Previous Article | Next Article 
Journal of Bacteriology, March 2000, p. 1575-1579, Vol. 182, No. 6
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Identification of the Active Site of HetR Protease
and Its Requirement for Heterocyst Differentiation in the
Cyanobacterium Anabaena sp. Strain PCC 7120
Yuqing
Dong,
Xu
Huang,
Xiang-Yu
Wu, and
Jindong
Zhao*
College of Life Sciences, Peking University,
Beijing 100871, China
Received 8 September 1999/Accepted 20 December 1999
 |
ABSTRACT |
HetR is a serine-type protease required for heterocyst
differentiation in heterocystous cyanobacteria under conditions of nitrogen deprivation. We have identified the active Ser residue of HetR
from Anabaena sp. strain PCC 7120 by site-specific
mutagenesis. By changing the S152 residue to an Ala residue, the mutant
protein cannot be labeled by Dansyl fluoride, a specific serine-type
protein inhibitor. The mutant protein showed no autodegradation in
vitro. The mutant hetR gene was introduced into
Anabaena strain 884a, a hetR mutant. The
resultant strain, Anabaena strain S152A, could not form
heterocysts under conditions of nitrogen deprivation even though the
up-regulation of the mutant hetR gene was induced upon
removal of combined nitrogen. The Anabaena strain 216, which carries a mutant hetR gene encoding S179N HetR and
could not form heterocysts, also produced HetR protein upon induction.
Sequence comparison shows that Ser152 is conserved in all
cyanobacterial HetR. Immunoblotting was used to study HetR induction in
both the wild-type and mutant strains. The amount of mutant HetR in strain S152A and in strain 216 increased continuously for 24 h after nitrogen step-down, while the amount of HetR in wild-type cells
reached a maximum level within 6 h after nitrogen step-down. Our
results show the Ser152 is the active site of HetR. The protease activity is required for heterocyst differentiation and might be needed
for repression of HetR overproduction under conditions of nitrogen deprivation.
| |
INTRODUCTION |
Some filamentous cyanobacteria form
specialized cells called heterocysts for providing a micro-oxygen
environment for nitrogen fixation under nitrogen-limiting conditions.
Mature heterocysts differ from vegetative cells metabolically and
morphologically in several ways (3, 6, 10, 25): they lack
photosystem II and oxygen-generating ability and have little
phycobiliprotein, they lack the ability to fix CO2, they
have a high rate of respiratory electron transfer, and they have a
thick envelope consisting of an inner glycolipid layer and an outer
polysaccharide layer. Another important feature of heterocysts is that
they are usually spaced regularly along the filaments so that they form
a pattern (23-25).
The process of differentiation from a vegetative cell to a heterocyst
is complex, and many genes are involved (3, 25). Some gene
products control early differentiation, while the others are essential
for later stages of heterocyst differentiation. Among the gene products
which are required for initiation of heterocyst differentiation are
NtcA and HetR. NtcA is a global nitrogen regulator present in both
unicellular and filamentous cyanobacteria (5, 22). HetR is
an autoregulatory serine-type protease present in heterocystous and
some nonheterocystous cyanobacteria (1, 2, 12, 28). The
expression of the hetR gene in Anabaena sp.
strain PCC 7120, a heterocystous cyanobacterium, is induced upon
removal of combined nitrogen from the growth medium (2, 28).
The hetR gene product is accumulated in the cells that are
destined to become heterocysts (2) and in mature heterocysts (28). It has been shown that a normal hetR gene
is required for its own induction in Anabaena sp. strain PCC
7120 (1) and a functional hetR gene is absolutely
required for heterocyst differentiation (1, 2). HetR also
controls pattern formation in heterocystous cyanobacteria (2,
25).
The hetR gene was initially discovered in
Anabaena strain 216, which was unable to form heterocysts
(2). Strain 216 carried a mutant hetR gene with a
single nucleotide mutation which converted Ser179 to an Asn residue.
The recombinant wild-type HetR showed auto-proteolysis while the mutant
HetR protein (S179N HetR) has no auto-degrading activity in vitro
(29). However, as in the case of wild-type HetR, S179N HetR
could be labeled with Dansyl fluoride (DnsF), a specific serine-type
protease inhibitor (21, 29). This result indicates that
Ser179 may not be the active serine of HetR even though it is required
for heterocyst differentiation and its protease activity. Peptide
mapping of DnsF-labeled HetR showed that the active Ser of HetR could
be located in the region between residues 140 and 164 (29),
the region which contains two Ser residues.
The mechanism by which HetR controls heterocyst differentiation has not
been fully elucidated. A database search revealed no similarity of HetR
to any other proteins. The substrates of HetR remain unknown except for
the fact that HetR undergoes auto-degradation (28, 29). The
active Ser residue has not been identified even though it is known that
Ser179 is required for its functions. In this communication, we report
identification of the active site of HetR from Anabaena sp.
strain PCC 7120. The roles of the active Ser residue in heterocyst
differentiation and hetR gene expression are also reported.
| |
MATERIALS AND METHODS |
Strains and culture conditions.
Anabaena sp. strain
PCC 7120 and its mutant strains were grown in BG11 medium
(17) containing appropriate antibiotics either in liquid
culture or on plates. The BG11 medium was supplemented with 10 mM HEPES
at pH 7.5. The cultures were grown under a moderate light intensity (50 to 100 µmol · m
2 · s1) at
28°C. The illumination was provided with cool-white fluorescent lamps. NaNO3 at a concentration of 1 g · liter1 was used when needed. Escherichia coli
strains were grown in LB medium containing appropriate antibiotics at
38°C. E. coli strain DH5
was used for all cloning
purposes, and BL21(DE3) was used to express hetR genes with
pET3a (18) as the expression vector as reported previously
(28, 29).
Site-specific mutagenesis and other DNA methods.
Plasmid
isolation and analysis were performed according to standard procedures.
Restriction endonucleases (Promega, Beijing, China) were used according
to the manufacturer's recommendations. To generate site-specific
mutant hetR genes, the pALTER-ex1 system from Promega was
used according to the manufacturer's recommendation. The
hetR gene was first cloned into the pALTER-ex1 plasmid, and the resultant plasmid was isolated and denatured under alkaline conditions. The in vitro synthesis of the second strand was then carried out. An oligonucleotide (5' GAGCATAAGTTACCCGCAAATCTTCCCG 3') was used to generate the S142A hetR gene. Another
oligonucleotide (5' CAGTTAGTTACTGCTTTTGAGTTT 3') was used to
generate the S152A hetR gene. Oligonucleotides (5'
CAGTTAGTTACTNNNTTTGAGTTT 3') were used to generate other possible
mutations at the Ser152 position. The mutant hetR genes were
digested with XbaI and BamHI and cloned into a
pBluescript KS+ vector (Stratagene). The inserts were
sequenced with an automatic DNA sequencer (ABI377; PE-Applied
Biosystems) to determine their exact mutations. The desired mutant
hetR genes were then cloned into a pET3a vector as described
previously (28) for overproduction of HetR proteins.
The expression vectors pET3a/HetRs were used to generate suicidal
plasmids (19) containing different hetR genes to
transform the Anabaena sp. strain PCC 7120 mutant derivative
strain 884a (1). The 1.2-kb fragment containing
hetR promoters was first amplified by PCR. The
oligonucleotides for the PCR were 5' TTAGATCTGATCAATAAATTAGGT 3'
and 5' AACATATGACAAATAGTTGAATAGC 3'. The amplification
conditions were as described by Zhou et al. (28). The
amplified fragment was digested with BglII and
NdeI and gel purified before ligation into pET3a/HetRs,
which were also digested with BglII and NdeI. The
fragment containing the gene for streptomycin resistance (7) was then inserted into the HindIII site
of the plasmids mentioned above to generate the suicidal plasmids,
pHetR.
Total DNA extraction, enzyme digestion, gel electrophoresis, and
Southern blotting were performed according to the method
of Zhao et al.
(
27). The isolated total DNA was digested with
HindIII and
DraI and separated with a 0.8%
agarose gel. The DNA
fragments in gel were denatured with NaOH and
transferred to a
nitrocellulose membrane. The membrane was baked and
used for hybridization.
Probes used for hybridization were prepared by
using two different
DNA templates. The first DNA template was the
0.9-kb DNA fragment
containing the
hetR gene encoding HetR
in its entirety from
Anabaena sp. strain PCC 7120 as
described previously (
28). The second
DNA template was
obtained by PCR amplification of an internal
fragment of the
hetR gene in
Anabaena sp. strain PCC 7120. The
primers used for the PCR were 5' GGCATGGAGCATTCTTAG 3' and
5'
AgATCCTCTTgCgATCgC 3'. The amplified region of the
hetR gene was
deleted in construction of
Anabaena
strain 884a (
1). Radioisotope-labeled
probes for Southern
hybridization were generated with [
-
32P]dATP (100 TBq
mmol
1) by using a random-labeling kit from
Amersham.
Triparental mating was used to introduce the
hetR genes into
Anabaena strain 884a, a
hetR mutant derivative of
Anabaena sp.
strain PCC 7120 (
1), according to
the method of Elhai and Wolk
(
4). The exconjugants were
selected on BG11 plates containing
neomycin (25 µg · ml
1) and streptomycin (5 µg · ml
1).
HetR protein characterization.
Overproduction, refolding,
and purification of both wild-type and mutant HetR proteins were
performed as described previously (28). Dansyl fluoride
(DnsF) labeling of the HetR proteins was performed according to the
method of Zhou et al. (29). The DnsF-labeled proteins were
separated from free DnsF by acetone precipitation. Electroblotting was
carried out after sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) (15) of the proteins, and the fluorescence images of the DnsF-HetR adducts were visualized under UV
light and recorded with a digital camera.
The nitrogen step-down of
Anabaena sp. strain PCC 7120 culture and immunoblotting for detection of HetR proteins were
performed
as described previously (
9,
28). The protein
concentration
was determined with dye-binding assays by using the kit
from Bio-Rad.
The amount of HetR was determined by immunoblotting as an
average
of three
blots.
Protein sequence alignment was carried out with the computer program
CLUSTAL W (
20). The relevant HetR sequences were obtained
from
GenBank.
Other methods.
The chlorophyll concentration was determined
with 80% acetone (16). Observation and photography of
Anabaena filaments were performed with a Leica light
microscope equipped with a digital camera. Light intensity was measured
with a Li-cor light intensity meter.
| |
RESULTS AND DISCUSSION |
Identification of the active Ser of the HetR from
Anabaena sp. strain PCC 7120.
It has been shown that
Dansyl fluoride (DnsF), a specific serine-type protease inhibitor,
could specifically label both wild-type HetR and S179N HetR, a mutant
HetR carried in strain 216 that cannot form heterocysts (2,
29). Tryptic mapping and sequencing have revealed that one of the
two Ser residues (Ser142 and Ser152) on the tryptic peptide between
residues 140 and 164 of the HetR protein from Anabaena sp.
strain PCC 7120 could be the site for DnsF labeling. To determine which
Ser residue is the site labeled by DnsF, site-specific mutagenesis was
performed. Ser142 and Ser152 were changed into an Ala residue
separately. The mutant genes as well as wild-type hetR were
overexpressed as described previously (28), and the
recombinant HetR proteins were purified. The purified HetR proteins
were used for labeling with DnsF; the results are shown in Fig.
1. DnsF could label both the wild-type
HetR (lane 3) and S142A HetR (lane 2), while S152A HetR (lane 1) could
not be labeled. We also performed other mutagenesis at the site of Ser152 and found that no residues could replace Ser at this position for DnsF labeling (data not shown). These results strongly suggest that
Ser152 is the active site of HetR.
View larger version (88K):
[in this window]
[in a new window]
|
FIG. 1.
DnsF labeling of HetR proteins. S152A HetR (lanes 1),
S142A HetR (lanes 2), and wild-type HetR (lanes 3) were overproduced in
E. coli and purified to homogeneity. DnsF was then reacted
with these proteins, followed by 80% acetone precipitation. The
proteins were separated from free DnsF by SDS-PAGE, followed by
electroblotting. (A) Fluorescence image of DnsF-labeled HetR proteins
on a polyvinylidene difluoride membrane recorded with a digital camera.
(B) The same membrane shown in panel A, but stained with Coomassie
blue.
|
|
HetR undergoes auto-degradation in the absence of a protease inhibitor
(
29). The fact that S152A HetR could not be labeled
with
DnsF predicted that the protein would not undergo auto-proteolysis.
To
test this prediction, recombinant HetR proteins were incubated
at
37°C for auto-degradation in vitro (Fig.
2). While both the
wild-type HetR and
S142A HetR showed auto-degradation, S152A HetR
showed no
auto-degradation. On the basis of these results, we
came to the
conclusion that Ser152 is the active Ser of HetR in
Anabaena
sp. strain PCC 7120.
View larger version (82K):
[in this window]
[in a new window]
|
FIG. 2.
Degradation of HetR protein in vitro. Purified HetR
protein at a concentration of 2 mg · ml1 was
incubated at 37°C for 1 h before sample loading buffer was added
to stop the reaction. SDS-PAGE separation of the proteins was
performed, and the gel was stained with Coomassie blue. The arrow
indicates the position of intact HetR in the gel.
|
|
Ser152 is required for heterocyst differentiation.
To
investigate the roles of the mutant HetR in heterocyst differentiation
and pattern formation, suicidal plasmids containing either the
wild-type hetR gene or mutant hetR genes were
constructed and introduced into Anabaena strain 884a, a
hetR mutant strain (1). Strain 884a lacks the
middle part of the hetR gene, encoding a region from residue
35 through residue 168. The backbone of the suicidal plasmids is the
expression vector for hetR genes, pET3a/HetRs. The 1.2-kb
upstream fragment, which contains several promoters for the
hetR gene (2, 11), was inserted upstream of the
hetR genes, and the fragment containing the
Strr gene was inserted into the
HindIII site of pET3a/HetR. The suicidal plasmids were
introduced into strain 884a by triparental mating, and the exconjugants
were selected with streptomycin and neomycin. The resultant strains,
containing the wild-type hetR gene, the S142A
hetR gene, and the S152A hetR gene, are named
strain WT211, S142A, and S152A, respectively.
Southern hybridization was performed to confirm that the
hetR genes were integrated into chromosomal DNA of strain
884a (Fig.
3). When hybridized with a
probe prepared by using the entire
hetR gene fragment as a
template, two bands, with sizes of 3.8
and 1.0 kb, were observed in
strain 884a DNA digested with
DraI
and
HindIII. Three bands were observed in
DraI-
and
HindIII-digested
DNA of WT211, S142A, and S152A when
the DNA was hybridized with
the same probe. The sizes of the hybridized
bands were 3.2, 1.5,
and 1.0 kb. Because strain 884a retains about
approximately 100
bp of the 5' coding region and 400 bp of the 3'
coding region
of the
hetR gene, the two bands that were
observed in strain 884a
DNA (Fig.
3A) were likely the fragments
containing these regions.
The 1.5-kb bands in
DraI- and
HindIII-digested DNA of WT211, S142A,
and S152A were
expected on the basis of restriction sites of the
suicidal plasmids. To
confirm that the 1.5-kb bands were indeed
from the
hetR
genes introduced into strain 884a through single
recombination, a probe
was prepared using a 0.4-kb DNA fragment
as a template. This fragment
was deleted in construction of strain
884a (
1). The
hybridization results (Fig.
3B) show that the
region was missing in
strain 884a, as was expected, and present
in strains WT211, S142A, and
S152A. Thus, it is evident that the
hetR genes have been
successfully introduced into strain 884a
and integrated into the
chromosome. Figure
3B also shows that
the recombination between
chromosomal DNA and the suicidal plasmids
likely occurred in the region
of
hetR promoters.
View larger version (79K):
[in this window]
[in a new window]
|
FIG. 3.
Southern hybridization analysis of integration of the
hetR genes into chromosomal DNA of Anabaena
strain 884a. Total DNA was isolated from strains 884a, WT211, S142A,
and S152A and digested with DraI and HindIII.
The digested DNA was separated with a 0.8% agarose gel and NaOH
denatured, followed by blotting onto nitrocellulose membranes. The
membranes were hybridized either with a probe of full-length
hetR (A) or with a probe consisting of a 0.4-kb internal
fragment of hetR (B) as described in Materials and Methods.
The membrane was then washed three times and dried before exposure to
an X-ray film. The arrows indicate the positions of DNA fragments
containing hetR genes (1.5 kb). The  phage DNA fragments
generated by EcoRI and HindIII digestions
were used as molecular size markers (shown on the left). They were
(from the top down): 21.2, 5.1, 4.9, 4.3, 3.5, 2.0, 1.9, 1.6, 1.4, 0.95, and 0.83 kb.
|
|
The expression of the
hetR genes in these strains was
studied by immunoblotting using anti-HetR antibodies. Cells were first
grown in nitrogen-replete media and then subjected to nitrogen
step-down for 3 h before immunoblotting. The results of
immunoblotting
are shown in Fig.
4. Both
the wild-type
hetR gene and the mutant
hetR genes
were expressed, and similar amount of HetR proteins
were accumulated in
these strains 3 h after nitrogen step-down.
Strain 216, which
carries a S179N
hetR gene and is unable to differentiate
heterocysts (
2), is also studied for its ability to produce
HetR. The result shows that a similar amount of HetR protein was
produced in strain 216 3 h after nitrogen step-down.
View larger version (115K):
[in this window]
[in a new window]
|
FIG. 4.
Immunoblotting analysis of hetR gene
expression in Anabaena strains 884a (lane 1), WT211 (lane
2), S142A (lane 3), S152A (lane 4), and 216 (lane 5). The
Anabaena cultures at a chlorophyll concentration of 3 µg · ml1 under nitrogen-replete conditions were
washed three times with nitrogen-depleted medium and resuspended at a
chlorophyll concentration of 3 µg · ml1. The
cultures were incubated in light for 3 h at 28°C. Five
milliliters of culture was collected and lysed with SDS-gel loading
buffer at 100°C before SDS-PAGE and immunoblotting. The arrow
indicates the position of intact HetR in the gel.
|
|
To determine whether strain S152A is capable of differentiating
heterocysts under nitrogen-deprived conditions, filaments
of the wild
type, S142A, and S152A were transferred to BG11 medium
containing no
combined nitrogen and incubated for 36 h. While
it is obvious that
both the wild type and S142A strains form heterocysts,
strain S152A
could not form heterocysts (Fig.
5).
Longer incubation
of strain S152A under nitrogen deprivation resulted
in filament
fragmentation and cell lysis (data not shown). The pattern
formation
in strain S142A is normal, showing that S142A HetR did not
change
heterocyst distribution along the filaments of
Anabaena sp. strain
PCC 7120.
View larger version (116K):
[in this window]
[in a new window]
|
FIG. 5.
Photographic images of Anabaena sp. strain
PCC 7120 (wild type), strain S142A, and strain S152A after incubation
under nitrogen-depleted conditions for 36 h in light at 28°C.
The nitrogen step-down procedure was the same as that described in the
legend to Fig. 4. The images of the filaments were recorded with a
digital camera attached to a Leica light microscope. Arrows indicate
the positions of heterocysts.
|
|
Sequence comparison has often been used to determine whether an amino
acid is important at a certain position on a protein.
A database search
revealed that Ser152 was conserved in all HetR
proteins deduced from
hetR genes in other cyanobacteria (data
not shown),
suggesting that Ser152 is a critical residue for
HetR.
Immunoblotting study of the expression of the mutant
hetR genes.
The expression of the wild-type
hetR gene from Anabaena sp. strain PCC 7120 has
been shown to be auto-regulatory (1). To study the
expression of the mutant hetR genes, cells from the wild
type and from strains S142A and S152A at 3, 6, 12, and 24 h after
nitrogen step-down were collected and the amount of HetR protein was
determined by immunoblotting (Fig. 6).
Figure 6 also includes the immunoblotting results for strain 216, which
contains S179N hetR. In both the wild type and strain S142A,
the up-regulation of HetR production occurred within the first 6 h
after nitrogen step-down, as reported previously (28). The
overall increase in the HetR level was approximately two- to threefold.
In strains 216 and S152A, the up-regulation of HetR continued for at
least 24 h after nitrogen step-down. The overall increase in HetR
in both strains upon induction was approximately five- to sixfold. Longer incubation of the strain 216 and S152A resulted in smearing in
immunoblotting, making it difficult to determine the amount of HetR
(data not shown).
View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Induction of HetR proteins in Anabaena
strains 216, WT211, S142A, and S152A in the absence of combined
nitrogen from the growth medium. The nitrogen step-down procedure was
the same as that described in the legend to Fig. 5. Cells at times
indicated after nitrogen step-down were collected and analyzed by
immunoblotting as described in the legend to Fig. 5. The amount of HetR
proteins in each culture was determined by band intensity after
staining. Each set of data from different strains was normalized
against the point at zero time nitrogen deprivation. Each point shown
in the figure was an average from three blots.
|
|
The integration of the
hetR genes introduced by suicidal
plasmids will result in two copies of the
hetR promoter
region in
Anabaena. The induction results of S142A shown in
Fig.
6 suggest
that the duplication of the
hetR promoter
region did not change
the pattern of
hetR gene expression as
compared with that of the
wild-type strain (
28). The spatial
pattern of heterocysts was
not altered either in strain S142A (Fig.
5).
It has been reported that
hetR gene is auto-regulatory in
its expression. By using
luxAB genes as reporter genes,
Black et
al. (
1) showed that a functional
hetR
gene product was required
for its own induction in expression. The
strain used in the study
by Black et al. was the strain 884a, which
produced no HetR due
to a partial deletion of the
hetR gene.
In the present report,
we show that both strain 216, which carries the
S179N
hetR gene,
and strain S152A, which carries the S152A
hetR gene, exhibit induction
of
hetR gene
expression upon shifting to nitrogen deprivation
conditions (Fig.
4 and
Fig.
6). These results suggest that the
protease activity of HetR is
not required for
hetR gene induction,
although this activity
is required for heterocyst formation. Figure
6 also shows that the
induction of expression of S152A
hetR and
S179N
hetR is quite different from that of the wild-type
hetR gene. The production of wild-type
hetR gene
product reached its
maximum level within 6 h after nitrogen
step-down (
28) (Fig.
6) and was maintained at this level
thereafter. The level of HetR
in strains 216 and S152A continued to
increase for at least 24
h after nitrogen step-down (Fig.
6). The
expression of
hetR genes
upon induction with
nitrogen-limiting conditions in these two
mutant strains is apparently
derepressed, suggesting that the
protease activity of HetR is required
not only for heterocyst
differentiation but also to prevent
overaccumulation of HetR protein
in cells. A similar conclusion has
been reached on the basis of
results using the green fluorescent
protein gene as a reporter
gene under control of the
hetR
promoter (
11). The prevention
of overaccumulation of HetR in
Anabaena sp. strain PCC 7120 could
be achieved by HetR's
auto-proteolytic activity. It is also possible
that a proteolytic
product generated by HetR could be functioning
as a repressor for
blocking
hetR gene induction in neighboring
vegetative
cells. The pentapeptide of PatS (
26) could be generated
in
such a way, as was suggested by Haselkorn (
11).
HetR plays a very critical role in heterocyst differentiation and
pattern formation (
3,
6,
24). Experimental evidence
shows
that HetR is a serine-type protease (
29). The evidence
presented here clearly demonstrates that Ser152 of HetR in
Anabaena sp. strain PCC 7120 is the active site and is
required for heterocyst
differentiation. The Ser179 residue is also
critical to the function
of HetR in
Anabaena sp. strain PCC
7120. Strain 216, which carries
a Ser-to-Asn mutation of HetR, could
not form heterocysts under
conditions of nitrogen deprivation
(
2). The recombinant S179N
HetR protein lacks
auto-degradation, while wild-type HetR undergoes
auto-proteolysis
(
29). On the basis of results that all revertants
in the
S179N
hetR gene exhibit an Asn-to-Ser codon change
(
11),
it is likely that Ser179 plays an active role in HetR.
Ser179
could participate in substrate binding. The lack of Ser179 in
HetR in
Anabaena sp. strain PCC 7120 could then lead to a
total
loss of HetR
activity.
Proteases play important roles in cell differentiation and development
in many organisms (
14). Cell cycles are also influenced
strongly by protease activity (
13). Proteases are also
required
for bacterial development, such as sporulation in
Bacillus subtilis (
8). HetR is another example of
proteases involved in cell
differentiation. One possible role of HetR
in heterocyst differentiation
is to specifically cleave a repressor(s)
which blocks transcription
of heterocyst-specific genes. More study is
required to understand
the mechanism of HetR in cyanobacterial cell
differentiation.
The identification of the active Ser of HetR would
certainly help
in the understanding of its biochemical
functions.
| |
ACKNOWLEDGMENTS |
We thank C. P. Wolk (Michigan State University) for strain
884a and R. Haselkorn (University of Chicago) for strain 216. We also
thank C. Dong for her skillful technical assistance.
This work was supported by the National Natural Science Foundation of
China to J. Z. (grants 39535002 and 39570067).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: College of Life
Sciences, Peking University, Beijing 100871, China. Phone:
86-10-6275-6421. Fax: 86-10-6275-1526. E-mail:
jzhao{at}pku.edu.cn.
| |
REFERENCES |
| 1.
|
Black, T. A.,
Y. Cai, and C. P. Wolk.
1993.
Spatial expression and autoregulation of hetR, a gene involved in the control of heterocyst development in Anabaena.
Mol. Microbiol.
9:77-84[Medline].
|
| 2.
|
Buikema, W. J., and R. Haselkorn.
1991.
Characterization of a gene controlling heterocyst differentiation in the cyanobacterium Anabaena 7120.
Genes Dev.
5:321-330[Abstract/Free Full Text].
|
| 3.
|
Buikema, W. J., and R. Haselkorn.
1993.
Molecular genetics of cyanobacterial development.
Annu. Rev. Plant Physiol. Plant Mol. Biol.
44:33-52[CrossRef].
|
| 4.
|
Elhai, J., and C. P. Wolk.
1988.
Conjugal transfer of DNA to cyanobacteria.
Methods Enzymol.
167:747-754[Medline].
|
| 5.
|
Frias, J. E.,
E. Flores, and A. Herrero.
1994.
Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120.
Mol. Microbiol.
14:823-832[Medline].
|
| 6.
|
Golden, J. W., and H. S. Yoon.
1998.
Heterocyst formation in Anabaena.
Curr. Opin. Microbiol.
1:623-629[CrossRef][Medline].
|
| 7.
|
Golden, J. W., and D. R. Wiest.
1988.
Genome rearrangement and nitrogen fixation in Anabaena blocked by inactivation of xisA gene.
Science
242:1421-1423[Abstract/Free Full Text].
|
| 8.
|
Gottesman, S.
1999.
Regulation by proteolysis: developmental switches.
Curr. Opin. Microbiol.
2:142-47[CrossRef][Medline].
|
| 9.
|
Harlow, E., and D. Lane.
1988.
Antibodies, a laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 10.
|
Haselkorn, R.
1978.
Heterocysts.
Annu. Rev. Plant Physiol.
29:319-344.
|
| 11.
|
Haselkorn, R.
1998.
How cyanobacteria count to 10.
Science
30:891-892.
|
| 12.
|
Janson, S.,
A. Matveyev, and B. Bergman.
1998.
The presence and expression of hetR in the non-heterocystous cyanobacterium Symploca PCC 8002.
FEMS Microbiol. Lett.
15:173-179.
|
| 13.
|
King, R. W.,
R. J. Deshaies,
J.-M. Peters, and M. W. Kirschner.
1996.
How proteolysis drives the cell cycle.
Science
274:1652-1659[Abstract/Free Full Text].
|
| 14.
|
Kumar, S.
1995.
ICE-like proteases in apoptosis.
Trends Biochem. Sci.
20:198-202[CrossRef][Medline].
|
| 15.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[CrossRef][Medline].
|
| 16.
|
MacKinney, G.
1941.
Absorption of light by chlorophyll solutions.
J. Biol. Chem.
140:315-322[Free Full Text].
|
| 17.
|
Rippka, R.,
J. Deruelles,
J. B. Waterbury,
M. Herdman, and R. Y. Stanier.
1979.
Generic assignments, strain histories and properties of pure cultures of cyanobacteria.
J. Gen. Microbiol.
111:1-61.
|
| 18.
|
Studier, F. W.,
A. H. Rosenberg,
J. J. Dunn, and J. W. Dubendorff.
1991.
Use of T7 RNA polymerase to direct expression of cloned genes.
Methods Enzymol.
185:60-89[CrossRef].
|
| 19.
|
Thiel, T.
1994.
Genetic analysis of cyanobacteria, p. 581-611.
In
D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 20.
|
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 21.
|
Vaz, W. L., and G. Schoellmann.
1976.
Specific fluorescent derivatives of macromolecules. A fluorescence study of some specifically modified derivatives of chymotrypsin, trypsin and subtilisin.
Biochim. Biophys. Acta
439:206-218[Medline].
|
| 22.
|
Wei, T.-F.,
T. S. Ramasubramanian, and J. W. Golden.
1994.
Anabaena sp. strain PCC 7120 ntcA gene required for growth on nitrate and heterocyst development.
J. Bacteriol.
176:4473-4482[Abstract/Free Full Text].
|
| 23.
|
Wilcox, M.,
G. J. Mitchison, and R. J. Smith.
1973.
Pattern formation in the blue-green alga, Anabaena. I. Basic mechanisms.
J. Cell Sci.
12:707-725[Abstract/Free Full Text].
|
| 24.
|
Wolk, C. P., and M. P. Quine.
1975.
Formation of one-dimensional patterns by stochastic processes and by filamentous blue-green algae.
Dev. Biol.
46:370-382[CrossRef][Medline].
|
| 25.
|
Wolk, C. P.,
A. Ernst, and J. Elhai.
1994.
Heterocyst metabolism and development, p. 769-823.
In
D. A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic Publishers, Dordrecht, The Netherlands.
|
| 26.
|
Yoon, H. S., and J. W. Golden.
1998.
Heterocyst pattern formation controlled by a diffusible peptide.
Science
282:935-938[Abstract/Free Full Text].
|
| 27.
|
Zhao, J.,
W. B. Snyder,
U. Muhlenhoff,
E. Rhiel,
P. V. Warren,
J. H. Golbeck, and D. A. Bryant.
1993.
Cloning and characterization of the psaE gene of the cyanobacterium Synechococcus sp. PCC 7002: characterization of a psaE mutant and overproduction of the protein in Escherichia coli.
Mol. Microbiol.
9:183-194[Medline].
|
| 28.
|
Zhou, R.,
Z. Cao, and J. Zhao.
1998.
Characterization of HetR protein turnover in Anabaena sp. PCC 7120.
Arch. Microbiol.
169:417-423[CrossRef][Medline].
|
| 29.
|
Zhou, R.,
X. Wei,
N. Jiang,
H. Li,
Y. Dong,
K. L. Hsi, and J. Zhao.
1998.
Evidence that HetR protein is an unusual serine-type protease.
Proc. Natl. Acad. Sci. USA
95:4959-4963[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2000, p. 1575-1579, Vol. 182, No. 6
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vintila, S., El-Shehawy, R.
(2007). Ammonium ions inhibit nitrogen fixation but do not affect heterocyst frequency in the bloom-forming cyanobacterium Nodularia spumigena strain AV1. Microbiology
153: 3704-3712
[Abstract]
[Full Text]
-
Zhao, W., Guo, Q., Zhao, J.
(2007). A Membrane-Associated Mn-Superoxide Dismutase Protects the Photosynthetic Apparatus and Nitrogenase from Oxidative Damage in the Cyanobacterium Anabaena sp. PCC 7120. Plant Cell Physiol
48: 563-572
[Abstract]
[Full Text]
-
Risser, D. D., Callahan, S. M.
(2007). Mutagenesis of hetR Reveals Amino Acids Necessary for HetR Function in the Heterocystous Cyanobacterium Anabaena sp. Strain PCC 7120. J. Bacteriol.
189: 2460-2467
[Abstract]
[Full Text]
-
Shi, Y., Zhao, W., Zhang, W., Ye, Z., Zhao, J.
(2006). Regulation of intracellular free calcium concentration during heterocyst differentiation by HetR and NtcA in Anabaena sp. PCC 7120. Proc. Natl. Acad. Sci. USA
103: 11334-11339
[Abstract]
[Full Text]
-
Orozco, C. C., Risser, D. D., Callahan, S. M.
(2006). Epistasis Analysis of Four Genes from Anabaena sp. Strain PCC 7120 Suggests a Connection between PatA and PatS in Heterocyst Pattern Formation.. J. Bacteriol.
188: 1808-1816
[Abstract]
[Full Text]
-
Khudyakov, I. Y., Golden, J. W.
(2004). Different functions of HetR, a master regulator of heterocyst differentiation in Anabaena sp. PCC 7120, can be separated by mutation. Proc. Natl. Acad. Sci. USA
101: 16040-16045
[Abstract]
[Full Text]
-
Torrecilla, I., Leganes, F., Bonilla, I., Fernandez-Pinas, F.
(2004). A calcium signal is involved in heterocyst differentiation in the cyanobacterium Anabaena sp. PCC7120. Microbiology
150: 3731-3739
[Abstract]
[Full Text]
-
Huang, X., Dong, Y., Zhao, J.
(2004). HetR homodimer is a DNA-binding protein required for heterocyst differentiation, and the DNA-binding activity is inhibited by PatS. Proc. Natl. Acad. Sci. USA
101: 4848-4853
[Abstract]
[Full Text]
-
Meeks, J. C., Elhai, J.
(2002). Regulation of Cellular Differentiation in Filamentous Cyanobacteria in Free-Living and Plant-Associated Symbiotic Growth States. Microbiol. Mol. Biol. Rev.
66: 94-121
[Abstract]
[Full Text]
-
Wong, F. C. Y., Meeks, J. C.
(2001). The hetF Gene Product Is Essential to Heterocyst Differentiation and Affects HetR Function in the Cyanobacterium Nostoc punctiforme. J. Bacteriol.
183: 2654-2661
[Abstract]
[Full Text]
-
Xu, X., Wolk, C. P.
(2001). Role for hetC in the Transition to a Nondividing State during Heterocyst Differentiation in Anabaena sp.. J. Bacteriol.
183: 393-396
[Abstract]
[Full Text]
Top
Abstract
Introduction
