Previous Article | Next Article 
Journal of Bacteriology, March 2000, p. 1739-1747, Vol. 182, No. 6
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
CTX
Infection of Vibrio cholerae Requires the
tolQRA Gene Products
Andrew J.
Heilpern1 and
Matthew K.
Waldor1,2,*
Graduate Program in
Immunology1 and Division of Geographic
Medicine/Infectious Disease,2 Tufts
University School of Medicine, Boston, Massachusetts 02111
Received 4 October 1999/Accepted 21 December 1999
 |
ABSTRACT |
CTX
is a lysogenic filamentous bacteriophage that encodes
cholera toxin. Filamentous phages that infect Escherichia
coli require both a pilus and the products of tolQRA
in order to enter host cells. We have previously shown that
toxin-coregulated pilus (TCP), a type IV pilus that is an essential
Vibrio cholerae intestinal colonization factor, serves as a
receptor for CTX
. To test whether CTX
also depends upon
tol gene products to infect V. cholerae, we
identified and inactivated the V. cholerae tolQRAB
orthologues. The predicted amino acid sequences of V. cholerae TolQ, TolR, TolA, and TolB showed significant similarity
to the corresponding E. coli sequences. V. cholerae strains with insertion mutations in tolQ,
tolR, or tolA were reduced in their efficiency
of CTX
uptake by 4 orders of magnitude, whereas a strain with an
insertion mutation in tolB showed no reduction in CTX
entry. We could detect CTX
infection of TCP
V. cholerae, albeit at very low frequencies. However, strains with
mutations in both tcpA and either tolQ,
tolR, or tolA were completely resistant to
CTX
infection. Thus, CTX
, like the E. coli
filamentous phages, uses both a pilus and TolQRA to enter its host.
This suggests that the pathway for filamentous phage entry into cells
is conserved between host bacterial species.
 |
INTRODUCTION |
Vibrio cholerae is a
gram-negative bacterium that causes cholera, a severe and sometimes
lethal diarrheal disease. Humans become infected with V. cholerae after ingesting food or water that has been contaminated
with the pathogen. V. cholerae is capable of colonizing and
multiplying within the small intestine. This colonization requires
production of a bundle-forming pilus, called toxin-coregulated pilus
(TCP) (34). In addition to TCP, other virulence factors are
expressed once the pathogen reaches the small intestine. One of these
virulence factors is cholera toxin, a potent protein exotoxin that
elicits a secretory response from intestinal epithelial cells. This
response is the principle basis for the secretory diarrhea that is the
hallmark of cholera (30).
Cholera toxin is an A-B-type toxin encoded by the ctxAB
operon. This operon is part of the genome of CTX
, a 7-kb lysogenic filamentous bacteriophage (37). Lysogenic conversion of
nontoxigenic strains to toxigenicity by CTX
infection appears to be
a critical step in the evolution of fully pathogenic V. cholerae. The CTX
genome is subdivided into two regions: a
4.6-kb core region that includes ctxAB and a 2.4-kb region
designated RS2 (38). The organization of the core-encoded
genes and the deduced amino acid sequences of their products (with the
exception of ctxAB) resemble those of filamentous phages
derived from a variety of bacterial species. These similarities, along
with experimental evidence, suggests that the CTX
core genes encode
proteins required for virion morphogenesis. The CTX
core gene
products include Cep, which is thought to be the virion major coat
protein, and Psh, OrfU, and Ace, which are thought to be minor coat
proteins. The core-encoded Zot protein is similar to protein pI of
coliphage M13 (15) and is required for virion assembly and
secretion but is not part of the phage particle. Although lacking
similarity to any Escherichia coli filamentous phage DNA
sequences, our data indicate that the RS2 region of the CTX
genome
encodes the genes and noncoding sequences required for phage
replication, integration, and transcriptional repression (14,
38).
The molecular steps involved in infection of E. coli by F
pilus-specific filamentous phages (the Ff phages) such as f1 and M13
have been well characterized. The process begins when a domain of a
minor coat protein (pIII) located on one end of the phage particle
binds to the tip of the conjugative F pilus of E. coli (13). This interaction between pIII and F is thought to
result in pilus retraction, which draws the phage through the
bacterium's outer membrane. Subsequent phage translocation through the
periplasmic space requires the tolQRA gene products
(32, 33). Recent studies indicate that the periplasmic
part of TolA binds to pIII and thereby serves as a coreceptor for phage
entry into the bacterium (26). TolQ and TolR appear to
interact with TolA via their inner membrane domains (8, 19),
although their exact function in filamentous phage uptake remains
unknown. Ff phage can infect E. coli lacking the F pilus,
albeit at much lower frequencies than infection of F+ cells
(29). Following translocation of the phage through the periplasm via the TolQRA complex, the phage major capsid protein, pVIII, inserts into the inner membrane (4) and the
single-stranded phage genome enters the cytoplasm and begins a new
cycle of phage replication and infection.
The physiological role of the tolQRAB gene products remains
uncertain. The tolQRA gene products of E. coli
are thought to contribute to maintaining the integrity of the outer
bacterial membrane. Disruption of these tol genes enhances
the sensitivity of the bacteria to certain antibiotics and detergents
and leads to leakage of periplasmic proteins into the extracellular
surroundings (17, 18, 39). Mutations also prevent transfer
of certain colicins into the cell (16). Disruption of a
fourth tol gene, tolB, located immediately 3' of
tolQRA, generates cells with comparable membrane
deficiencies; however, mutation of this tol gene has no
detectable effect upon Ff phage uptake (32).
For filamentous phages that infect hosts other than E. coli,
little is known concerning the molecular aspects of phage entry. We
previously found that V. cholerae cells harboring deletions or particular amino acid substitutions in tcpA, which
encodes the major subunit of TCP, are resistant to CTX
infection.
This finding suggested that this type IV pilus serves as a receptor for
CTX
(37). The CTX
ligand that binds TCP has been
hypothesized to be the core-encoded protein OrfU, based both upon the
size and relative position of this gene within the CTX
genome
(37). Although OrfU does not have significant sequence
similarity to Ff pIII, Holliger and Riechmann have predicted that the
N-terminal portion of OrfU has structural similarity to the domain of
pIII that interacts with E. coli TolA (11).
In the current study, we investigated whether orthologues of the
E. coli tolQRAB genes are encoded in the V. cholerae genome and whether the products of these genes are
required for CTX
infection. We found that the V. cholerae
genome contains four contiguous open reading frames (ORFs)
predicted to encode proteins similar to E. coli
TolQRAB and that disruption of the V. cholerae tolQRA
genes severely reduces the efficiency of V. cholerae
CTX
uptake. Further supporting the importance of V. cholerae
tolQRA in CTX
uptake, we found that TCP
strains
of V. cholerae can be infected by CTX
, albeit at greatly reduced frequencies, and that TolQRA are absolutely required for phage
entry into TCP
cells.
 |
MATERIALS AND METHODS |
Strains, media, and antibiotics.
The bacterial strains used
in this study are listed in Table 1.
Bacteria were grown in Luria-Bertani (LB) broth (2) at 37°C. To induce TCP expression and the concomitant autoagglutination of classical V. cholerae strain O395, bacteria were cultured
on a roller drum shaker at 30°C overnight as previously described (34). Antibiotics were used at the following concentrations: ampicillin, 50 µg/ml (V. cholerae) and 100 µg/ml
(E. coli); streptomycin, 200 µg/ml; kanamycin, 50 µg/ml;
chloramphenicol, 15 µg/ml (E. coli) and 1 µg/ml
(V. cholerae); spectinomycin, 50 µg/ml; and rifampicin, 40 µg/ml. Arabinose (Ara) (0.02%) was added to LB broth to induce
expression of genes under the control of the E. coli
promoter, pBAD (9).
Construction of O395 tolQRAB mutant strains.
Homologous recombination of suicide vectors containing internal
fragments of tolQ, tolR, tolA, and
tolB into their respective chromosomal genes was used to
inactivate each of these genes in the V. cholerae O395
background. These gene fragments were amplified from O395 genomic DNA
by PCR. The sequences of the primers used to amplify these internal
tol gene fragments relative to the predicted start codon of
each of these genes are shown in Table 2.
These PCR products were subsequently cloned into the TA cloning vector pCRII-TOPO vector (Invitrogen, Carlsbad, Calif.) according to the
manufacturer's protocol. An EcoRI fragment of each of the resulting plasmids which contained the cloned PCR product was then
ligated to EcoRI-digested pGP704, a suicide vector encoding Apr which requires the product of the pir gene
for replication (23). The resulting plasmids, pDH235,
pDH107, pDH149, and pDH270 (Table 1), were subsequently introduced into
E. coli Sm10
pir and then mobilized into
V. cholerae O395 and TCP2. Transconjugants (Smr
and Apr colonies) were selected, and disruption of each
tol gene in all of the resulting strains was confirmed by
Southern analyses (data not shown).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Sequences of the PCR primers used to generate the
internal fragments for insertional mutations of V. cholerae tolQRAB
|
|
Construction of tolQRA-complementing plasmids.
The full-length tolQ gene was amplified by PCR with the
forward primer tolQ-1 (5' CCGAGAGCTTTGCCTCAGTTAATC 3')
located 43 bp upstream of the predicted start codon of
tolQ and the reverse primer tolQ-2 (5'
TTTGGTTTGATAGCCAGCC 3') ending 26 bp downstream of the predicted
stop codon of tolQ. The PCR product was then cloned into the
pCRII-TOPO vector. Following subcloning into pBluescript SK(
)
(Stratagene, La Jolla, Calif.), a SacI/KpnI
fragment containing the insert was ligated into
SacI/KpnI-digested pBAD33 (9), resulting in pDH8.
The
tolQR genes were amplified by PCR with the forward
primer tolQ-1
Kpn (the tolQ-1 forward primer sequence with a
KpnI restriction
site at the 5' end) and the reverse primer
tolR-2
Xba (5' TCTAGAATTTAAGGTCCGTGAGTAGCCCTAC
3')
which ends 2 bp downstream from the predicted stop codon of
tolR and includes an
XbaI site added to the 5'
end. The PCR product
was first cloned into the pCRII-TOPO vector, and
then a
KpnI/
XbaI
fragment containing the insert
was ligated into
KpnI/
XbaI-digested
pBAD33 to
yield
pDH9.
The
tolR gene was amplified by PCR using the forward primer
tolR-1 (5' AGTTTCATACCATTCTCCACCGTC 3') located 69 bp
upstream
of the predicted start codon of
tolR and the
reverse primer tolR-2,
which has the same sequence and location as
tolR-2
Xba but lacks
the
XbaI site. The PCR
product was subsequently cloned into the
pCRII-TOPO vector, and then a
HindIII/
XbaI fragment containing
the insert
was ligated into
HindIII/
XbaI-digested
pBad33, resulting
in
pDH10.
The
tolA gene was amplified using the forward primer tolA-1
(5' TCCTAAAGTAGGGCTACTCACGGAC3') located 51 bp upstream of
the
predicted start codon of
tolA and the reverse primer
tolA-2 (5'
ACTAGCTCCAATGCCGCATTC 3') ending 97 bp downstream
of the
tolA predicted stop codon. Following cloning of the
PCR product into
the pCRII-TOPO vector and then subcloning into
pBluescript SK(

),
a
PstI/
SalI fragment
containing the insert was ligated into
PstI/
SalI-digested
pBAD33, resulting in
pDH11.
Assays of efficiency of CTX
infection.
To compare the
efficiency of CTX
infection of different mutant strains, both a
previously described supernatant-based transduction assay
(37) and a new coculture transduction assay were used. In
the supernatant-based transduction assay, filtered supernatants from a
strain harboring the kanamycin-marked CTX
replicative form, pCTX-Kn,
were mixed with different recipients. Seventy-five microliters of
recipient cells, which were autoagglutinated after overnight growth at
30°C, was vortexed and mixed with 75 µl of the cell supernatants
containing CTX-Kn
particles. The phage and recipient cells were
gently mixed for 20 min at room temperature on a shaker. Then, each
mixture was plated on LB agar containing streptomycin (for O395) or
streptomycin and ampicillin (for the tol mutants) to
enumerate the potential recipients and on LB agar containing Kn (for
O395) or kanamycin and ampicillin (for the tol mutants) to
enumerate the transductants. The frequency of infection was determined
by dividing the number of transductants (Knr or
Knr Apr CFU) by the number of recipients
(Smr or Smr Apr CFU).
In the coculture transduction assay, RV508, a Spec
r
Rif
r derivative of 569B (
37) harboring pCTX-Kn,
was streaked on LB agar
plates along with Sm
r potential
recipient strains. After incubating at 30°C for 4.5
h, the cells
were recovered from the plates in 3 ml of LB broth.
The number of
potential recipient cells was determined by counting
the number of
Sm
r CFU (the donor strain RV508 is Sm
s), and
the number of transductants was determined by enumerating
the
Sm
r Kn
r CFU (for O395) or Sm
r
Ap
r Kn
r CFU (for the
tol mutants).
Again, the frequency of infection
was determined by dividing the number
of transductants by the
number of potential
recipients.
Characterization of other phenotypes of the tolQRAB
mutants.
Immunoblot analysis of whole-cell lysates with
polyclonal
-TcpA antiserum was carried out as previously described
(23). For determination of the growth kinetics of the mutant
strains, equivalent dilutions (based on optical density [OD] readings
at 600 nm) of overnight LB broth cultures containing the
appropriate antibiotics were used as the inocula for cultures. Aliquots
were removed from these cultures at 30-min intervals for
OD600 determination. At hourly intervals, these aliquots
were also plated on LB agar with the appropriate antibiotics to
enumerate the number of CFU.
The sensitivity of the
tol mutants to deoxycholate (Sigma,
St. Louis, Mo.) was assayed by growing the bacteria in LB broth
plus
the appropriate antibiotics, containing a range of deoxycholate
concentrations from 0.025 to 12.4%. After approximately 14-h growth
at
37°C, the turbidity of cultures was assayed visually, and cultures
without apparent turbidity were scored as sensitive to deoxycholate.
The starting inocula for these determinations were mid-log-phase
cultures (OD
600 of 0.5) of each strain
tested.
RNase I leakage from the periplasm was assessed by plating bacteria
on LB plates containing 1.0% (wt/vol) type VI RNA from
Torula yeast
(Sigma) as described by Lazzaroni and Portalier (
18).
After
overnight growth, 0.5 N HCl was added to each plate to precipitate
the
RNA. Leakage of RNase I was detected by the appearance of
a halo
surrounding individual colonies after the addition of HCl.
Leakage of

-lactamase was determined as follows. Supernatants
of overnight
cultures were assayed for

-lactamase activity by
measuring the color
change of nitrocefin (50 µg) (Calbiochem,
San Diego, Calif.) per ml,
a chromogenic substrate of

-lactamase
which turns from yellow (390 nm) to red (486 nm) in the presence
of

-lactamase; cleavage of
substrate was monitored by a change
in absorbance at 486 nm.

-Lactamase activity was measured in
both the supernatant and
periplasmic extracts of these cells.
Periplasmic extracts were
prepared by treating cells with NaCl,
sucrose, and lysozyme to disrupt
the outer membrane (
7). The
percentage of

-lactamase
activity in the supernatant compared
to cell associated

-lactamase
activity was then
calculated.
Molecular biology methods.
Standard molecular biology
methods were used in this study (2). Restriction enzymes and
ligase were purchased from New England Biolabs (Beverly, Mass.)
Southern hybridization was carried out with the ECL direct nucleic acid
labelling and detection system (Amersham Pharmacia, Buckinghamshire,
England) according to the manufacturer's instructions. The DNA probes
for these blots were the internal fragments of the tol genes
that were used for targeted disruption of these genes as described
above. DNA sequencing was performed by dye terminator cycle sequencing
with an Applied Biosystems 373A DNA sequencer at the Tufts Core
Facility. The MacVector software package (Oxford Molecular Group) was
used to assemble the tolQRAB sequence, and the BLAST
programs (1) were used for comparing this sequence to the
GenBank database. The hydrophobicity of TolQRAB was calculated with the
Kyte-Doolittle algorithm in MacVector. The protein localization program
P-sort (25) was used to assess protein localization.
 |
RESULTS |
The V. cholerae tolQRAB DNA sequence.
Extrapolating from the model of filamentous phage entry into E. coli, we asked whether the tolQRAB gene cluster could
be identified in the V. cholerae genome and if these gene
products, TolQRA in particular, were necessary for entry of CTX
into
V. cholerae. To address the first question, the amino acid
sequence of each of the E. coli TolQRAB proteins was used to
query the partial V. cholerae genome being sequenced by The
Institute for Genomic Research (TIGR) for potential V. cholerae tol orthologues. Of the four E. coli
sequences, E. coli TolR yielded the most significant similarity (E value, 2e-08) using the BLAST X algorithm (1). No clones overlapped with the relevant contig GVCCN44F at that time;
consequently, we used inverse PCR to clone the adjacent sequences from
classical V. cholerae strain O395, which we speculated might
encode V. cholerae tolQ and tolAB. After several
iterations of inverse PCR and DNA sequencing, a sequence spanning 4 kb
and containing four ORFs which were similar to E. coli
TolQRAB was generated. Our sequence of the O395 tolQRAB
cluster has been deposited in GenBank with accession number AF187269.
This sequence is virtually identical to the El Tor strain N16961
tolQRAB sequence determined by TIGR (http://www.tigr.org).
Using the complete
V. cholerae genome sequence recently
released by TIGR, we found that the genes neighboring the
tolQRAB gene cluster in
V. cholerae are similar
to those in
E. coli. In
both species, the cluster includes
the
orf1,
tolQ,
tolR,
tolA,
tolB, and
pal genes (
36), and the
predicted
V. cholerae TolQRAB
sequences bear significant
similarity to the
E. coli sequences
(Fig.
1). The proteins encoded by the
V. cholerae tol genes also
appear to resemble the
E. coli
proteins in secondary structure.
For example, the Kyte-Doolittle
hydrophobicity profiles of
V. cholerae and
E. coli TolQRAB predict that
V. cholerae TolQ, TolR,
and
TolA, like the
E. coli proteins, contain 3, 1, and 1 transmembrane
domains, respectively (
20,
21,
24,
35). The
extended

-helical
region with repeats of Lys, Ala, and Glu/Asp found
in
E. coli TolA (
20) also appears to be present
in
V. cholerae TolA, based
on an analysis of secondary
structure performed with MacVector.
Finally, the protein localization
program P-sort (
25) predicts
that
V. cholerae
TolB, like
E. coli TolB (
12), is predominantly
periplasmic. These structural similarities suggest that
V. cholerae TolQRAB may perform functions similar to those of
E. coli TolQRAB.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
The organization of the tol gene clusters in
V. cholerae and E. coli is identical. The
predicted lengths of the V. cholerae Tol proteins were
derived from an ORF map of the V. cholerae DNA sequence with
MacVector. Percent identity and similarity were determined by comparing
the predicted amino acid sequences of V. cholerae and
E. coli Tol proteins with MacVector. The solid lines flanked
by vertical bars represent the positions of the fragments of each
tol gene that were used to construct the insertion
mutations. The solid lines flanked by arrows represent the sequences
cloned into pBAD33 used for the complementation studies.
|
|
Role of tolQRAB in CTX
infection.
To test the
role of TolQRAB in CTX
infection, insertion mutations in each of
these genes were generated within the classical biotype V. cholerae strain O395. We found that the strains harboring the
tolQ, tolR, and tolB mutations grew
heterogeneously on agar plates, forming either large or small colonies.
The large colonies reproducibly restreaked only as large colonies,
whereas the smaller colonies upon restreaking gave rise to a
heterogeneous population of large and small colonies. DH3, which
contains the tolA mutation, only grew as large colonies.
These large colonies were confirmed by Southern analysis to have the
correct integration. We suspect that a spontaneous, secondary mutation
that enhances growth has arisen in the large colonies of all four of
the strains harboring tol gene mutations. Because of the
stability of the large colonies, we chose to use these homogenous
populations for the studies of CTX
infection described below.
The ability of CTX

to infect each of these four mutant O395
derivatives was tested. Since CTX

infection of
V. cholerae does
not result in plaque formation, a transduction assay
was initially
used. In this assay, cell-free culture supernatants
containing
a kanamycin-marked CTX

(CTX-Kn

) were used to transduce
recipient
strains to kanamycin resistance (Kn
r). We found
that the O395 derivatives containing
tolQ,
tolR,
and
tolA mutations were dramatically less susceptible to
CTX

infection
than O395 (Table
3).
More specifically, the
tolA mutant strain
could not be
infected with this assay, and the
tolQ and
tolR
mutants
were approximately 4 orders of magnitude less efficient at
CTX
uptake than wild-type O395. In contrast, the
tolB
mutation did
not confer resistance to CTX

infection. All four mutant
strains
showed fewer CFU after overnight culture than the wild-type
strain
(Table
3, column 3); however, this growth difference is unlikely
to account for the resistance of the
tolQRA mutant strains
to
CTX

infection, since the growth defect of the
tolB
mutant did
not inhibit phage infection. Overall, these results suggest
that
V. cholerae TolQRA proteins are important for uptake of
CTX

,
whereas TolB does not play an essential role in this process.
Complementation studies were performed to verify that the resistance of
the
tolQ,
tolR, and
tolA mutant
strains to CTX

infection
was due to the disruption of the targeted
tol gene and not to
polar effects or to spontaneous mutation
in another gene. Plasmids
containing each of the
tol genes
under the control of an Ara-inducible
promoter, pBAD (
9),
were introduced into the corresponding
mutant strain. Either in the
presence or absence of inducer, DH1(pDH8),
the
tolQ mutant
strain harboring the plasmid expressing
tolQ,
remained
resistant to CTX

infection (Table
4).
This suggested
the possibility of a secondary mutation, or more likely,
that
the
tolQ mutation in DH1 disrupted the expression of
the downstream
gene,
tolR. To address this latter
possibility, a plasmid containing
both
tolQ and
tolR, pDH9, was introduced into the
tolQ mutant
strain. This plasmid rendered this strain nearly as susceptible
to
CTX

infection as the wild-type strain (Table
4). We conclude
that
the
tolQ mutation in DH1 eliminates expression of TolR and
that TolR is required for CTX

infection. To discern whether
tolQ is also required in this process, a plasmid encoding a
functional
TolR, pDH10 (see below), was introduced into the
tolQ mutant.
Even in the presence of Ara, no complementation
was seen (Table
4). Thus,
tolQ, like
tolR, is
necessary for the efficient uptake
of CTX

. Although supplying a
functional TolR in
trans did not
complement the
tolQ mutation, it was sufficient to complement
the mutation
in
tolR in DH2 (Table
4). Similarly, expression
of TolA
rendered the
tolA mutant strain, DH3, susceptible to CTX
(Table
4). The results of these complementation studies confirm
that
TolQ, TolR, and TolA are required for infection of
V. cholerae by CTX

and that the spontaneous, secondary mutations
which allowed
these
tol mutant strains to grow as large
colonies on LB agar
plates were not responsible for these strains'
resistance to CTX
infection.
Requirement for tolQRA in CTX
infection of
TCP
V. cholerae.
E. coli lacking the F
pilus can be infected by Ff phage, although at greatly reduced
frequencies than F+ E. coli. F-independent
infection of E. coli by Ff phage is dependent on the
E. coli tolQRA gene products (29). With our
standard liquid suspension CTX
transduction assay, which relies upon
cell-free filtered supernatants containing a marked CTX
to transduce
recipient cells, we have not been able to detect transductants of
TCP
V. cholerae recipients (37).
However, we found that we could circumvent the requirement for TCP in
CTX
infection if a CTX
producing donor strain was grown in close
proximity to a potential recipient strain. When a strain harboring the
CTX-Kn
replicative form was cross-streaked with a TCP
recipient strain, O395 derivative TCP2 (10), we found that CTX-Kn
transfer to the recipient was detectable, albeit
approximately 100,000-fold less frequently than CTX-Kn
transfer to
O395 in this assay (Table 5). Transfer of
the CTX
genome under these conditions still required formation of
functional virions, since mutant forms of CTX-Kn
that are maintained
as plasmids but do not give rise to virions (pMW1 and pMW2
[37]) were not transferred. This result indicates that
CTX
transfer was mediated by CTX
virions rather than by an
alternative route, such as conjugation.
Using this protocol, we found that TCP
+ strains containing
a mutation in any one of the
tolQRA genes could be infected
by CTX
at very low frequencies, similar to those observed for
infection
of the TCP

strain (Table
5). This suggests
that, individually, none of
the
V. cholerae tolQ,
tolR, or
tolA gene products is absolutely
required for CTX

infection. However, mutations in any of these
three
genes in combination with the
tcpA mutation rendered the
recipient strains completely resistant to CTX

infection in this
assay (Table
5). In contrast, as in the liquid-based transduction
assay, a
tolB mutation did not significantly affect the
ability
of the recipient strain to be infected by CTX

. None of the
tol mutations impaired transfer of an RP4-derived conjugal
plasmid
(
5) from
E. coli (data not shown). The
finding that disruption
of the
V. cholerae tol genes did not
reduce the ability of cells
to act as recipients in conjugation is an
additional indication
that transfer of CTX

genes under these assay
conditions is dependent
upon infection of recipients by virions, rather
than an alternative
mechanism of gene transfer. In conclusion, these
experiments demonstrate
that, similar to Ff phage infection of
E. coli, TCP

cells can be infected by CTX

and that
the
tolQRA gene products
are absolutely required for
infection of TCP

cells. However, unlike
E. coli, a single mutation in
V. cholerae tolQ,
tolR, or
tolA does not render these cells
completely resistant
to CTX
infection.
Other properties of V. cholerae strains with
tolQ, tolR, tolA, and
tolB mutations.
A potential explanation for the
inefficiency of CTX
entry in V. cholerae strains with
tolQ, tolR, and tolA mutations is that these strains do not express TCP. This possibility is unlikely because
DH1, DH2, and DH3, and DH4 cells autoagglutinated after overnight
growth at 30°C, a property dependent on TCP production. To further
confirm that these V. cholerae tol mutant strains synthesize TCP, immunoblot assays were carried out. As shown in Fig.
2, all four of the tol mutant
strains expressed approximately wild-type amounts of a 20.5-kDa
polypeptide that stained with
-TcpA antiserum. This is comparable to
E. coli, where tol mutations have been shown not
to interfere with production of F pili (32).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
V. cholerae tolQRAB mutants (DH1, DH2, DH3,
and DH4) produce amounts of TcpA similar to those produced by O395. All
strains are derivatives of O395. The DH1 revertant was made by growing
a small colony of DH1 in LB broth overnight at 37°C in the absence of
ampicillin. The excision of pDH235 from tolQ in this
revertant strain was confirmed by Southern analysis. All strains were
grown in LB broth at 30°C. Whole-cell lysates were prepared in sample
buffer as previously described (23) and run on an 4 to 12%
Tris-Bis gradient gel (Novex, San Diego, Calif.). The proteins were
then transferred to nitrocellulose and probed with anti-TcpA polyclonal
antiserum.
|
|
In our studies of the requirement of the
tolQRAB gene
products in CTX

infection, we noted that there were reproducibly
fewer
viable cells in overnight cultures of
tol mutant
strains than
in O395 (Table
3). Further studies were carried out to
characterize
the growth properties of the
V. cholerae tol
mutant strains. The
change of the OD
600 over time of the
O395 derivatives with either
tolQ,
tolR,
tolA, or
tolB mutations during growth in LB broth
did not dramatically differ from O395 (Fig.
3A). However, when
these cultures were
plated on LB agar to determine the number
of CFU, there were far fewer
colonies in the
tol mutant strains
(Fig.
3B). This
discrepancy between the OD
600 and the recovery
of colonies
on LB agar plates was most noticeable during the initial
lag phase of
growth. This reduced plating efficiency may be explained
at least in
part by the fact that all four
V. cholerae tol mutants
formed extensive filaments during growth (Fig.
4). This phenotype
was most notable
during the lag phase of growth. None of the
tol-complementing
plasmids, with the exception of the
tolR-encoding plasmid pDH10,
completely eliminated
filamentation of the
tol mutant strains.
Since direct
interactions between TolQRA have been demonstrated
in
E. coli (
8,
19), our failure to fully complement the
growth
defect in the
tol mutants may reflect our inability
to restore
the correct stoichiometry of the TolQRA proteins in these
strains.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics of growth of O395 and O395-derived
tol mutant strains. All strains were grown in LB broth with
the appropriate antibiotics at 37°C and their OD600 (A)
and CFU (B) were determined over time.
|
|

View larger version (90K):
[in this window]
[in a new window]
|
FIG. 4.
Filamentous morphology of V. cholerae tol
mutant strain DH4 (A) compared with O395 (B). O395 derivatives with
insertions in tolQ, tolR, and tolA
also exhibited filamentation.
|
|
In addition to their inability to facilitate entry of filamentous
phages,
E. coli tol mutants exhibit reduced stability of
their outer membranes, resulting in leakage of periplasmic proteins
into the extracellular environment (
39). In
E. coli, this leakiness
has been assessed by assays for the
extracellular presence of
periplasmic proteins, such as

-lactamase and RNase I, and by
increased sensitivity to detergents
like deoxycholate. The parental
strain O395 and its
tolQRAB
derivates (DH1, DH2, DH3, and DH4)
were tested for similar phenotypes.
Two
E. coli control strains,
MG1655 (wild-type
E. coli K-12) and TPS66 (
32) (an
E. coli strain
harboring a missense mutation in
tolQ), were also analyzed.
As
reported for
E. coli, we saw significant leakage of

-lactamase
(about 30% of the total) into the culture supernatants
from
V. cholerae tol mutants. However, unlike wild-type
strains of
E. coli containing pBR322 (a plasmid encoding the

-lactamase gene),
which have very low levels of

-lactamase (about
1.5%) in supernatants
(
40),
V. cholerae O395,
harboring the
bla-containing plasmid
pCRII, had significant
amounts of

-lactamase (about 15 to 20%
of the total) present in
culture supernatants. Thus, the effect
of the
tol mutations
in leakage of

-lactamase in
V. cholerae was difficult to
ascertain. To ensure that the

-lactamase detected
in the
supernatants of O395 and DH1-4 was not due to cell lysis,
we also
assayed the supernatants for the presence of the cytoplasmic
enzyme,

-galactosidase (

-Gal). We found that

-Gal activity
in the
supernatants of these strains was less than 5% of total

-Gal
activity. A similar low percentage of

-Gal activity in
supernatants
of MG1655 and TPS66 was also
measured.
A similar difficulty was encountered when the leakage of RNase I was
assayed. Both TPS66 and the four
V. cholerae tol mutants
(DH1 to DH4) exhibited a halo around colonies indicative of leakage
of
RNase I. While the wild-type
E. coli strain showed no such
halo, O395 did, although the size of its halo was slightly smaller
than
those around the colonies of DH1 to DH4. Thus, the O395 derivatives
with
tol mutations leaked slightly more RNase I than O395;
however,
due to the significant basal level of leakiness found in O395,
this difference was not as dramatic as that seen between TPS66
and
MG1655.
The sensitivity of DH1, DH2, DH3, DH4, and O395 to deoxycholate was
compared. The
V. cholerae tol mutants showed an increased
sensitivity to deoxycholate as these strains had no growth at
concentrations of deoxycholate eightfold less than the inhibitory
concentration for O395. Thus, as observed in
E. coli
(
39), mutations
in the
V. cholerae tolQRAB genes
increase the sensitivity of these
strains to
deoxycholate.
 |
DISCUSSION |
Our work indicates that there are significant parallels between
the pathways used by CTX
for entry into V. cholerae and
by Ff phage for entry into E. coli. Like Ff phage entry into
F+ E. coli, we found that efficient entry of
CTX
into V. cholerae requires both a pilus, TCP, and the
products of the tolQRA genes but not the product of
tolB. Most likely, in both instances, binding of the phages
to their respective pilus receptors constitutes the initial event in
infection. We found that CTX
, like the coliphages, does not
absolutely require its pilus receptor for uptake into V. cholerae. Therefore, it is reasonable to suggest (as Reichmann and
Holliger proposed for the coliphages [26]) that the
initial binding of CTX
to TCP enables the phage to bind to V. cholerae at a significant distance from the cell surface. Binding
to TCP somehow then directs CTX
to the V. cholerae outer
membrane where it can interact with the TolQRA complex, which
facilitates its traversal of the periplasmic space. In the absence
of TCP, however, occasionally CTX
particles can contact the outer
membrane and interact with the TolQRA complex. This model is supported
by our data that mutations in both tcpA and one of the
tolQRA genes render the target cell resistant to CTX
infection.
The similarity of V. cholerae TolQRA to E. coli
TolQRA, together with the requirement for V. cholerae TolQRA
in CTX
entry into V. cholerae, suggests that elements of
the recently proposed model of Ff phage infection of E. coli
apply to CTX
infection of V. cholerae. Based on
structural and biochemical data, Riechmann and Holliger have proposed
that the requirement for both the F pilus and TolQRA in the entry of Ff
phages into E. coli is based on the dual-binding
specificities of pIII, a minor coat protein located on one end of Ff
phages (26). Domain 2 of pIII (g3p-D2) binds to the F pilus,
and domain 1 (g3p-D1) binds to the carboxyl terminus of TolA
(TolA-III). Binding of g3p-D2 to F is thought to lead to pilus
retraction and to exposure of g3p-D1 for binding to TolA-III. After
g3p-D1 binds to TolA-III, the subsequent steps leading to
internalization of the Ff phage are not known, though g3p may, along
with TolQRA, form a channel in the inner membrane (26).
Given the requirement for V. cholerae TolQRA in CTX
infection and the predicted structural similarity of domain 1 of the CTX
g3p orthologue, OrfU, with domain 1 of g3p (11), it
is reasonable to suggest that this domain of OrfU binds to V. cholerae TolA after OrfU binds to TCP. If the E. coli
model applies, the initial binding of CTX
to TCP (presumably via
OrfU domain 2) results in retraction of TCP and exposes OrfU domain 1 for binding to the C terminus of TolA. TCP retraction has not been
demonstrated experimentally in V. cholerae but is suggested
by our data. A structural prediction of this model is that after CTX
particles bind TCP, OrfU is in sufficient proximity to TolA to enable
these proteins to interact. If this is the case, then two distinct
types of pili, F and TCP, are similarly distributed relative to the TolQ, TolR, and TolA proteins in E. coli and V. cholerae. It remains to be shown whether there is a direct
physical interaction between TolQRA and F in E. coli and
TolQRA and TCP in V. cholerae.
Our demonstration of CTX
infection of TCP
V. cholerae cells may provide an explanation for the origin of
CTX
+ TCP
V. cholerae isolates
that have been reported. In the laboratory, we were able to infect
TCP
CTX
-V. cholerae O1 isolate 468-83 (28) with CTX-Kn
by coculturing it with a CTX
donor
strain. As with TCP2, a laboratory-derived TCP
strain,
the frequency of infection of 468-83 by CTX-Kn
was very low
(approximately 2.6 × 10
9) in this assay. Thus, the
experimental evidence indicates that infection of TCP
strains by CTX
is possible, but it is likely to be a rare event. As
would be expected in light of these results, relatively few CTX
+ TCP
strains have been found among
environmental isolates.
Although the host molecules required for CTX
infection of V. cholerae are similar to molecules required for Ff infection of
E. coli, our data suggest that there are differences in the importance of TolQRA in CTX
infection. Unlike E. coli, a
mutation in any one of the V. cholerae tolQRA genes,
including tolA, did not render the target cell completely
resistant to CTX
. There are a number of potential explanations for
this difference. First, there could be an alternate route for uptake of
CTX
, mediated by different proteins. Since cells with mutations in
both tcpA and one of the tolQ, tolR,
or tolA genes could not be infected with CTX
, this
alternative pathway must be dependent (at least indirectly) on the
expression of TCP. Ongoing studies are aimed at determining if V. cholerae carries other genes that might play a role in uptake of
CTX
. Second, because our mutations in tolQ, tolR, and tolA were plasmid integrations into the
middle of these genes, it is possible that truncated TolQRA proteins
were sufficient to permit the low levels of infection we observed with
these mutations. Finally, it may be that our alternative assay for
transduction, which relied upon coculture of donor and recipients on a
semisolid surface, is more sensitive than the liquid transduction
assays used for E. coli and Ff phages. If so, this could
account for the residual CTX
infection of the V. cholerae
tol mutant strains.
The similarities between the tol gene products of several
gram-negative species, including E. coli (32,
33), Haemophilus influenzae (31),
Pseudomonas putida (27), and Pseudomonas aeruginosa (6), suggest that the structure and function
of the tol gene products, although as yet not completely
defined, is conserved between species. In spite of this similarity,
however, differences exist in the phenotypes exhibited by E. coli, P. aeruginosa, and V. cholerae strains
containing mutations in their tolQRAB genes. In P. aeruginosa, viable strains containing mutations in the
tolQRAB genes could not be obtained, leading to the
suggestion that TolQRAB proteins are essential in this bacteria
(6). Although the tol genes were not essential in
V. cholerae, most mutants grew slowly, giving rise to small
colonies in the absence of presumed secondary mutations. In addition,
we found that our small-colony V. cholerae strains with
mutations in tolQ, tolR, and tolB were not viable at 42°C. In E. coli, TolQRAB proteins have not
been reported to be essential for growth at any temperature. Also, the
defect in efficiency of plating exhibited by V. cholerae
strains with tolQRAB mutations has not been reported in
E. coli, although it has recently been reported that a
mutation in tolA in E. coli impairs septation and
cell division (22). The molecular bases for these
differences in phenotypes are not known.
In E. coli, the transcriptional organization of the
tolQRAB gene complex consists of two operons: orf1
tolQRA, which has a promoter upstream of orf1, and
tolB pal, which has a promoter upstream of tolB
(37). Similar to E. coli, the data from our complementation studies suggest that V. cholerae tolQ and
tolR are transcriptionally linked, as the insertion mutation
in tolQ was polar on tolR and could only be
complemented with the addition of both tolQ and
tolR. Another possibility, demonstrated for E. coli (36), is that translational control of
tolR expression by TolQ exists in V. cholerae.
Since the tolR mutation in DH2 was not polar on
tolA, these results suggest that in V. cholerae there is no linkage of tolQR transcription to
tolA transcription but rather that tolA may have
its own promoter. Another explanation is that the mutation introduced
in tolR by pDH107 integration is only partially polar on
tolA and that the resultant reduced levels of
tolA message are sufficient to enable CTX
infection. Further studies are required to determine the exact transcriptional organization of V. cholerae tolQRAB.
Our finding that the V. cholerae tolQRA products are
required for CTX
uptake suggests a way to improve the biosafety of
live-attenuated (CTX
) V. cholerae vaccine
strains. These strains can be reinfected by CTX
and thereby revert
back to toxigenicity. However, a mutation in either tolQ,
tolR, or tolA in a vaccine strain should render it relatively resistant to CTX
infection. A potential difficulty with this approach is that the pleiotropic effects of these mutations may diminish the strains' capacity to colonize the intestine, a
prerequisite for antigenicity (10). Colonization defects
have been reported in a Salmonella enterica serovar
Typhimurium strain harboring a mutation in tolB
(3). Our preliminary results suggest that the
tolQRA mutations in DH1, DH2, and DH3 significantly
attenuate colonization; however, these results are difficult to
interpret given the plating inefficiency of these strains. Even if the
V. cholerae tol gene products are required for colonization,
it may be possible to isolate specific tolQ,
tolR, or tolA mutations which render the
resulting strains resistant to CTX
infection but which do not
significantly attenuate intestinal colonization. For this approach to
work, the essential functions of TolQRA must be structurally separable
from the activity of these proteins as phage coreceptors.
 |
ACKNOWLEDGMENTS |
We thank N. Golden for construction of the tolR
mutation and A. Kane, B. Davis, B. Hochhut, H. Kimsey, A. Camilli, and
C. Moyer for critical reading of the manuscript. We are grateful to
Robert Webster for sending strain TPS66. We thank A. Kane and the GRASP
Center Intestinal Microbiology Core for preparation of media and M. Berne of the Tufts Core Facility for DNA sequencing.
This work was supported by NIH grant AI 42347. M.K.W. is a Pew Scholar
in the Biomedical Sciences.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Tufts University
School of Medicine, Division of Geographic
Medicine/Infectious Disease, NEMC 041, 750 Washington St., Boston, MA
02111. Phone: (617) 636-7618. Fax: (617) 636-5292. E-mail:
mwaldor{at}lifespan.org.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidmann,
J. A. Smith, and K. Struhl (ed.).
1990.
Current protocols in molecular biology.
Greene Publishing and Wiley-Interscience, New York, N.Y.
|
| 3.
|
Bowe, F.,
C. J. Lipps,
R. M. Tsolis,
E. Groisman,
F. Heffron, and J. G. Kusters.
1998.
At least four percent of the Salmonella typhimurium genome is required for fatal infection of mice.
Infect. Immun.
66:3372-3377[Abstract/Free Full Text].
|
| 4.
|
Click, E. M., and R. E. Webster.
1998.
The TolQRA proteins are required for membrane insertion of the major capsid protein of the filamentous phage f1 during infection.
J. Bacteriol.
180:1723-1728[Abstract/Free Full Text].
|
| 5.
|
Datta, N., and R. W. Hedges.
1972.
Host ranges of R factors.
J. Gen. Microbiol.
70:453-460[Abstract/Free Full Text].
|
| 6.
|
Dennis, J. J.,
E. R. Lafontaine, and P. A. Sokol.
1996.
Identification and characterization of the tolQRA genes of Pseudomonas aeruginosa.
J. Bacteriol.
178:7059-7068[Abstract/Free Full Text].
|
| 7.
|
Gerhardt, P.,
R. G. E. Murray,
W. A. Wood, and N. R. Krieg (ed.).
1994.
Methods for general and molecular bacteriology.
American Society for Microbiology, Washington, D.C.
|
| 8.
|
Germon, P.,
T. Clavel,
A. Vianney,
R. Portalier, and J. C. Lazzaroni.
1998.
Mutational analysis of the Escherichia coli K-12 TolA N-terminal region and characterization of its TolQ-interacting domain by genetic suppression.
J. Bacteriol.
180:6433-6439[Abstract/Free Full Text].
|
| 9.
|
Guzman, L. M.,
D. Belin,
M. J. Carson, and J. Beckwith.
1995.
Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol.
177:4121-4130[Abstract/Free Full Text].
|
| 10.
|
Herrington, D. A.,
R. H. Hall,
G. Losonsky,
J. J. Mekalanos,
R. K. Taylor, and M. M. Levine.
1988.
Toxin, toxin-coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans.
J. Exp. Med.
168:1487-1492[Abstract/Free Full Text].
|
| 11.
|
Holliger, P., and L. Riechmann.
1997.
A conserved infection pathway for filamentous bacteriophages is suggested by the structure of the membrane penetration domain of the minor coat protein g3p from phage fd.
Structure
5:265-275[Medline].
|
| 12.
|
Isnard, M.,
A. Rigal,
J. C. Lazzaroni,
C. Lazdunski, and R. Lloubes.
1994.
Maturation and localization of the TolB protein required for colicin import.
J. Bacteriol.
176:6392-6396[Abstract/Free Full Text].
|
| 13.
|
Jacobson, A.
1972.
Role of F pili in the penetration of bacteriophage f1.
J. Virol.
10:835-843[Abstract/Free Full Text].
|
| 14.
|
Kimsey, H. H., and M. K. Waldor.
1998.
CTX immunity: application in the development of cholera vaccines.
Proc. Natl. Acad. Sci. USA
95:7035-7039[Abstract/Free Full Text].
|
| 15.
|
Koonin, E. V.
1992.
The second cholera toxin, Zot, and its plasmid-encoded and phage-encoded homologues constitute a group of putative ATPases with an altered purine NTP-binding motif.
FEBS Lett.
312:3-6[CrossRef][Medline].
|
| 16.
|
Lazdunski, C. J.
1995.
Colicin import and pore formation: a system for studying protein transport across membranes?
Mol. Microbiol.
16:1059-1066[CrossRef][Medline].
|
| 17.
|
Lazzaroni, J. C.,
N. Fognini-Lefebvre, and R. Portalier.
1989.
Cloning of the excC and excD genes involved in the release of periplasmic proteins by Escherichia coli K12.
Mol. Gen. Genet.
218:460-464[CrossRef][Medline].
|
| 18.
|
Lazzaroni, J. C., and R. C. Portalier.
1981.
Genetic and biochemical characterization of periplasmic-leaky mutants of Escherichia coli K-12.
J. Bacteriol.
145:1351-1358[Abstract/Free Full Text].
|
| 19.
|
Lazzaroni, J. C.,
A. Vianney,
J. L. Popot,
H. Benedetti,
F. Samatey,
C. Lazdunski,
R. Portalier, and V. Geli.
1995.
Transmembrane alpha-helix interactions are required for the functional assembly of the Escherichia coli Tol complex.
J. Mol. Biol.
246:1-7[CrossRef][Medline].
|
| 20.
|
Levengood, S. K.,
W. F. Beyer, Jr., and R. E. Webster.
1991.
TolA: a membrane protein involved in colicin uptake contains an extended helical region.
Proc. Natl. Acad. Sci. USA
88:5939-5943[Abstract/Free Full Text].
|
| 21.
|
Lewin, T. M., and R. E. Webster.
1996.
Membrane insertion characteristics of the various transmembrane domains of the Escherichia coli TolQ protein.
J. Biol. Chem.
271:14143-14149[Abstract/Free Full Text].
|
| 22.
|
Meury, J., and G. Devilliers.
1999.
Impairment of cell division in tolA mutants of Escherichia coli at low and high medium osmolarities.
Biol. Cell
91:67-75[CrossRef][Medline].
|
| 23.
|
Miller, V. L., and J. J. Mekalanos.
1988.
A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR.
J. Bacteriol.
170:2575-2583[Abstract/Free Full Text].
|
| 24.
|
Muller, M. M.,
A. Vianney,
J. C. Lazzaroni,
R. E. Webster, and R. Portalier.
1993.
Membrane topology of the Escherichia coli TolR protein required for cell envelope integrity.
J. Bacteriol.
175:6059-6061[Abstract/Free Full Text].
|
| 25.
|
Nakai, K., and M. Kanehisa.
1991.
Expert system for predicting protein localization sites in gram-negative bacteria.
Proteins
11:95-110[CrossRef][Medline].
|
| 26.
|
Riechmann, L., and P. Holliger.
1997.
The C-terminal domain of TolA is the coreceptor for filamentous phage infection of E. coli.
Cell
90:351-360[CrossRef][Medline].
|
| 27.
|
Rodríguez-Herva, J. J.,
M.-I. Ramos-González, and J. L. Ramos.
1996.
The Pseudomonas putida peptidoglycan-associated outer membrane lipoprotein is involved in maintenance of the integrity of the cell envelope.
J. Bacteriol.
178:1699-1706[Abstract/Free Full Text].
|
| 28.
|
Rubin, E. J.,
W. Lin,
J. J. Mekalanos, and M. K. Waldor.
1998.
Replication and integration of a Vibrio cholerae cryptic plasmid linked to the CTX prophage.
Mol. Microbiol.
28:1247-1254[CrossRef][Medline].
|
| 29.
|
Russel, M.,
H. Whirlow,
T.-P. Sun, and R. E. Webster.
1988.
Low-frequency infection of F bacteria by transducing particles of filamentous bacteriophages.
J. Bacteriol.
170:5312-5316[Abstract/Free Full Text].
|
| 30.
|
Sears, C. L., and J. B. Kaper.
1996.
Enteric bacterial toxins: mechanisms of action and linkage to intestinal secretion.
Microbiol. Rev.
60:167-215[Free Full Text].
|
| 31.
|
Sen, K.,
D. J. Sikkema, and T. F. Murphy.
1996.
Isolation and characterization of the Haemophilus influenzae tolQ, tolR, tolA, and tolB genes.
Gene
178:75-81[CrossRef][Medline].
|
| 32.
|
Sun, T. P., and R. E. Webster.
1986.
fii, a bacterial locus required for filamentous phage infection and its relation to colicin-tolerant tolA and tolB.
J. Bacteriol.
165:107-115[Abstract/Free Full Text].
|
| 33.
|
Sun, T. P., and R. E. Webster.
1987.
Nucleotide sequence of a gene cluster involved in entry of E colicins and single-stranded DNA of infecting filamentous bacteriophages into Escherichia coli.
J. Bacteriol.
169:2667-2674[Abstract/Free Full Text].
|
| 34.
|
Taylor, R. K.,
V. L. Miller,
D. B. Furlong, and J. J. Mekalanos.
1987.
Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin.
Proc. Natl. Acad. Sci. USA
84:2833-2837[Abstract/Free Full Text].
|
| 35.
|
Vianney, A.,
T. M. Lewin,
W. F. Beyer, Jr.,
J. C. Lazzaroni,
R. Portalier, and R. E. Webster.
1994.
Membrane topology and mutational analysis of the TolQ protein of Escherichia coli required for the uptake of macromolecules and cell envelope integrity.
J. Bacteriol.
176:822-829[Abstract/Free Full Text].
|
| 36.
|
Vianney, A.,
M. M. Muller,
T. Clavel,
J. C. Lazzaroni,
R. Portalier, and R. E. Webster.
1996.
Characterization of the tol-pal region of Escherichia coli K-12: translational control of tolR expression by TolQ and identification of a new open reading frame downstream of pal encoding a periplasmic protein.
J. Bacteriol.
178:4031-4038[Abstract/Free Full Text].
|
| 37.
|
Waldor, M. K., and J. J. Mekalanos.
1996.
Lysogenic conversion by a filamentous phage encoding cholera toxin.
Science
27:1910-1914[CrossRef].
|
| 38.
|
Waldor, M. K.,
E. J. Rubin,
G. D. Pearson,
H. Kimsey, and J. J. Mekalanos.
1997.
Regulation, replication, and integration functions of the Vibrio cholerae CTX are encoded by region RS2.
Mol. Microbiol.
24:917-926[CrossRef][Medline].
|
| 39.
|
Webster, R. E.
1991.
The tol gene products and the import of macromolecules into Escherichia coli.
Mol. Microbiol.
5:1005-1011[Medline].
|
| 40.
|
Young, K., and L. L. Silver.
1991.
Leakage of periplasmic enzymes from envA1 strains of Escherichia coli.
J. Bacteriol.
173:3609-3614[Abstract/Free Full Text].
|
Journal of Bacteriology, March 2000, p. 1739-1747, Vol. 182, No. 6
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sikora, A. E., Beyhan, S., Bagdasarian, M., Yildiz, F. H., Sandkvist, M.
(2009). Cell Envelope Perturbation Induces Oxidative Stress and Changes in Iron Homeostasis in Vibrio cholerae. J. Bacteriol.
191: 5398-5408
[Abstract]
[Full Text]
-
Paterson, G. K., Northen, H., Cone, D. B., Willers, C., Peters, S. E., Maskell, D. J.
(2009). Deletion of tolA in Salmonella Typhimurium generates an attenuated strain with vaccine potential. Microbiology
155: 220-228
[Abstract]
[Full Text]
-
Cascales, E., Buchanan, S. K., Duche, D., Kleanthous, C., Lloubes, R., Postle, K., Riley, M., Slatin, S., Cavard, D.
(2007). Colicin Biology. Microbiol. Mol. Biol. Rev.
71: 158-229
[Abstract]
[Full Text]
-
Dubuisson, J.-F., Vianney, A., Hugouvieux-Cotte-Pattat, N., Lazzaroni, J. C.
(2005). Tol-Pal proteins are critical cell envelope components of Erwinia chrysanthemi affecting cell morphology and virulence. Microbiology
151: 3337-3347
[Abstract]
[Full Text]
-
LaRocque, R. C., Harris, J. B., Dziejman, M., Li, X., Khan, A. I., Faruque, A. S. G., Faruque, S. M., Nair, G. B., Ryan, E. T., Qadri, F., Mekalanos, J. J., Calderwood, S. B.
(2005). Transcriptional Profiling of Vibrio cholerae Recovered Directly from Patient Specimens during Early and Late Stages of Human Infection. Infect. Immun.
73: 4488-4493
[Abstract]
[Full Text]
-
Mathur, J., Waldor, M. K.
(2004). The Vibrio cholerae ToxR-Regulated Porin OmpU Confers Resistance to Antimicrobial Peptides. Infect. Immun.
72: 3577-3583
[Abstract]
[Full Text]
-
Campos, J., Martinez, E., Marrero, K., Silva, Y., Rodriguez, B. L., Suzarte, E., Ledon, T., Fando, R.
(2003). Novel Type of Specialized Transduction for CTX{phi} or Its Satellite Phage RS1 Mediated by Filamentous Phage VGJ{phi} in Vibrio cholerae. J. Bacteriol.
185: 7231-7240
[Abstract]
[Full Text]
-
Nikaido, H.
(2003). Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiol. Mol. Biol. Rev.
67: 593-656
[Abstract]
[Full Text]
-
Campos, J., Martinez, E., Suzarte, E., Rodriguez, B. L., Marrero, K., Silva, Y., Ledon, T., del Sol, R., Fando, R.
(2003). VGJ{phi}, a Novel Filamentous Phage of Vibrio cholerae, Integrates into the Same Chromosomal Site as CTX{phi}. J. Bacteriol.
185: 5685-5696
[Abstract]
[Full Text]
-
Heilpern, A. J., Waldor, M. K.
(2003). pIIICTX, a Predicted CTX{phi} Minor Coat Protein, Can Expand the Host Range of Coliphage fd To Include Vibrio cholerae. J. Bacteriol.
185: 1037-1044
[Abstract]
[Full Text]
-
Llamas, M. A., Ramos, J. L., Rodriguez-Herva, J. J.
(2003). Transcriptional Organization of the Pseudomonas putida tol-oprL Genes. J. Bacteriol.
185: 184-195
[Abstract]
[Full Text]
-
Boyd, E. F., Waldor, M. K.
(2002). Evolutionary and functional analyses of variants of the toxin-coregulated pilus protein TcpA from toxigenic Vibrio cholerae non-O1/non-O139 serogroup isolates. Microbiology
148: 1655-1666
[Abstract]
[Full Text]
-
Germon, P., Ray, M.-C., Vianney, A., Lazzaroni, J. C.
(2001). Energy-Dependent Conformational Change in the TolA Protein of Escherichia coli Involves Its N-Terminal Domain, TolQ, and TolR. J. Bacteriol.
183: 4110-4114
[Abstract]
[Full Text]
-
Boyd, E. F., Heilpern, A. J., Waldor, M. K.
(2000). Molecular Analyses of a Putative CTXphi Precursor and Evidence for Independent Acquisition of Distinct CTXphi s by Toxigenic Vibrio cholerae. J. Bacteriol.
182: 5530-5538
[Abstract]
[Full Text]
-
Llamas, M. A., Ramos, J. L., Rodríguez-Herva, J. J.
(2000). Mutations in Each of the tol Genes of Pseudomonas putida Reveal that They Are Critical for Maintenance of Outer Membrane Stability. J. Bacteriol.
182: 4764-4772
[Abstract]
[Full Text]