Previous Article | Next Article ![]()
Journal of Bacteriology, April 2000, p. 1872-1882, Vol. 182, No. 7
Department of Microbiology and Molecular
Genetics, Harvard Medical School, Boston, Massachusetts
021151; Department of Biochemistry and
Molecular Biology, The Albany Medical College, Albany, New York
122082; Department of Biomedical
Sciences, University of South Alabama, Mobile, Alabama
366883; and Department of Biological
Sciences, Purdue University, West Lafayette, Indiana
479074
Received 11 November 1999/Accepted 19 January 2000
HilA activates the expression of Salmonella enterica
serovar Typhimurium invasion genes. To learn more about regulation of hilA, we isolated Tn5 mutants exhibiting
reduced hilA and/or invasion gene expression. In addition
to expected mutations, we identified Tn5 insertions in
pstS, fadD, flhD, flhC,
and fliA. Analysis of the pstS mutant indicates
that hilA and invasion genes are repressed by the response
regulator PhoB in the absence of the Pst high-affinity inorganic
phosphate uptake system. This system is required for negative control
of the PhoR-PhoB two-component regulatory system, suggesting that
hilA expression may be repressed by PhoR-PhoB under low
extracellular inorganic phosphate conditions. FadD is required for
uptake and degradation of long-chain fatty acids, and our analysis of
the fadD mutant indicates that hilA is
regulated by a FadD-dependent, FadR-independent mechanism. Thus, fatty
acid derivatives may act as intracellular signals to regulate
hilA expression. flhDC and fliA
encode transcription factors required for flagellum production,
motility, and chemotaxis. Complementation studies with flhC
and fliA mutants indicate that FliZ, which is encoded in an
operon with fliA, activates expression of hilA, linking regulation of hilA with motility. Finally,
epistasis tests showed that PhoB, FadD, FliZ, SirA, and EnvZ act
independently to regulate hilA expression and invasion. In
summary, our screen has identified several distinct pathways that can
modulate S. enterica serovar Typhimurium's ability to
express hilA and invade host cells. Integration of signals
from these different pathways may help restrict invasion gene
expression during infection.
Salmonella enterica
serovar Typhimurium is a facultative intracellular pathogen that causes
gastroenteritis in humans and a typhoid-like disease in mice. Some
S. enterica serovar Typhimurium virulence factors are
encoded on the 40-kb Salmonella pathogenicity island 1 (SPI1) located at centisome 63 (60). Many SPI1 genes were
first identified for their roles in invasion, a process whereby bacteria induce their own uptake into normally nonphagocytic cells (34). These invasion genes have also been implicated in
other processes that may contribute to S. enterica serovar
Typhimurium virulence, including intestinal colonization (R. A. Murray, unpublished observations), destruction of M cells in Peyer's
patches (49, 66), activation of cytokine expression in
epithelial cells (45), induction of neutrophil migration
across the intestinal epithelium (36, 58), and stimulation
of apoptosis in macrophages (18, 44, 61).
SPI1 invasion genes encode a type III secretory apparatus and several
secreted factors that are translocated by the secretion system directly
into the cytosol of cultured epithelial cells (21, 33, 39)
(Fig. 1). During invasion, the secreted
effectors are thought to interact with eukaryotic proteins to activate
signal transduction pathways, rearrange the actin cytoskeleton, and
cause membrane ruffling and macropinocytosis in the host cell,
ultimately inducing uptake of bacteria (17, 32, 33, 40, 45).
Oxygen, osmolarity, bacterial growth state, and certain mutations
affect Salmonella's ability to invade cultured epithelial
cells (10, 31, 53, 74, 79). Many of these conditions and
mutations also affect expression of invasion genes (9, 65),
suggesting that invasiveness may be modulated by regulating invasion
gene expression. This regulation is thought to be mediated by several transcriptional regulators on SPI1, including InvF and HilA (9, 23, 29).
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Multiple Factors Independently Regulate
hilA and Invasion Gene Expression in Salmonella
enterica Serovar Typhimurium
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
View larger version (12K):
[in a new window]
FIG. 1.
Regulation of SPI1 genes by HilA and InvF. The proposed
functions of SPI1 gene products are as follows: black boxes, secreted
effectors; gray boxes, type III secretory apparatus; dotted boxes,
chaperones involved in type III secretion; diagonally striped boxes,
transcriptional regulators; horizontally striped boxes, iron uptake
system; white boxes, function unknown (73).
, expression
of the SPI1 gene is not affected by a mutation in hilA or
invF; +, expression of the SPI1 gene is severely reduced by
a mutation in hilA or invF (8, 9, 23,
29, 30; this work; S. M. Damrauer, unpublished
observations).
InvF is an AraC-like transcriptional regulator required for expression
of secreted effectors encoded on SPI1 (Fig. 1), SPI5, and SopE
(23, 29). HilA is an OmpR-ToxR family member that appears to
directly activate transcription of SPI1 genes encoding components of
the type III secretory apparatus (8, 9). HilA also appears
to directly activate invF expression, thereby indirectly activating expression of several secreted effectors. Interestingly, two
SPI1 effectors may be directly activated by both HilA and InvF
(23, 29). One effector, sipC, appears to have two
promoters: a HilA-dependent promoter thought to be upstream of
spaS and an InvF-dependent promoter located downstream of
spaS (23). Thus, HilA directly or indirectly
regulates expression of the type III secretion system and its secreted
effectors, and this regulation is thought to be mediated by modulating
hilA expression.
Changes in oxygen tension, osmolarity, and pH alter expression of hilA and SPI1 invasion genes (9), but the sensors and transcription factors involved in this regulation have not yet been identified. A point mutation (pho-24) in the extracellular cation sensor phoQ drastically reduces hilA and invasion gene expression (9, 65). Normally, the PhoQ sensor kinase is activated and phosphorylates its cognate transcriptional regulator, PhoP, when extracellular cation levels are low (82). In the pho-24 mutant, PhoQ is active even when extracellular cation levels are relatively high, resulting in net phosphorylation of PhoP (37). The strong repressing effect of the pho-24 mutation on hilA and invasion gene expression suggests that PhoP~P might repress hilA directly or indirectly in response to low extracellular cation levels. Expression of hilA and invasion genes is also reduced by disruptions in sirA or barA (1, 4, 48). The products of these genes resemble GacA and LemA, respectively. GacA and LemA are two-component regulatory factors implicated in Pseudomonas pathogenesis. It is thought that BarA regulates the activity of SirA in response to an unknown environmental cue, and SirA goes on to directly or indirectly activate expression of hilA and invasion genes.
Other mutations causing decreased hilA and invasion gene expression have been identified in csrB and in a second pathogenicity island called SPI2. In Escherichia coli, CsrB is an RNA thought to sequester CsrA, a protein that binds to and accelerates degradation of particular mRNAs (55, 84). Chromosomal disruptions in S. enterica serovar Typhimurium csrB or expression of E. coli csrA from a plasmid reduces hilA expression (4), suggesting that CsrA may degrade an mRNA whose product is involved in regulation of hilA. hilA expression is also reduced by insertions in SPI2 genes that encode structural components of a type III secretion system required by S. enterica serovar Typhimurium to survive inside macrophages (25). Thus, regulation of the SPI1 and SPI2 secretion systems may be interrelated. The mechanisms whereby CsrA-CsrB and SPI2 genes affect hilA expression are unknown.
Recent studies of the hilA promoter suggest that inhibition
of hilA expression by high oxygen, low osmolarity,
pho-24, or disruptions in sirA or barA
requires region
39 to
314 upstream of the hilA
transcriptional start site (72). An unknown repressor is
thought to act at this site to inhibit hilA expression.
hilC, also referred to as sirC (69) or
sprA (30), and hilD are SPI1 genes
predicted to encode AraC-like transcriptional regulators that may
inhibit the repressor under appropriate conditions, allowing expression
of hilA (72). hilC mutants exhibit a
mild decrease in hilA expression and invasiveness, while a
disruption in hilD drastically reduces hilA
expression and significantly inhibits S. enterica serovar
Typhimurium's ability to invade HEp-2 cells (69, 72). Thus,
hilD seems to play a more important role than hilC in regulation of hilA expression and
S. enterica serovar Typhimurium invasiveness in vitro.
HilC may be capable of activating invF and invA
expression directly, since high-level expression of hilC
from a plasmid allows expression of these genes in the absence of
hilA (30, 69).
Although many genes have been implicated in hilA regulation, only one screen designed to isolate mutations reducing invasion gene expression has been reported (48), and this screen was not saturating. Identification of such mutations might help uncover novel regulatory pathways or elucidate mechanisms involved in regulation of hilA and invasion genes by environmental conditions. Here we report the identification of Tn5 insertions causing decreased hilA and/or invasion gene expression. Our results suggest that several pathways not previously implicated in regulation of hilA work independently of each other to modulate hilA expression and invasion of HEp-2 cells.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Bacterial strains and growth conditions.
Bacterial strains
and plasmids used in this study are listed in Table
1. Bacterial cultures were grown at
37°C in Luria-Bertani (LB) medium composed of 0.5% Bacto-yeast
extract, 1% Bacto-tryptone, and 1% NaCl. When appropriate, the medium
was supplemented with antibiotics as follows: 100 to 200 µg of
ampicillin per ml, 50 to 100 µg of kanamycin per ml, 10 µg of
chloramphenicol per ml, and/or 10 µg of tetracycline per ml.
Expression of fliA, fliZY, fliZ, and
fliY was induced by growing cultures in medium containing 0.01 to 0.1 mM isopropyl-
-D-thiogalactopyranoside
(IPTG).
-Galactosidase assays were performed with bacterial cultures
grown under low-oxygen conditions as previously described (9,
54), and activities were quantified by the Miller method
(59).
|
Tissue culture growth conditions and invasion assays. HEp-2 cells (ATCC CCL23) were maintained in Dulbecco's modified Eagle medium supplemented with 5% fetal bovine serum. Invasion assays were performed on HEp-2 monolayers with oxygen-limited bacterial cultures as previously described (9, 54). To verify results from invasion assays, coverslip assays were performed on HEp-2 monolayers that were obtained by seeding approximately 5 × 104 cells per coverslip in a 24-well plate and allowing growth overnight at 37°C with 5% CO2. After inoculation of coverslips with 100 µl of oxygen-limited bacterial cultures, plates were centrifuged at 100 × g for 10 min and incubated at 37°C in a 5% CO2 incubator for 1 h. Cells were then rinsed two times with phosphate-buffered saline (PBS), fixed with methanol for 5 min, and treated with Giemsa stain for 45 min. Following four rinses with distilled water, coverslips were dried, mounted, and examined by bright-field microscopy.
DNA methods. Restriction enzymes were purchased from New England Biolabs. Chromosomal DNA was isolated with Invitrogen's Easy-DNA kit. PCR was performed with rTaq polymerase from TaKaRa Shuzo Co. PCR products were cloned with a TA-cloning kit from Invitrogen. Plasmid DNA was purified on Qiagen columns. Enzymes and kits were used according to the manufacturers' instructions.
Bacterial strain construction.
Marked mutations were moved
into different strain backgrounds and tested for linkage to chromosomal
markers by P22 transduction. Plasmids were passaged through
r
m+ LT2 strain LB5000 (15, 70)
before being electroporated into SL1344 derivatives by standard methods.
Motility assays and flagellar staining. Motility was tested by assessing swarming phenotypes on motility agar (2.5% nutrient broth and 0.5% Bacto-agar) supplemented with antibiotics and IPTG when appropriate. To visualize flagella, cells were grown in tubes on a roller at 37°C to mid-log phase, and 1 drop of each culture was mixed with 5 to 10 µl of RYU Flagella stain (Remel). Cells were then examined by bright-field microscopy.
Tn5 mutagenesis and screening of mutants. Pools of EE251::Tn5 mutants were generated as previously described (54). To identify mutations that affect hilA and invasion gene expression, Tn5 mutations were moved from EE251 pools into CL87 and EE633 by P22 phage transduction. Transductants were initially selected on LB agar supplemented with 100 µg of kanamycin per ml and 10 mM EGTA. Transductants were scraped off the plates, suspended in LB medium containing 10 mM EGTA, and replated on MacConkey lactose (MacLac) agar supplemented with 100 µg of kanamycin per ml and 10 mM EGTA. Colonies exhibiting a loss-of-red phenotype compared to their wild-type parents were restreaked on MacLac agar containing 10 mM EGTA to purify the bacteria from phage and to confirm the loss-of-red phenotype.
Identification of Tn5 mutations.
RL20, RL119,
and RL224 chromosomal DNAs were digested with SalI or
EcoRI, ligated into pUC19, and transformed into DH5
.
Plasmids from transformants which were resistant to both ampicillin and kanamycin were isolated and sequenced with primer IS50RL
(GGTCACATGGAAGTCAGATC), corresponding to a sequence internal
to Tn5, or primer M13F (GTAAAACGACGGCCAG). Chromosomal DNAs from RL60, RL61, and RL134 were subjected to PCR
with primers IS50RL and tar1 (CTGGCGGAAGCATAACGGTG). PCR
products were TA cloned into DH5
and sequenced with primers M13F and
M13R (CAGGAAACAGCTATGAC). Sequencing was performed with the
PRISM ready reaction dideoxy terminator cycle sequencing kit and the
model 373A DNA sequencing system (Applied Biosystems).
Isolation of
fliA36::Tn5B50.
Pools of
EE251::Tn5B50 mutants were generated as previously
described (54). Tn5B50 mutations were transduced
into CL87, and transductants were selected on LB agar supplemented with
10 µg of tetracycline per ml and 10 mM EGTA. Mutants were screened on
motility agar supplemented with 10 µg of tetracycline per ml and 10 mM EGTA. Nonmotile mutants were examined for flagella and tested for
-galactosidase activity. Tn5B50 insertions in nonmotile mutants with decreased iagB87::lacZY
expression were tested for linkage to
fliA51::Tn5 by P22 transduction. RL241
was confirmed to have a Tn5B50 insertion in fliA
by PCR with primers at the 5' and 3' ends of fliA,
fliA1 (GGCGCTACAGGTTACATAAG) and fliA2 (TAGTCTATACGTTGTGCGGC), respectively.
| |
RESULTS |
|---|
|
|
|---|
Reporter fusion strains. To monitor the effects of mutations on hilA and invasion gene expression, we utilized the iagB87::lacZY fusion strain CL87 and the sipA4::Tn5lacZY fusion strain EE633. iagB is a gene downstream of hilA encoding a product of unknown function, and sipA encodes a secreted factor whose expression is dependent on HilA (Fig. 1). iagB is thought to be cotranscribed with hilA, since hilA339::kan abolishes iagB87::lacZY expression, even in the presence of plasmids expressing hilA or hilA and iagB (data not shown). Thus, iagB87::lacZY and sipA4::Tn5lacZY are used as reporters of hilA and hilA-dependent invasion gene expression, respectively (9, 48). Both CL87 and EE633 are able to invade HEp-2 cells as efficiently as their wild-type parent, SL1344 (C. A. Lee, unpublished observations).
Isolation of mutants.
To isolate mutants with reduced
hilA and invasion gene expression, we transduced
Tn5 insertions from our pools of Tn5-mutagenized EE251 into CL87 and EE633. Among approximately 9,000 transductants, we
chose 36 exhibiting a lactose-negative (pink or white) phenotype on MacLac agar. Of these, we confirmed that 3 CL87::Tn5 mutants had decreased
iagB87::lacZY expression, and 25 EE633::Tn5 mutants had decreased
sipA4::Tn5lacZY expression by
-galactosidase assays. Two mutants completely lacking
-galactosidase activity had lost the
sipA4::Tn5lacZY reporter fusion during
transduction of the Tn5 mutations into EE633 due to linkage
between the Tn5 and sipA. We examined the
remaining 26 mutants for their ability to invade HEp-2 cells, and,
since loss of motility results in decreased invasiveness
(50), we tested noninvasive mutants for motility by
microscopy and motility agar assays. To determine linkage of the
mutations to SPI1 and to test their effects on other invasion genes, we
transduced the kanamycin-resistant Tn5 insertions into strains carrying various invasion gene Tn5lacZY reporter
fusions encoding tetracycline resistance. In two cases, the phenotypes of the mutants did not cotransduce with the Tn5 insertions,
suggesting that the Tn5 mutations are not responsible for
decreased sipA4::Tn5lacZY expression in
those mutants.
Characterization of SPI1-linked Tn5 insertions. Seven EE633::Tn5 mutants exhibiting 2- to 7-fold decreases in sipA4::Tn5lacZY expression and 50- to >100-fold reductions in invasion of HEp-2 cells contained Tn5 insertions linked to SPI1. One of these insertions was closely linked to sipA4::Tn5lacZY and was not further characterized. Six other insertions were found to be >69% linked to invG, a gene immediately downstream of invF. One of them, invF-29::Tn5, was also tested for linkage to invF11-5::Tn5lacZY and was found to be 100% linked. Since disruptions in invF are known to cause strong defects in invasion and reduced expression of certain hilA-dependent genes (23, 29), the invG-linked Tn5 insertions isolated in our screen are likely to decrease expression of sipA by reducing or abolishing invF expression. Such mutations are expected to decrease expression of sipC, but not hilA or other hilA-dependent genes (Fig. 1). In support of this, we found that invF-29::Tn5 reduced expression of sipA and sipC, but not hilA, orgA, prgH, or prgK (data not shown). Other invG-linked insertions were not further analyzed.
Identification of motile mutants with Tn5 insertions unlinked to SPI1. One motile CL87::Tn5 mutant with a fivefold decrease in iagB87::lacZY expression and six motile EE633::Tn5 mutants with two- to fourfold decreases in sipA4::Tn5lacZY expression exhibited less-than-sevenfold reductions in invasion of HEp-2 cells and contained Tn5 insertions unlinked to SPI1. Based on sequencing of the Tn5 insertion site junctions, two of these appear to be in the S. enterica serovar Typhimurium pstS and fadD genes. The region flanking pstS55::Tn5 is predicted to encode amino acids that are 93% identical to PstS from E. coli. The insertion site corresponds to a location 798 bp downstream of the translational start site for E. coli pstS. The region flanking fadD1::Tn5 is predicted to encode amino acids that are 75% identical to E. coli FadD. Its insertion site corresponds to a location 125 bp downstream of the translational start site for E. coli fadD. The locations of the other five Tn5 insertions in this group have not yet been determined.
Identification of nonmotile mutants. Two CL87::Tn5 mutants with 2- to 4-fold decreases in iagB87::lacZY expression and three EE633::Tn5 mutants with 2- to 4-fold decreases in sipA4::Tn5lacZY expression exhibited 50- to 100-fold reductions in invasion of HEp-2 cells and had Tn5 insertions unlinked to SPI1. These mutants were nonmotile, as determined by swarming phenotypes on motility agar plates, and staining results indicated that they lacked flagella (data not shown). Thus, the strong invasion defects of these mutants are most likely due to loss of motility. Based on DNA sequencing, the fliA51::Tn5 mutant has an insertion in S. enterica serovar Typhimurium fliA 63 bp downstream of the translational start site.
The four remaining nonmotile mutants had Tn5 insertions >57% linked to tar::Tn10. For three of these mutants, the regions between tar and Tn5 were amplified by PCR, cloned, and sequenced. Two lie in flhC, and one lies in flhD. The flhC4::Tn5 and flhC36::Tn5 insertions lie 119 and 101 bp downstream of the S. enterica serovar Typhimurium flhC translational start site, respectively. The flhD37::Tn5 insertion lies 303 bp downstream of the S. enterica serovar Typhimurium flhD translational start site. zec57::Tn5 is 57.5% linked to tar, but its insertion site has not yet been identified.Characterization of pstS55::Tn5
mutant.
The pstS55::Tn5 mutation
reduced expression of hilA and invasion genes two- to
threefold, and this defect was complemented by pSN507, a pBR322
derivative containing the E. coli pstSCAB-phoU operon (Fig.
2A). pBR322 had no effect on
hilA or invasion gene expression (data not shown). In
E. coli, the pstSCAB-phoU operon encodes a
high-affinity inorganic phosphate (Pi) uptake system (83). In addition to its role in importing Pi,
the Pst system is required for negative control of the PhoR-PhoB
two-component regulatory system. When extracellular Pi
levels are low (<4 µM), PhoR phosphorylates the transcriptional
regulator PhoB, activating expression of the phosphate (Pho) regulon
(see Fig. 6). When Pi levels are high (>4 µM), PhoR acts
as a phosphatase and dephosphorylates PhoB~P, inhibiting expression
of the Pho regulon. In the absence of the Pst system, PhoB~P
accumulates even in the presence of high Pi levels. Thus,
the pstS55::Tn5 mutation is expected
both to abolish the high-affinity Pst system and lead to accumulation of PhoB~P.
|
phoB1::cat. In the
presence of pstS55::Tn5,
phoB1::cat restored hilA
and invasion gene expression to wild-type levels (Fig. 2B). These data
suggest that repression of hilA and invasion genes by
pstS55::Tn5 is mediated by PhoB and
that the PhoR-PhoB two-component regulatory system has the ability to
directly or indirectly regulate hilA and invasion gene
expression. As expected,
phoB1::cat
had no effect on hilA or invasion gene expression when the
Pst system was intact (Fig. 2B). Under our growth conditions (i.e.,
rich medium), Pi levels are not limiting and PhoR is able
to dephosphorylate PhoB in the presence of an intact Pst system,
preventing any accumulation of PhoB~P.
Characterization of fadD1::Tn5
mutant.
fadD1::Tn5 reduced expression
of hilA and invasion genes three- to fivefold, and this
defect was complemented by pN300, a pACYC177 derivative containing
E. coli fadD (Fig. 3A).
pACYC177 had no effect on invasion gene expression (data not shown). In E. coli, fadD encodes acyl coenzyme A (CoA)
synthetase, a protein required for import of long-chain fatty acids
(LCFA) and for activation of LCFA with CoA prior to the first step in
-oxidation (13). As expected,
fadD1::Tn5 mutants were unable to grow
on LCFA as the sole carbon source (data not shown).
|
Characterization of fliA51::Tn5
and flhC4::Tn5.
In E. coli and S. enterica serovar Typhimurium
flhC and flhD encode master regulators of
flagellar genes. FlhC and FlhD form heterotetramers to activate
expression of operons encoding the flagellar basal body and FliA
(56). FliA is an alternate sigma factor required for the
expression of operons encoding flagellin, chemotaxis machinery, and the
flagellar motor (64).
flhC4::Tn5 and
fliA51::Tn5 had comparable effects on
invasion gene expression (Fig. 4A), and
both abolished swarming phenotypes on motility agar plates (Table
2). As expected, addition of pSIIA1, a
plasmid expressing fliA from the tac promoter,
restored motility to the fliA51::Tn5
mutant but not the flhC4::Tn5 mutant in
the presence of IPTG (Table 2). However, pSIIA1 did not complement the
effect of fliA51::Tn5 on
hilA expression (data not shown), suggesting that loss of
FliA itself is not responsible for decreased hilA and
invasion gene expression in this mutant.
|
|
Effects of double mutations on iagB87::lacZY expression and invasion of HEp-2 cells. The results presented above show that multiple regulators appear to control hilA and invasion gene expression. We therefore tested whether they operate via common or different regulatory pathways. We predicted that mutations repressing hilA through the same pathway would not reduce hilA expression more when combined than when acting alone. In contrast, we expected that mutations reducing hilA expression by distinct regulatory pathways would decrease hilA expression much more when combined than when acting alone. We therefore used P22 transduction to combine mutations that reduce hilA expression and compared the effects of single and double mutations on iagB87::lacZY expression and invasion of HEp-2 cells.
In addition to the mutations identified in our screen, low osmolarity (9) and disruptions in sirA (1, 48) are known to reduce hilA expression. In E. coli and S. enterica serovar Typhimurium, the EnvZ-OmpR two-component regulatory system is thought to modulate expression of certain genes in response to changes in osmolarity (67). Thus, we also tested mutants containing envZ182::cam or sirA2::kan alone and in combination with mutations identified by our screen. Mutants with insertions in fliA and flhC were not tested in invasion assays, since nonmotility per se is known to greatly reduce invasiveness, even in strains that express hilA (50). In order to construct certain double mutants, we obtained mutations with alternate antibiotic resistance markers in the pstSCAB-phoU operon and fliA. pst-4::Tn10 disrupts the pstSCAB-phoU operon and encodes tetracycline resistance (47). To obtain a mutation in fliA with a different marker, we transduced Tn5B50 insertions encoding tetracycline resistance into CL87 and screened for nonmotile mutants with decreased iagB87::lacZY expression. We then mapped these mutations relative to fliA51::Tn5 and identified a Tn5B50 insertion in fliA (data not shown). Compared to pstS55::Tn5 (Fig. 2A), pst-4::Tn10 had a somewhat stronger effect on iagB expression (Fig. 5A). fliA36::Tn5B50's effect on iagB expression was comparable to that of fliA51::Tn5 and was complemented by pDSM29 (data not shown). Other single mutations, including envZ182::cam, mildly reduced iagB expression. However, with the exception of the fliA36::Tn5B50 flhC4::Tn5 mutant, double mutants exhibited much greater reductions in expression of iagB (Fig. 5A) than their single-mutant parents. Similarly, the single mutants invaded HEp-2 cells almost as well as CL87, while the double mutants exhibited strong invasion defects (Fig. 5B). Invasion assay results were confirmed by coverslip assays as described in Materials and Methods (data not shown). These data indicate that most of the mutations act independently of each other to reduce hilA expression and invasion of HEp-2 cells. For example, the mutation in sirA does not appear to reduce hilA expression by the same pathway as the mutation in envZ. In contrast, fliA36::Tn5B50 and flhC4::Tn5 appear to work in the same pathway to reduce hilA expression. The latter result is consistent with our model, in which flhDC is required for expression of the fliAZY operon and fliZ expression is required for maximal hilA and invasion gene expression.
|
| |
DISCUSSION |
|---|
|
|
|---|
S. enterica serovar Typhimurium encounters many different environmental conditions and barriers at various sites during infection (73). After being ingested, the bacteria must survive the acidity of the stomach to reach the low-oxygen, hyperosmotic environment of the small intestine. There they must overcome the deleterious effects of defensins, secretory immunoglobulin A, bile salts, and pancreatic enzymes. To cause systemic infection, the bacteria must penetrate the intestinal epithelium and withstand the host's immune system. The latter process may be achieved in part by S. enterica serovar Typhimurium's ability to grow inside macrophages, where the bacteria must overcome exposure to cationic peptides, acid pH, and nutrient deprivation.
Although some genes may be important for S. enterica serovar Typhimurium's survival throughout infection, particular genes seem to be required to overcome unique challenges that bacteria face at specific sites. For example, SPI1 invasion genes are thought to play an important role in colonization and persistence in the intestine (R. A. Murray, unpublished observations), while certain genes on SPI2 (19, 43, 63) and SPI3 (14) appear to be important for survival in macrophages. In order to correlate expression of appropriate sets of genes with specific locations, S. enterica serovar Typhimurium may regulate expression of virulence genes in response to environmental signals found at critical sites during infection.
Fatty acids and virulence.
Genes involved in uptake and
degradation of fatty acids may be important at various stages of
infection, and many of these genes seem to be induced in vivo
(42). For example, in a screen for in vivo-induced genes,
Mahan et al. recovered a fadB fusion from the spleens of
mice infected intraperitoneally with S. enterica serovar
Typhimurium (57). fadB encodes an enzyme required
for
-oxidation of LCFA (20). In a similar screen, a
fadL fusion was isolated from a mouse intestine 24 h
after intragastric inoculation with S. enterica serovar
Typhimurium (D. M. Heithoff, C. P. Conner, and M. J. Mahan, unpublished results). fadL is an outer membrane transporter required for uptake of LCFA (11, 12). In
addition, a fusion to fadF, a gene required for metabolism
of medium-chain fatty acids and LCFA (20), was induced in
cultured epithelial cells (78). Finally, a Fad
mutant has been shown to exhibit reduced virulence after oral inoculation in mice (80). Together, these results suggest
that fatty acid degradation may be important for S. enterica
serovar Typhimurium's survival throughout infection. However, the
availability of fatty acids and the effects of these fatty acids on the
bacteria's nutritional status, membrane composition, and levels of
fatty acid intermediates may vary at different sites during infection. In turn, S. enterica serovar Typhimurium may utilize these
variations to evaluate its environment and alter virulence gene
expression accordingly.
|
-oxidation may occur under the growth
conditions used in our study. The fadD mutation blocks
degradation of fatty acids and may lead to accumulation of endogenous
precursors that might somehow repress hilA expression. One
candidate for such an activity is long-chain acyl-acyl carrier protein
(acyl-ACP), an important intermediate of fatty acid biosynthesis responsible for feedback inhibition of fatty acid biosynthetic enzymes
(27). Long-chain acyl-ACP is a substrate for synthesis of
lipid A and phospholipids, and changes in its levels may affect the
phospholipid composition of the cellular membrane. Such alterations are
known to affect expression of several genes (27). Acyl-ACP has also been implicated in production of autoinducers (71), suggesting another link between this intermediate and gene regulation. Alternatively, a product of
-oxidation may activate hilA
expression. However, in the absence of exogenous LCFA, the levels of
intermediates in this pathway are extremely low (27). Thus,
any transcriptional regulator modulating hilA expression in
response to fatty acid degradation products would have to be extremely
sensitive to such metabolites.
Finally, it may be that FadD produces short- or medium-chain fatty
acyl-CoA derivatives which do not affect FadR but modulate a regulator
of hilA. Significant quantities of short-chain fatty acids
have been found in the intestinal lumen (22), and their CoA
derivatives may act as signals inducing hilA expression.
Thus, production of short-chain acyl-CoA may help to activate
hilA and invasion gene expression in the intestinal lumen.
Whatever the mechanism, our results link fatty acid metabolism with
regulation of hilA, suggesting that S. enterica
serovar Typhimurium may somehow monitor this pathway to coordinate
expression of invasion genes during infection.
Motility and regulation of invasion genes. Our results indicate that hilA and invasion genes are also regulated by expression of fliZ (Fig. 6). In addition, Eichelberg et al. have reported that invF expression is reduced by a fliA::Tn10 insertion in Salmonella enterica serovar Typhi (K. Eichelberg, K. Kaniga, and J. E. Galan, Abstr. 95th Gen. Meet. Am. Soc. Microbiol. 1995, abstr. B-319, p. 221, 1995), and our results would suggest that this effect is due to reduced or abolished expression of fliZ. Although an in-frame deletion of fliZ is reported to have a mild effect on motility (46), fliZ's function is unknown, and its predicted product bears no significant homology to any known protein or structural motif. It seems unlikely that FliZ itself acts as a transcriptional regulator, since it contains no apparent DNA binding domain. A mutation in fliA that presumably abolishes fliZ expression does not significantly affect S. enterica serovar Typhimurium's ability to cause disease in mice (75), suggesting that FliZ is not required for virulence.
Because fliZ is cotranscribed with fliA in S. enterica serovar Typhimurium (46), the regulation of hilA by FliZ implies a link between motility and invasion gene expression. Interestingly, many other pathogenic organisms also appear to coordinate motility with expression of virulence factors. In Bordetella bronchiseptica, BvgAS activates expression of certain virulence factors, while inhibiting expression of flagella and motility (2, 3), and in Yersinia enterocolitica, both motility and expression of inv, which encodes an invasion factor, are maximal at 23°C (51). Temperature-dependent expression of inv and flagellin genes seems to be coordinately regulated at the level of transcription (7). In Vibrio cholerae, mutations resulting in nonmotile or hypermotile phenotypes also affect expression of virulence factors, including the toxin-coregulated pilus and cholera toxin (35). Our results indicate that S. enterica serovar Typhimurium motility per se is not required for hilA expression, and fliZ is not necessary for motility. However, environmental signals modulating fliAZY expression may coordinately regulate motility via FliA and expression of invasion genes via FliZ. The significance of this link between motility and invasion gene expression in S. enterica serovar Typhimurium virulence is unknown.PhoPQ and PhoR-PhoB: differential regulation of virulence genes. While this study implicates fadD and fliZ in regulating expression of only one set of virulence factors (i.e., invasion genes), evidence suggests that some regulatory pathways modulate expression of more than one set of virulence factors. One example of this is the model for regulation of virulence genes by PhoPQ. When extracellular cation levels are low, PhoPQ activates expression of PhoP-activated genes (pag), including genes on SPI2 (24) and SPI3 (14). Although it is unclear whether cation levels are the true signals for PhoPQ activation in vivo, many PhoP-activated genes are known to be induced in macrophages (81), implying that PhoPQ is active in that environment. However, PhoPQ is thought to inhibit hilA and invasion gene expression (9, 65), suggesting that these genes are repressed in macrophages. In turn, when exposed to conditions that inactivate PhoPQ, S. enterica serovar Typhimurium presumably expresses invasion genes while repressing PhoP-activated genes. Thus, PhoPQ may be inactive in the small intestine where invasion gene expression is thought to be important. PhoPQ's differential regulation of PhoP-activated gene and invasion gene expression evokes a model in which S. enterica serovar Typhimurium uses the same regulatory system to activate the expression of genes whose products are required at a particular site (such as the intestinal lumen or inside macrophages) while simultaneously turning off expression of genes whose products are not needed at that specific location.
An interesting parallel can be drawn between this model and the regulation of virulence genes by the PhoR-PhoB two-component regulatory system. Our results indicate that PhoB~P directly or indirectly represses hilA and invasion genes, suggesting that low extracellular Pi levels may be capable of repressing hilA and invasion genes via PhoR-PhoB (Fig. 6). This leads to speculation that Pi levels are high in the intestinal lumen, allowing expression of invasion genes at that site. In contrast, Pi levels may be low in the macrophage. gfp fusion studies indicate that the pstSCAB-phoU operon is induced in macrophages (81), implying that Pi uptake and P assimilation are important for survival of S. enterica serovar Typhimurium in this environment. In addition, the pstSCAB-phoU operon is a member of the Pho regulon, and its induction in the macrophage is therefore probably mediated by PhoR-PhoB (83). This implies that Pi levels in the macrophage are low enough (<4 µM) to activate the PhoR sensor kinase, resulting in the accumulation of PhoB~P. Thus, in response to low levels of Pi in the macrophage, PhoR-PhoB may reduce expression of genes whose products are no longer needed, including invasion genes, while turning on expression of genes that help S. enterica serovar Typhimurium survive the harsh conditions inside macrophages, including pstSCAB-phoU. In support of this model, Deiwick et al. have shown that SPI2 genes are activated by low Pi levels in vitro (24). As with PhoPQ, it is unclear how PhoR-PhoB might regulate hilA expression. The E. coli Pho regulon consists of at least 31 genes involved in Pi uptake and P assimilation (83). PhoB~P might repress hilA by modulating the expression of any one of these genes. Also, PhoB~P may regulate SPI2 genes in response to Pi levels, and since mutations in certain SPI2 genes reduce hilA expression, the regulation of hilA by PhoB~P may be an indirect effect resulting from a change in expression of those SPI2 genes. Alternatively, PhoB~P might repress hilA expression through some unknown gene not yet identified as part of the Pho regulon, or it may repress hilA directly. Finally, it could be that an increase in PhoB~P affects accumulation of an intracellular signal such as ppGpp, which may somehow reduce hilA expression (16, 77). Future studies will aim to distinguish between these possibilities.Restricted gene expression and complex regulation. The activation and repression of different virulence genes by PhoPQ and PhoR-PhoB raise an important point about S. enterica serovar Typhimurium pathogenesis. While expression of a particular set of genes at a specific site may be crucial for virulence, repression of a different set of genes at the same site may be equally important for survival of bacteria in the host. Mutations causing ectopic expression of virulence genes can greatly reduce S. enterica serovar Typhimurium's ability to cause disease in mice (41). The attenuation of such mutants may be due in part to premature host immune responses to antigens from inappropriately expressed virulence factors. Some ectopically produced proteins may interfere with other processes whose functions are required at certain sites during infection. Also, it may be important for S. enterica serovar Typhimurium's survival in the host to minimize the expenditure of energy and resources required for producing certain virulence determinants. For example, type III secretion systems are relatively complex structures, and it may be energetically unfavorable to produce them continuously. Thus, it may be necessary to restrict virulence gene expression to one or a few specific locations during infection.
Our results suggest that FliZ, FadD, PhoB, EnvZ, and SirA each affect hilA expression independently and act through distinct pathways. PhoPQ, SPI2 genes, and CsrA-CsrB may represent other independent pathways regulating hilA expression, and many more such pathways may await discovery. The regulation of hilA expression by multiple pathways may be necessary to ensure that SPI1-mediated type III secretion occurs only in the presence of specific environmental conditions representing the precise location(s) where this process is necessary. Several candidate regulators that may integrate signals from various regulatory pathways include HilC, HilD, the unknown repressor, and/or HilA itself. Prior studies have demonstrated that hilA and invasion genes are severely repressed by high oxygen, low osmolarity, or the pho-24 mutation (9), suggesting that the expression of hilA (and therefore the expression of the secretion apparatus and its secreted effectors) is similar to an all-or-nothing response. However, mutations identified in this study have milder effects than the previously identified repressing environmental signals, and these mutations result in intermediate expression levels of hilA and invasion genes. This suggests that instead of simply being turned on or off, hilA can be modulated incrementally by different regulatory inputs. However, it is possible that the pathways implicated by these mutations really have much stronger effects on hilA expression under certain appropriate conditions. Another possibility is that the strong repression of hilA by certain conditions involves two or more regulatory pathways. For example, the effect of the envZ mutation on hilA expression is fairly mild, suggesting that this regulatory system cannot fully account for the strong repression of hilA by low osmolarity. However, changes in osmolarity might regulate hilA expression through both EnvZ and some other independent pathway, and it may be necessary to abolish both pathways in order to observe the level of repression seen under low-osmolarity conditions. Thus, the regulation of hilA and invasion genes in response to individual environmental conditions may be more complex than previously thought. Finally, it may be that hilA and invasion genes are incrementally regulated at certain sites within the host, as suggested by the effects of mutations identified in this screen. This type of regulation may be important if particular environmental conditions are the same at several critical locations during infection. By requiring more than one inhibiting signal, S. enterica serovar Typhimurium may have more flexibility, permitting intermediate levels of hilA and invasion gene expression at sites where one inhibiting condition is present. At the same time, such regulation would allow for inhibition of hilA and invasion gene expression when particular combinations of repressing conditions are encountered. In contrast, signals like high oxygen or low osmolarity that completely repress hilA and invasion genes may represent a very unique environment encountered by the bacteria at a specific site during infection. As previously suggested, a condition at one site in the host may be precisely the opposite of a condition found at another site, allowing differential regulation of distinct sets of virulence factors by a common pathway, such as PhoPQ. In such situations, an all-or-nothing response may be more efficient than incremental regulation. Whether incremental or absolute, the repression of hilA and invasion genes by mutations identified in this study adds to the growing list of regulatory pathways implicated in modulating hilA and invasion gene expression. Future studies will aim to determine the mechanisms whereby these pathways affect expression of hilA and may provide insights into how various signals are integrated to ultimately influence S. enterica serovar Typhimurium invasiveness.| |
ACKNOWLEDGMENTS |
|---|
We are grateful to R. Langdon and S. Pardo-Reoyo for preliminary studies of the fadD and envZ mutants; K. Kutsukake, S. Lindgren, and B. Ahmer for sharing strains; and M. Mahan for sharing unpublished data. We also thank L. Schechter, R. Murray, and S. Akbar for critical reading of the manuscript.
This work was supported by American Heart Association grant-in-aid 96006780 (C.A.L.), the Albany Medical College Strategic Research Initiative (C.C.D.), NIH grant no. GM47628-01 (M.P.S.), and NIH Senior Fellowship F33 AI10093 (B.L.W.).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Molecular Genetics, Harvard Medical School, 200 Longwood Ave., Boston, MA 02115. Phone: (617) 432-4988. Fax: (617) 738-7664. E-mail: clee{at}hms.harvard.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Ahmer, B. M. M., J. van Reeuwijk, P. R. Watson, T. S. Wallis, and F. Heffron. 1999. Salmonella SirA is a global regulator of genes mediating enteropathogenesis. Mol. Microbiol. 31:971-982[CrossRef][Medline]. |
| 2. |
Akerley, B. J., and J. F. Miller.
1993.
Flagellin gene transcription in Bordetella bronchiseptica is regulated by the BvgAS virulence control system.
J. Bacteriol.
175:3468-3479 |
| 3. |
Akerley, B. J.,
D. M. Monack,
S. Falkow, and J. F. Miller.
1992.
The bvgAS locus negatively controls motility and synthesis of flagella in Bordetella bronchiseptica.
J. Bacteriol.
174:980-990 |
| 4. | Altier, C., M. Suyemoto, A. I. Ruiz, K. D. Burnham, and R. Maurer. Characterization of two novel regulatory genes affecting Salmonella invasion gene expression. Mol. Microbiol., in press. |
| 5. | Amann, E., B. Ochs, and K. J. Abel. 1988. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene 69:301-315[CrossRef][Medline]. |
| 6. |
Amemura, M.,
H. Shinagawa,
K. Makino,
N. Otsuji, and A. Nakata.
1982.
Cloning of and complementation tests with alkaline phosphatase regulatory genes (phoS and phoT) of Escherichia coli.
J. Bacteriol.
152:692-701 |
| 7. |
Badger, J. L., and V. L. Miller.
1998.
Expression of invasin and motility are coordinately regulated in Yersinia enterocolitica.
J. Bacteriol.
180:793-800 |
| 8. | Bajaj, V., C. Hwang, and C. A. Lee. 1995. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 15:749-759[CrossRef][Medline]. |
| 9. | Bajaj, V., R. L. Lucas, C. Hwang, and C. A. Lee. 1996. Co-ordinate regulation of Salmonella typhimurium invasion genes by environmental and regulatory factors is mediated by control of hilA expression. Mol. Microbiol. 22:703-714[CrossRef][Medline]. |
| 10. |
Behlau, I., and S. I. Miller.
1993.
A PhoP-repressed gene promotes Salmonella typhimurium invasion of epithelial cells.
J. Bacteriol.
175:4475-4484 |
| 11. | Black, P. N. 1990. Characterization of FadL-specific fatty acid binding in Escherichia coli. Biochim. Biophys. Acta 1046:97-105[Medline]. |
| 12. |
Black, P. N.
1988.
The fadL gene product of Escherichia coli is an outer membrane protein required for uptake of long-chain fatty acids and involved in sensitivity to bacteriophage T2.
J. Bacteriol.
170:2850-2854 |
| 13. |
Black, P. N.,
C. C. DiRusso,
A. K. Metzger, and T. L. Heimert.
1992.
Cloning, sequencing, and expression of the fadD gene of Escherichia coli encoding acyl coenzyme A synthetase.
J. Biol. Chem.
267:25513-25520 |
| 14. |
Blanc-Potard, A.-B.,
F. Solomon,
J. Kayser, and E. A. Groisman.
1999.
The SPI-3 pathogenicity island of Salmonella enterica.
J. Bacteriol.
181:998-1004 |
| 15. |
Bullas, L. R., and J.-I. Ryu.
1983.
Salmonella typhimurium LT2 strains which are r m+ for all three chromosomally located systems of DNA restriction and modification.
J. Bacteriol.
156:471-474 |
| 16. | Cashel, M., D. R. Gentry, V. J. Hernandez, and D. Vinella. 1996. The stringent response, p. 1458-1496. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 17. |
Chen, L. M.,
S. Hobbie, and J. E. Galan.
1996.
Requirement for CDC42 for Salmonella-induced cytoskeletal and nuclear responses.
Science
274:2115-2118 |
| 18. | Chen, L. M., K. Kaniga, and J. E. Galan. 1996. Salmonella spp. are cytotoxic for cultured macrophages. Mol. Microbiol. 21:1101-1115[CrossRef][Medline]. |
| 19. | Cirillo, D., R. H. Valdivia, D. Monack, and S. Falkow. 1998. Macrophage-dependent induction of the Salmonella pathogenicity island 2 type III secretion system and its role in intracellular survival. Mol. Microbiol. 30:175-188[CrossRef][Medline]. |
| 20. | Clark, D. P., and J. E. Cronan, Jr. 1996. Two-carbon compounds and fatty acids as carbon sources, p. 343-357. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 21. | Collazo, C. M., and J. E. Galán. 1997. The invasion-associated type III system of Salmonella typhimurium directs the translocation of Sip proteins into the host cell. Mol. Microbiol. 24:747-756[CrossRef][Medline]. |
| 22. |
Cummings, J. H.,
E. W. Pomare,
W. J. Branch,
C. P. Naylor, and G. T. Macfarlane.
1987.
Short chain fatty acids in human large intestine, portal, hepatic and venous blood.
Gut
28:1221-1227 |
| 23. |
Darwin, K. H., and V. L. Miller.
1999.
InvF is required for expression of genes encoding proteins secreted by the SPI1 type III secretion apparatus in Salmonella typhimurium.
J. Bacteriol.
181:4949-4954 |
| 24. | Deiwick, J., T. Nikolaus, S. Erdogan, and M. Hensel. 1999. Environmental regulation of Salmonella pathogenicity island 2 expression. Mol. Microbiol. 31:1759-1773[CrossRef][Medline]. |
| 25. |
Deiwick, J.,
T. Nikolaus,
J. E. Shea,
C. Gleeson,
D. W. Holden, and M. Hensel.
1998.
Mutations in Salmonella pathogenicity island 2 (SPI2) genes affecting transcription of SPI1 genes and resistance to antimicrobial agents.
J. Bacteriol.
180:4775-4780 |
| 26. | Derman, A. I., J. W. Puziss, P. J. Bassford, Jr., and J. Beckwith. 1993. A signal sequence is not required for protein export in prlA mutants of Escherichia coli. EMBO J. 12:879-888[Medline]. |
| 27. | DiRusso, C. C., P. N. Black, and J. D. Weimar. 1999. Molecular inroads into the regulation and metabolism of fatty acids, lessons from bacteria. Prog. Lipid Res. 38:129-197[CrossRef][Medline]. |
| 28. |
DiRusso, C. C.,
T. L. Heimert, and A. K. Metzger.
1992.
Characterization of FadR, a global transcriptional regulator of fatty acid metabolism in Escherichia coli.
J. Biol. Chem.
267:8685-8691 |
| 29. |
Eichelberg, K., and J. E. Galán.
1999.
Differential regulation of Salmonella typhimurium type III secreted proteins by pathogenicity island 1 (SPI-1)-encoded transcriptional activators InvF and HilA.
Infect. Immun.
67:4099-4105 |
| 30. | Eichelberg, K., W. D. Hardt, and J. E. Galán. 1999. Characterization of SprA, an AraC-like transcriptional regulator encoded within the Salmonella typhimurium pathogenicity island 1. Mol. Microbiol. 33:139-152[CrossRef][Medline]. |
| 31. |
Ernst, R. K.,
D. M. Dombroski, and J. M. Merrick.
1990.
Anaerobiosis, type 1 fimbriae, and growth phase are factors that affect invasion of HEp-2 cells by Salmonella typhimurium.
Infect. Immun.
58:2014-2016 |
| 32. | Francis, C. L., T. A. Ryan, B. D. Jones, S. J. Smith, and S. Falkow. 1993. Ruffles induced by Salmonella and other stimuli direct macropinocytosis of bacteria. Nature 364:639-642[CrossRef][Medline]. |
| 33. | Fu, Y., and J. E. Galan. 1998. The Salmonella typhimurium tyrosine phosphatase SptP is translocated into host cells and disrupts the actin cytoskeleton. Mol. Microbiol. 27:359-368[CrossRef][Medline]. |
| 34. |
Galán, J. E., and R. Curtiss, III.
1989.
Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells.
Proc. Natl. Acad. Sci. USA
86:6383-6387 |
| 35. | Gardel, C. L., and J. J. Mekalanos. 1996. Alterations in Vibrio cholerae motility phenotypes correlate with changes in virulence factor expression. Infect. Immun. 64:2246-2255[Abstract]. |
| 36. |
Gewirtz, A. T.,
A. M. Siber,
J. L. Madara, and B. A. McCormick.
1999.
Orchestration of neutrophil movement by intestinal epithelial cells in response to Salmonella typhimurium can be uncoupled from bacterial internalization.
Infect. Immun.
67:608-617 |
| 37. |
Gunn, J. S.,
E. L. Hohmann, and S. I. Miller.
1996.
Transcriptional regulation of Salmonella virulence: a PhoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP.
J. Bacteriol.
178:6369-6373 |
| 38. |
Hamilton, C. M.,
M. Aldea,
B. K. Washburn,
P. Babitzke, and S. R. Kushner.
1989.
New method for generating deletions and gene replacements in Escherichia coli.
J. Bacteriol.
171:4617-4622 |
| 39. |
Hardt, W. D., and J. E. Galan.
1997.
A secreted Salmonella protein with homology to an avirulence determinant of plant pathogenic bacteria.
Proc. Natl. Acad. Sci. USA
94:9887-9892 |
| 40. |
Hardt, W. D.,
H. Urlaub, and J. E. Galan.
1998.
A substrate of the centisome 63 type III protein secretion system of Salmonella typhimurium is encoded by a cryptic bacteriophage.
Proc. Natl. Acad. Sci. USA
95:2574-2579 |
| 41. |
Heithoff, D. M.,
R. L. Sinsheimer,
D. A. Low, and M. J. Mahan.
1999.
An essential role for DNA adenine methylation in bacterial virulence.
Science
284:967-970 |
| 42. | Heithoff, D. M., R. L. Sinsheimer, D. A. Low, and M. J. Mahan. In vivo gene expression and the adaptive response: from pathogenesis to vaccines and antimicrobials. In H. Smith, C. J. Dorman, G. Dougan, D. W. Holden, and P. Williams (ed.), Royal Society Philosophical Transactions: Biological sciences, in press. The Royal Society, London, United Kingdom. |
| 43. | Hensel, M., J. E. Shea, S. R. Waterman, R. Mundy, T. Nikolaus, G. Banks, A. Vazquez-Torres, C. Gleeson, F. Fang, and D. W. Holden. 1998. Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are required for bacterial virulence and proliferation in macrophages. Mol. Microbiol. 30:163-174[CrossRef][Medline]. |
| 44. |
Hersh, D.,
D. M. Monack,
M. R. Smith,
N. Ghori,
S. Falkow, and A. Zychlinsky.
1999.
The Salmonella invasin SipB induces macrophage apoptosis by binding to caspase-1.
Proc. Natl. Acad. Sci. USA
96:2396-2401 |
| 45. | Hobbie, S., L. M. Chen, R. J. Davis, and J. E. Galan. 1997. Involvement of mitogen-activated protein kinase pathways in the nuclear responses and cytokine production induced by Salmonella typhimurium in cultured intestinal epithelial cells. J. Immunol. 159:5550-5559[Abstract]. |
| 46. |
Ikebe, T.,
S. Iyoda, and K. Kutsukake.
1999.
Structure and expression of the fliA operon of Salmonella typhimurium.
Microbiology
145:1389-1396 |
| 47. |
Jiang, W.,
W. W. Metcalf,
K.-S. Lee, and B. L. Wanner.
1995.
Molecular cloning, mapping, and regulation of Pho regulon genes for phosphonate breakdown by the phosphonatase pathway of Salmonella typhimurium LT2.
J. Bacteriol.
177:6411-6421 |
| 48. | Johnston, C., D. A. Pegues, C. J. Hueck, C. A. Lee, and S. I. Miller. 1996. Transcriptional activation of Salmonella typhimurium invasion genes by a member of the phosphorylated response-regulator superfamily. Mol. Microbiol. 22:703-714. |
| 49. |
Jones, B. D.,
N. Ghori, and S. Falkow.
1994.
Salmonella typhimurium initiates murine infection by penetrating and destroying the specialized epithelial M cells of the Peyer's patches.
J. Exp. Med.
180:15-23 |
| 50. |
Jones, B. D.,
C. A. Lee, and S. Falkow.
1992.
Invasion of Salmonella typhimurium is affected by the direction of flagellar rotation.
Infect. Immun.
60:2475-2480 |
| 51. | Kapatral, V., J. W. Olson, J. C. Pepe, V. L. Miller, and S. A. Minnich. 1996. Temperature-dependent regulation of Yersinia enterocolitica class III flagellar genes. Mol. Microbiol. 19:1061-1071[CrossRef][Medline]. |
| 52. |
Kutsukake, K., and T. Iino.
1994.
Role of the FliA-FlgM regulatory system on the transcriptional control of the flagellar regulon and flagellar formation in Salmonella typhimurium.
J. Bacteriol.
176:3598-3605 |
| 53. |
Lee, C. A., and S. Falkow.
1990.
The ability of Salmonella to enter mammalian cells is affected by bacterial growth state.
Proc. Natl. Acad. Sci. USA
87:4304-4308 |
| 54. |
Lee, C. A.,
B. D. Jones, and S. Falkow.
1992.
Identification of a Salmonella typhimurium invasion locus by selection for hyperinvasive mutants.
Proc. Natl. Acad. Sci. USA
89:1847-1851 |
| 55. |
Liu, M. Y.,
H. Yang, and T. Romeo.
1995.
The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability.
J. Bacteriol.
177:2663-2672 |
| 56. |
Liu, X., and P. Matsumura.
1994.
The FlhD/FlhC complex, a transcriptional activator of the Escherichia coli flagellar class II operons.
J. Bacteriol.
176:7345-7351 |
| 57. |
Mahan, M. J.,
J. W. Tobias,
J. M. Slauch,
P. C. Hanna,
R. J. Collier, and J. J. Mekalanos.
1995.
Antibiotic-based selection for bacterial genes that are specifically induced during infection of a host.
Proc. Natl. Acad. Sci. USA
92:669-673 |
| 58. |
McCormick, B. A.,
P. M. Hofman,
J. Kim,
D. K. Carnes,
S. I. Miller, and J. L. Madara.
1995.
Surface attachment of Salmonella typhimurium to intestinal epithelia imprints the subepithelial matrix with gradients chemotactic for neutrophils.
J. Cell Biol.
131:1599-1608 |
| 59. | Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 60. | Mills, D. M., V. Bajaj, and C. A. Lee. 1995. A 40kb chromosomal fragment encoding Salmonella typhimurium invasion genes is absent from the corresponding region of the Escherichia coli K-12 chromosome. Mol. Microbiol. 15:749-759. |
| 61. |
Monack, D. M.,
B. Raupach,
A. E. Hromockyj, and S. Falkow.
1996.
Salmonella typhimurium invasion induces apoptosis in infected macrophages.
Proc. Natl. Acad. Sci. USA
93:9833-9838 |
| 62. |
Mytelka, D. S., and M. J. Chamberlin.
1996.
Escherichia coli fliAZY operon.
J. Bacteriol.
178:24-34 |
| 63. |
Ochman, H.,
F. C. Soncini,
F. Solomon, and E. A. Groisman.
1996.
Identification of a pathogenicity island required for Salmonella survival in host cells.
Proc. Natl. Acad. Sci. USA
93:7800-7804 |
| 64. | Ohnishi, K., K. Kutsukake, H. Suzuki, and T. Iino. 1990. Gene fliA encodes an alternative sigma factor specific for flagellar operons in Salmonella typhimurium. Mol. Gen. Genet. 221:139-147[Medline]. |
| 65. | Pegues, D. A., M. J. Hantman, I. Behlau, and S. I. Miller. 1995. PhoP/PhoQ transcriptional repression of Salmonella typhimurium invasion genes: evidence for a role in protein secretion. Mol. Microbiol. 17:169-181[CrossRef][Medline]. |
| 66. | Penheiter, K. L., N. Mathur, D. Giles, T. Fahlen, and B. D. Jones. 1997. Non-invasive Salmonella typhimurium mutants are avirulent because of an inability to enter and destroy M cells of ileal Peyer's patches. Mol. Microbiol. 24:697-709[CrossRef][Medline]. |
| 67. | Pratt, L. A., and T. J. Silhavy. 1995. Porin regulon of Escherichia coli, p. 105-127. In J. A. Hoch, and T. J. Silhavy (ed.), Two-component signal transduction. American Society for Microbiology, Washington, D.C. |
| 68. | Quail, M. A., C. E. Dempsey, and J. R. Guest. 1994. Identification of a fatty acyl responsive regulator (FarR) in Escherichia coli. FEBS Lett. 356:183-187[CrossRef][Medline]. |
| 69. |
Rakeman, J. L.,
H. R. Bonifield, and S. I. Miller.
1999.
A HilA-independent pathway to Salmonella typhimurium invasion gene transcription.
J. Bacteriol.
181:3096-3104 |
| 70. | Sanderson, K. E., and B. A. D. Stocker. 1987. Salmonella typhimurium strains used in genetic analysis, p. 1220-1224. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. |
| 71. |
Schaefer, A. L.,
D. L. Val,
B. L. Hanzelka,
J. E. Cronan, Jr., and E. P. Greenberg.
1996.
Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein.
Proc. Natl. Acad. Sci. USA
93:9505-9509 |
| 72. | Schechter, L. M., S. M. Damrauer, and C. A. Lee. 1999. Two AraC/XylS family members can independently counteract the effect of repressing sequences upstream of the hilA promoter. Mol. Microbiol. 32:629-642[CrossRef][Medline]. |
| 73. | Schechter, L. M., and C. A. Lee. 2000. Salmonella invasion of non-phagocytic cells, p. 289-320. In T. A. Oelschlaeger, and J. H. Hacker (ed.), Subcellular biochemistry, vol. 33. Bacterial invasion into eukaryotic cells. Kluwer Academic/Plenum Publishers, New York, N.Y. |
| 74. |
Schiemann, D. A., and S. R. Shope.
1991.
Anaerobic growth of Salmonella typhimurium results in increased uptake by Henle 407 epithelial and mouse peritoneal cells in vitro and repression of a major outer membrane protein.
Infect. Immun.
59:437-440 |
| 75. |
Schmitt, C. K.,
S. C. Darnell,
V. L. Tesh,
B. A. D. Stocker, and A. D. O'Brien.
1994.
Mutation of flgM attenuates virulence of Salmonella typhimurium, and mutation of fliA represses the attenuated phenotype.
J. Bacteriol.
176:368-377 |
| 76. | Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53:85-96[CrossRef][Medline]. |
| 77. | Spector, M. P. 1998. The starvation-stress response (SSR) of Salmonella. Adv. Microb. Physiol. 40:233-279[Medline]. |
| 78. |
Spector, M. P.,
C. C. DiRusso,
M. J. Pallen,
F. G. D. Portillo,
G. Dougan, and B. B. Finlay.
1999.
The medium/long-chain fatty acyl-CoA dehydrogenase (fadF) gene of Salmonella typhimurium is a phase 1 starvation-stress response (SSR) locus.
Microbiology
145:15-31 |
| 79. |
Tartera, C., and E. S. Metcalf.
1993.
Osmolarity and growth phase overlap in regulation of Salmonella typhi adherence to and invasion of human intestinal epithelial cells.
Infect. Immun.
61:3084-3089 |
| 80. | Utley, M., D. P. Franklin, K. A. Krogfelt, D. C. Laux, and P. S. Cohen. 1998. A Salmonella typhimurium mutant unable to utilize fatty acids and citrate is avirulent and immunogenic in mice. FEMS Microbiol. Lett. 163:129-134[CrossRef][Medline]. |
| 81. |
Valdivia, R. H., and S. Falkow.
1997.
Fluorescence-based isolation of bacterial genes expressed within host cells.
Science
277:2007-2011 |
| 82. | Véscovi, E. G., F. C. Soncini, and E. A. Groisman. 1996. Mg2+ as an extracellular signal: environmental regulation of Salmonella virulence. Cell 84:165-174[CrossRef][Medline]. |
| 83. | Wanner, B. L. 1996. Phosphorus assimilation and control of the phosphate regulon, p. 1357-1381. In F. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nd ed., vol. 1. American Society for Microbiology, Washington, D.C. |
| 84. |
Yang, H.,
M. Y. Liu, and T. Romeo.
1996.
Coordinate genetic regulation of glycogen catabolism and biosynthesis in Escherichia coli via the CsrA gene product.
J. Bacteriol.
178:1012-1017 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»