INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Tracing back the evolution of a metabolic pathway becomes possible when differences in biochemical characters and gene organization can be compared with a phylogenetic progression of the host organisms (23). By applying this rationale to the different branches of the aromatic amino acid biosynthetic pathway, a paradigm was generated to study the molecular evolution of metabolism among Bacteria (1, 8, 23, 24).

Arginine biosynthesis displays diverse patterns of gene organization (5, 9, 15) and is one of those rare instances where two completely different enzymes may catalyze the formation of a key intermediate, in this case ornithine (Fig. 1). In the linear version of the pathway, characteristic of the Enterobacteriaceae (9), the hydrolysis of N--acetylornithine into ornithine and acetate is catalyzed by an acetylornithinase (AOase [EC 3.5.1.16], encoded by argE). In all other prokaryotes, except Myxococcus xanthus (19) and possibly the archaeon Sulfolobus (51), an ornithine acetyltransferase (OATase [EC 2.3.1.35], encoded by argJ) recycles the acetyl group of acetylornithine on glutamate. OATase is also characteristic of fungi and green algae (10).

View larger version (13K): [in this window] [in a new window]   FIG. 1.   Arginine biosynthesis. 1, N-Acetylglutamate synthase (acetyl coenzyme A [acetyl-CoA]: L-glutamate N-acetyltransferase [EC 2.3.1.1]); 2, N-acetylglutamate 5-phosphotransferase (ATP: N-acetyl-L-glutamate 5-phosphotransferase [EC 2.7.2.8]); 3, N-acetylglutamate 5-semialdehyde dehydrogenase (N-acetyl-L-glutamate-5-semialdehyde: NADP+ oxidoreductase [phosphorylating] [EC 1.2.1.38); 4, N2-acetylornithine 5-aminotransferase (N2-acetyl-L-ornithine:2-oxoglutarate aminotransferase [EC 2.6.1.11]); 5, AOase (N2-acetyl-L-ornithine amidohydrolase [EC 3.5.1.16]); 5', OATase (N2-acetyl-L-ornithine:L-glutamate N-acetyltransferase [EC 2.3.1.35]); 6, OTCase (carbamoylphosphate:L-ornithine carbamoyltransferase [EC 2.1.3.3]); 7, argininosuccinate synthetase (L-citrulline:L-aspartate ligase [AMP forming] [EC 6.3.4.5]; 8, argininosuccinase (L-argininosuccinate arginine lyase [EC 4.3.2.1]).

Among gram-negative bacteria, the arginine pathway has been thoroughly studied for fluorescent pseudomonads (9, 39) and for Enterobacteriaceae (9, 15), both members of the class Proteobacteria (54, 55), but not for Vibrionaceae, a related family. Early rRNA-DNA homology analyses and comparative studies of the aspartate and aromatic families of amino acid biosynthetic pathways already suggested a common origin for the Vibrionaceae and Enterobacteriaceae (3, 8, 23, 24). In view of this relationship and considering the prevalent position of OATase among prokaryotes, it was of interest to examine the gene-enzyme relationship of the arginine pathway in members of the Vibrionaceae.

We have investigated two psychrophilic and barotolerant strains previously designated Vibrio strains 2674 and 2693 (29, 56) which proved to belong to the genus Moritella. Both were found to possess an AOase and to present an organization of arginine genes which appears ancestral with respect to the different patterns found among Enterobacteriaceae.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains, plasmids, and growth conditions. Bacterial strains are listed in Table 1. For genetic experiments cells were grown either in liquid broth 869 (14) supplemented with 0.7 g of K₂HPO₄ and 0.2 g of KH₂PO₄ per liter or on agar plates supplemented with the same base or with minimal medium 132 (14). For enzyme assays, cells (Escherichia coli or Moritella) were grown in arginine- and uracil-free (AUF) rich synthetic medium (56). For Moritella strains this medium was supplemented with artificial seawater as a minimal base (42). Plasmid vectors pTrc99A and pBK-CMV were from Pharmacia and Stratagene, respectively.

Cloning and sequencing strategies. Partially digested (with Sau3A) DNA from cells of Moritella strain 2693 grown in Difco Marine Broth was ligated with vector pTrc99A, which had been predigested with BamHI, and was used to transform E. coli C600 OTC argF argI. Colonies appearing at 37°C on 856 plates supplemented with ampicillin (50 µg ml¹) were replicated on minimal medium containing glucose (0.5%), thiamine (1 µg ml¹), and DL-proline (200 µg ml¹) and then incubated at 18°C for 7 days. Several recombinant plasmids were retained for further study and used for the complementation tests whose results are reported in Table 2. Southern blots (48) carried out with pC-11, containing a 3.7-kb insert complementing E. coli argB, -F, and -G mutants, showed that the cloned DNA hybridized to Moritella but not E. coli DNA (data not shown).

1

16S RNA nucleotide sequences. From DNA extracts obtained from cultures of strains 2674 and 2693, the nucleotide sequence of 16S RNA was determined and interpreted by the identification service of the BCCM/LMG node of the Coordinated Collections of Microorganisms at the University of Ghent, Ghent, Belgium.

Enzyme assays. Cell extracts were obtained by 5-min sonic disruption of 0.9% NaCl-washed mid-exponential-phase cells (either Moritella grown at 6°C or recombinant E. coli grown at 30°C) suspended in 50 mM Tris-HCl buffer (pH 8.0). The extracts were centrifuged for 15 min at 20,000 × g, and the supernatants were used for assays. AOase was assayed as described by Vogel and McLellan (53), OATase was assayed according to the method of Van de Casteele et al. (51), and OTCase (EC 2.1.3.3) was assayed as described by Stalon et al. (49). One enzyme unit is defined as the amount of enzyme converting 1 µmol of substrate to product per h. Protein concentrations were determined by the Lowry method.

Primer extension. The antisense oligonucleotides 5' TGCATATAACGTTCCTGT 3' and 5' ACTGTCTCGTCGAAACCATGA 3' (corresponding, respectively, to positions +83 to +66 and +63 to +43 of the argE and argC genes) were used for extension by reverse transcriptase. The protocol was as described by Treizenberg (50). Hybridization was performed at 42°C.

Nucleotide sequence accession numbers. The sequences of the genomic regions reported have been deposited in the EMBL, GenBank, and DDBJ databases under accession numbers AJ252020 to AJ252023.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Main characteristics of Moritella strains 2674 and 2693. Both strains were isolated from the upper sediment layer of the deep Atlantic (2,815 m; 05°37.0N, 19°58.9W) at a temperature of 2°C. By their morphology and other characteristics they had been provisionally assigned to the genus Vibrio (29, 56). Comparative analysis of their 16S rRNA nucleotide sequence brought to light highest similarities with reference organisms of the genus Moritella (from 98.5 to above 99%), the two strains being 98.5% identical with each other.

1

Isolation of arg genes from Moritella and analysis of their nucleotide sequence. The argF gene (encoding OTCase) was cloned from both strains by complementation of E. coli C600 OTC argF argI (E. coli K-12 harbors duplicate genes for OTCase synthesis [15, 28]). Plasmid pC-11 (containing 3.7 kb of strain 2693 DNA) also complemented argB and argG mutants of E. coli. Other fragments belonging to the same region complemented argA, argE, or argH E. coli mutants (Table 2). None were found to complement argD mutants.

View larger version (24K): [in this window] [in a new window]   FIG. 2.   Arginine operons from Moritella strains. The box presents an enlargement of the control region. +1, transcription start site; underlining, putative ARG boxes (operators).

Functional analysis of the argE-argC control region. The presence of DNA transcription signals in the 242-nt region (243-nt region in strain 2693) separating the putative translation start codons of argE and argC was established by primer extension. For argE, a predominant start was identified at a G residue preceded by putative 10 and 35 elements: TAAGGT (or TAAAGT in strain 2 693) and TTCATT, respectively. For argC, transcription was found to start at an A residue in front of the sequences TATTCT and TTGCAT (Fig. 2 and 3). The two promoters face each other as in E. coli (12, 15, 21). In Moritella, however, there is no overlap between the transcripts, whereas in E. coli the overlap is 13 nt long (15). Most of the 242-nt segment is in front of argC; such a long and presumably untranslated sequence is also present in E. coli. Putative operator sequences (Fig. 2) were identified by their similarity to E. coli ARG boxes, i.e., the 18-bp and partly symmetric elements interacting with the E. coli ArgR repressor (15, 30). A close match to the E. coli consensus overlaps the putative argE 35 element. The argC promoter region contains two ARG boxes separated by 3 bp (i.e., the arrangement found in most E. coli arg operators), but the almost completely conserved C residue at position 15 in the right-hand half of the box is either shifted forward by one nucleotide or absent. Since repression was observed in vivo and since there is a gene highly similar to E. coli argR in Moritella (see below), it is likely that at least some of these sequences have a regulatory function.

View larger version (87K): [in this window] [in a new window]   FIG. 3.   Identification of transcription start sites for the arginine operon by primer extension in strains 2674 and 2693 using RNA extracted from cells grown in AUF medium. No bands were observed in the control without RNA. For argC the sequence shown was identical in both strains. For argE the results shown are from strain 2674; the transcription start in strain 2693 was found to be the same.

Enzyme assays and repression in the native context. In extracts of cells grown in AUF medium, an AOase activity of 0.25 U/mg of protein could be detected but no OATase activity was detected; i.e., the level was <0.001 U/mg of protein. Thus, OATase activity was less than 0.05, 0.3, and 2% of the activities measured in extracts of Pseudomonas aeruginosa (33), Bacillus stearothermophilus, and Bacillus subtilis (43), respectively. Extracts of Moritella grown at 6°C in AUF medium displayed enough OTCase activity to determine a repression ratio with some accuracy. In an assay conducted at 15°C, OTCase in extracts of cells of strains 2674 and 2693 was found to have specific activities of 199 and 60 U/mg of protein, respectively, in the absence of arginine and 7 U/mg of protein (for both strains) in the presence of arginine. Thus, the synthesis of this enzyme was repressed by arginine to a considerable extent, as in E. coli.

Enzyme assays in recombinant E. coli cells. Both AOase and OTCase displayed a distinctly psychrophilic profile, with apparent temperature optima lower than those of their E. coli homologues (Fig. 4). Considerable activity was still observed in the actual temperature range of the organisms (from 0 to 14°C). The lower performance of strain 2674 OTCase at a low temperature appears to be compensated for by a higher specific activity (see above).

View larger version (14K): [in this window] [in a new window]   FIG. 4.   Comparison of the temperature dependence of AOase and OTCase activities from E. coli and Moritella. (A) Effect of temperature on AOase activity in cell extracts of E. coli () and of E. coli transformed with plasmid pC-28 harboring argE from strain 2693 (). (B) Effect of temperature on OTCase activity in cell extracts of E. coli () and of E. coli transformed with plasmid pC-11 harboring argF from strain 2693 () and plasmid pXY-114 harboring argF from strain 2674 (). The assays were performed at various temperatures under the conditions described in Materials and Methods. Data are means of at least duplicate measurements; the standard error of the mean was less than 10%.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

A major objective of this work was to determine whether the genetic organization of arginine biosynthetic genes and the mode of ornithine synthesis in Moritella strains 2674 and 2693 could shed some light on the evolution of the arginine pathway within the -3 group of the class Proteobacteria. The data improve our understanding of this process and disclose a new, peculiar type of bifunctional argininosuccinase.

To synthesize ornithine Moritella uses an AOase instead of an OATase, and most of its arg genes are clustered in one continuous sequence divergently transcribed in two wings: argE and argCBFGH(A). This new pattern is related to the argECBH unit of divergent transcription characterized in E. coli (12, 21), the similar cluster found in Salmonella enterica serovar Typhimurium (45) and Providencia strain 9295 (41), and the argECBGH cluster of different Proteus species (41) and Serratia marcescens (32). Other similarities between Moritella and Enterobacteriaceae are the presence of a homologous arginine repressor and the close linkage between ppc and argE.

In Fig. 5 we have combined these data in a schematic and qualitative dendrogram with concurrent phylogenetic information gained by rRNA-DNA homology studies (3), 16S RNA analysis (1, 57), and character state analysis of aromatic amino acid biosynthesis (1). The data suggest that higher degrees of clustering of arg biosynthetic genes correspond to ancestral states in the evolution of this pathway and that the pattern found in Moritella originates from an ancestor common to Vibrionaceae and Enterobacteriaceae.

View larger version (23K): [in this window] [in a new window]   FIG. 5.   Schematic representation of phylogenetic relationships and patterns of arg genes clustering among Vibrionaceae (Vibrio, Moritella, and Shewanella) and various Enterobacteriaceae. The dendrogram is based on the data reported by Ahmad et al. (1) (a synthetic diagram integrating 16S RNA data and biochemical character states from the aromatic amino acid biosynthetic pathways), by Baumann and Schubert (3), and by Yanagibayashi et al. (57); the numbers refer to the enteroclusters defined in reference 1. *, preliminary observations from ongoing sequencing project (see text).

Preliminary and still-incomplete data obtained from the Institute of Genomics Research (http://www.tigr.org) and also reported in Fig. 5 support this view: in Vibrio cholerae, which appears more closely related to E. coli than Moritella (57), there is a cluster comprising at least the argE, -C, -B, -G, and -H genes. Interestingly, for Shewanella putrefaciens, which is closely related to Moritella, the same source of information mentions an argCBFGH cluster, with the gene responsible for acetylornithine deacylation remaining as yet undefined.

The observation that the argH gene is extended by a stretch of 173 codons able to complement argA mutants emerges as unprecedented in an already wide variety of organisms comprising Eucarya, Archaea, and Bacteria, among which are several Proteobacteria (E. coli, Haemophilus influenzae, Campylobacter jejuni, and Zymomonas mobilis [http://www.ncbi.nlm.nih.gov]). However, preliminary data from the Institute of Genetic Research (see above) suggest that a similar situation may prevail in V. cholerae and S. putrefaciens as well. The ability of this new gene to compensate for a defect in enzymatic acetylation of glutamate is intriguing from both the functional and evolutionary points of view. It should be noted that the origin of glutamate acetylation is far from clear and that it is not impossible that this metabolic function is accomplished in different organisms by unrelated proteins (7, 44). This novel type of argininosuccinase is currently under investigation.

Enterobacterial AOase is thus not anymore an isolated singularity among organisms of the  group of the class Proteobacteria. The other bacteria screened by genomic analysis and/or analyzed at the enzymatic level belong to 6 of the 11 major subdivisions of their domain, not counting the chlamydiae (Table 3). They all produce an OATase except M. xanthus, a -group proteobacterium (19). Putative OATase genes were also reported for several archaea (6, 27, 47). It therefore appears likely that the last common ancestor of the three domains relied on an OATase rather than an AOase.

Is it possible to infer from available data how ornithine synthesis and the organization of the arginine regulon have evolved among Proteobacteria and in other branches of the Bacteria? As regards ornithine synthesis among -3 Proteobacteria, the evidence thus distinguishes Vibrionaceae and enteric bacteria (with an AOase) from P. aeruginosa and closely related species, which have an OATase. On the 16S RNA phylogenetic tree (38), P. aeruginosa branches off at a lower level than H. influenzae (which has no pathway for de novo ornithine synthesis), Vibrio parahaemolyticus, Proteus vulgaris, Erwinia carotovora, and E. coli. OATase may thus have been lost in an organism located near the bifurcation between P. aeruginosa and the branch containing the latter organisms; ornithine synthesis would have been maintained by recruiting (22) internally or acquiring horizontally a deacylase able to split off the acetyl group of N-acetylornithine. AOase itself acts on a variety of N-acetylated compounds (53) and is homologous to other deacylases (4). Since - and -group Proteobacteria appear to have diverged relatively late (38), the presence of an OATase in Neisseria gonorrhoeae (belonging to the  group) suggests that it was maintained in Proteobacteria from their origin as far as the splitting between the  and  groups. The  branch is not yet documented, and among the earlier-branching  and  branches the only case known is M. xanthus, which uses an AOase (19); this suggests that the bacterial ancestral OATase gene was lost in this branch as well, much earlier than in the  group. Further analysis of various Proteobacteria could disclose the exact path followed by the evolution of ornithine synthesis. In particular, it would be interesting to characterize arginine genes in Leucothrix mucor. Indeed, both Vibrionaceae and enteric bacteria possess a class B aspartate carbamoyltransferase, i.e., a dodecameric enzyme constituted by six catalytic and six regulatory subunits, which was detected in Vibrio natriegens (26) and in the two strains analyzed in this work (56). By contrast, fluorescent pseudomonads and Acinetobacter calcoaceticus have a class A ATCase, which has a quite different architecture. As pointed out by Kenny et al. (26), L. mucor may be located near the bifurcation dividing species possessing class A and class B ATCases within the  group.

Regarding the organization of the arginine regulon in Proteobacteria, we observe on the one hand complete scattering in the fluorescent pseudomonads and Neisseria (from the -3 and  groups, respectively) (17, 31, 40) and on the other hand the argECBFGH, ECBGH, and ECBH gene patterns found in Vibrionaceae and Enterobacteriaceae, both from the -3 group. In the latter organisms the very presence of an AOase is correlated with integration of argE in a unit of divergent transcription. In M. xanthus, however, argE is located between two unrelated genes (19). In other branches of the bacterial domain we observe other interrelated modes of clustering, such as argCJ in Thermus (2), argCJBD or argCJBDF in several gram-positive organisms (5) (Table 3), and argGHCJBD in Thermotoga maritima (35) and Thermotoga neapolitana (V. Sakanyan, personal communication), which both belong to a primeval line of descent on the 16S RNA tree (38). However, in Aquifex (11), another ancient branch by the 16S RNA criterion, and in Synechocystis (25), a cyanobacterium, the arginine genes are scattered. It thus seems that extensive reorganization of arg genes has accompanied the emergence of major subdivisions of the Bacteria, and, within the Proteobacteria themselves, of their main ramifications. Within the  group, one important event was the recruitment of the ancestor of AOase. As regards the mechanism controlling the expression of arginine genes, another major event occurred in the branch leading to P. aeruginosa; indeed, this organism uses an argR gene which is not homologous to its functional equivalent in Enterobacteriaceae, gram-positive bacteria, and Moritella (15, 30, 37, 39; also this paper). This may be related to the integration of arginine biosynthesis in the complex nitrogen metabolism of this organism.

In keeping with the strict psychrophily of both Moritella strains, AOase and OTCase present clear-cut cold-adapted temperature activity profiles, with relatively high activities at 0°C. With respect to other cold-active enzymes, many of which were characterized from psychrotolerant rather than strictly psychrophilic hosts (13, 16), the OTCase from Moritella strain 2693 has a comparatively low apparent temperature optimum (17°C). It will therefore be interesting to compare this enzyme with its mesophilic and thermophilic homologues (52). The disclosure of an arginine repressor from a strict psychrophile also calls for structural comparisons between this protein and its homologues operating in the mesophilic and thermophilic ranges (36).