of Burkholderia cepacia H111 controls biofilm formation and swarming motility. Microbiology
147: 2517-2528
[Abstract]
[Full Text]
-
Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, I., Penades, J. R.
(2001). Bap, a Staphylococcus aureus Surface Protein Involved in Biofilm Formation. J. Bacteriol.
183: 2888-2896
[Abstract]
[Full Text]
-
Froeliger, E. H., Fives-Taylor, P.
(2001). Streptococcus parasanguis Fimbria-Associated Adhesin Fap1 Is Required for Biofilm Formation. Infect. Immun.
69: 2512-2519
[Abstract]
[Full Text]
-
Li, Y.-H., Lau, P. C. Y., Lee, J. H., Ellen, R. P., Cvitkovitch, D. G.
(2001). Natural Genetic Transformation of Streptococcus mutans Growing in Biofilms. J. Bacteriol.
183: 897-908
[Abstract]
[Full Text]
-
Cvitkovitch, D.G.
(2001). Genetic Competence and Transformation in Oral Streptococci. CROBM
12: 217-243
[Abstract]
[Full Text]
-
Davey, M. E., O'toole, G. A.
(2000). Microbial Biofilms: from Ecology to Molecular Genetics. Microbiol. Mol. Biol. Rev.
64: 847-867
[Abstract]
[Full Text]
-
Du, L. D., Kolenbrander, P. E.
(2000). Identification of Saliva-Regulated Genes of Streptococcus gordonii DL1 by Differential Display Using Random Arbitrarily Primed PCR. Infect. Immun.
68: 4834-4837
[Abstract]
[Full Text]