This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soto, M. J.
Right arrow Articles by Toro, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soto, M. J.
Right arrow Articles by Toro, N.

 Previous Article  |  Next Article 

Journal of Bacteriology, April 2000, p. 1935-1941, Vol. 182, No. 7
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Sinorhizobium meliloti putA Gene Regulation: a New Model within the Family Rhizobiaceae

María José Soto, José Ignacio Jiménez-Zurdo, Pieter van Dillewijn, and Nicolás Toro*

Departamento de Microbiología del Suelo y Sistemas Simbióticos, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, 18008 Granada, Spain

Received 21 October 1999/Accepted 22 December 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Proline dehydrogenase (PutA) is a bifunctional enzyme that catalyzes the oxidation of proline to glutamate. In Sinorhizobium meliloti, as in other microorganisms, the putA gene is transcriptionally activated in response to proline. In Rhodobacter capsulatus, Agrobacterium, and most probably in Bradyrhizobium, this activation is dependent on an Lrp-like protein encoded by the putR gene, located immediately upstream of putA. Interestingly, sequence and genetic analysis of the region upstream of the S. meliloti putA gene did not reveal such a putR locus or any other encoded transcriptional activator of putA. Furthermore, results obtained with an S. meliloti putA null mutation indicate the absence of any proline-responsive transcriptional activator and that PutA serves as an autogenous repressor. Therefore, the model of S. meliloti putA regulation completely diverges from that of its Rhizobiaceae relatives and resembles more that of enteric bacteria. However, some differences have been found with the latter model: (i) S. meliloti putA gene is not catabolite repressed, and (ii) the gene encoding for the major proline permease (putP) does not form part of an operon with the putA gene.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Proline can be catabolized to glutamate by the action of two enzymatic activities: proline dehydrogenase (PDH) and Delta -pyrroline-5-carboxylate dehydrogenase (P5CDH). Whereas in eukaryotes PDH and P5CDH are encoded by two different genes (15, 38), in enteric bacteria (18, 21), Rhodobacter capsulatus (14), Bradyrhizobium japonicum (36), Photobacterium leiognathi (16), Agrobacterium tumefaciens (8), and Sinorhizobium meliloti (13), both steps for proline utilization are catalyzed by a single polypeptide encoded by the putA gene. Although this enzyme is highly conserved among the different microorganisms, the genetic organization and control of expression of the gene are quite divergent (Fig. 1).


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 1.   Genetic organization and models of regulation of the putA gene of different microorganisms. +, activator; -, repressor.

In enteric bacteria, the putA gene belongs to the put operon together with the divergently transcribed putP gene, which encodes the major proline permease. In Escherichia coli, Salmonella enterica serovar Typhimurium, and Klebsiella pneumoniae, in addition to its enzymatic activity, the PutA protein also functions as an autogenous transcriptional repressor of the putA and putP genes. In the absence of proline, PutA remains in the cytoplasm where it binds to the put operators, thereby preventing put gene expression. When a sufficient concentration of proline is available, PutA binds proline and functionally associates with the electron transport chain in the cytoplasmic membrane, where it is enzymatically active. The resulting decrease in cytoplasmic PutA levels releases the repression of the operators, allowing expression of the put genes (1, 19, 20, 24-26). PutA autophosphorylation has been implicated in these regulatory processes (27), and PutA proline dehydrogenase activity is required for the induction of the put operon by proline (23). The putA genes of Klebsiella aerogenes and K. pneumoniae are also positively regulated by the Nac protein (7, 17). Expression of the nac gene is dependent on the Ntr system in which the transcriptional activator NtrC is a key regulatory protein that is activated in nitrogen-limiting conditions. Additionally, the putA gene of all three enteric bacteria is catabolite repressed, requiring cyclic AMP (cAMP) and cAMP receptor protein CRP (7).

In R. capsulatus, the expression of proline dehydrogenase is regulated only by the presence of its substrate via the regulatory gene putR located immediately upstream of putA (14). The putR gene is constitutively expressed at a low level, and its product, which belongs to the class of Lrp-like activator proteins, negatively autoregulates its own transcription. In the absence of proline, PutR activates the expression of putA to a low level. The presence of proline may cause a conformational change in PutR protein, increasing the affinity for the putA promoter and, subsequently, putA gene expression. It has been suggested that the R. capsulatus PutA protein, similar to that of enteric bacteria, represses its own transcription because the expression of the putA promoter in the absence of proline dramatically increased in a putA mutant background. However, as indicated by Cho and Winans (8), it is equally plausible that this effect could be due to the inability of the mutant to catabolize proline, which means a higher pool size of the inducer. On the other hand, no indication of general nitrogen control could be observed in R. capsulatus.

The regulation of putA gene expression in A. tumefaciens is similar in some aspects to that of R. capsulatus: the Agrobacterium putA promoter is also positively regulated by the product of the regulatory gene putR in response to proline. This gene is divergently transcribed from the putA gene and negatively regulates its own synthesis. However, the Agrobacterium putA gene is not autorepressed (8).

The analysis of the sequence upstream of B. japonicum putA indicates the existence of a gene encoding a PutR homologue (8, 36). Thus, the regulation mechanism in this bacteria could be similar to that of Agrobacterium and Rhodobacter.

In P. leiognathi, the putA gene is linked to the lum and lux operons in the genome (16). In this bacterium, although the regulation mechanism of putA is not clearly defined, it has been found that a specific inverted repeat is required to initiate gene expression and that there is no catabolite repression. No putR homologue has been found in the 5' end of the putA gene.

The nucleotide sequence and initial characterization of the S. meliloti putA gene have been reported (12, 13). This gene has been found to be involved in root colonization, nodulation efficiency, and competitiveness of the bacteria on alfalfa roots. Recently, the S. meliloti putA gene has also been implicated in the utilization of stachydrine, a derivative of proline that occurs widely in Medicago species, strengthening the importance of the role of the putA gene in root colonization (28).

In our efforts to better understand the regulation of this key enzyme in S. meliloti, we have found that the expression of putA, contrary to its Rhizobiaceae relatives, is not dependent on a PutR-like protein and that, similarly to enteric bacteria, PutA plays a regulatory role, functioning as an autogenous repressor. Furthermore, some differences from the enteric situation have been found: the absence of carbon source regulation and of a linked proline transporter gene.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains, plasmids, media, and growth conditions. The bacterial strains and plasmids used in this study are listed in Table 1. E. coli was routinely grown in Luria-Bertani medium (LB) (31) or in M3 (PANREAC) medium when selecting with the antibiotic gentamicin. Rhizobial strains were grown at 30°C in tryptone-yeast (4) or in defined minimal medium (MM) (30). Antibiotics were used as required at the following concentrations (in micrograms per milliliter): ampicillin, 200; spectinomycin, 100; streptomycin, 50 for E. coli and 250 for Sinorhizobium; kanamycin, 50 for E. coli and 200 for Sinorhizobium; gentamicin, 10 for E. coli and 30 for Sinorhizobium.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Bacterial strains and plasmids used in this study

DNA manipulations and sequence analysis. Plasmid DNA was routinely isolated and manipulated following standard protocols (31). The nucleotide sequence presented in this work was determined by the chain termination method (32). Cloned DNA in plasmid pDIL102.1 was subjected to controlled exonuclease III-S1 nuclease digestion (Erase-a-Base kit; Promega) to a nested set of deletions, and overlapping clones were selected for sequencing. Plasmid DNA for sequencing was isolated with the Wizard Plus SV Minipreps DNA purification system (Promega), and sequencing was performed in an automatic laser fluorescent DNA sequencer (Applied Biosystems). DNA sequence edition, translation, and analysis were performed with the GeneWorks software package (Intelligenetics Inc.) and the program BLAST from the network service at the National Center for Biotechnology Information (2, 10). The potential secondary operator sites were located by using the DNA mfold server version 3.0 by Michael Zuker.

Construction of the R2 mutant. The upstream region and 5' end of the putA gene from S. meliloti GR4 were excised from plasmid pPDH2 and subcloned in pUC18 as an EcoRI-SalI fragment, creating pDIL102.1. The sequence corresponding to the upstream region was disrupted by introducing the gentamicin resistance (Gmr) cassette from pAB2001 into the unique SacI site of pDIL102.1, generating pDIL102.1G. The EcoRI-SalI fragment of the resulting plasmid was cloned into the mobilizable suicide plasmid pK18mob::sacB to give pK102.1. This plasmid was mobilized from E. coli DH5alpha into S. meliloti GRM8 by triparental mating using pRK2013 as a helper plasmid. Transconjugants were selected on solid MM containing gentamicin and 10% sucrose and later tested for sensitivity to kanamycin. Five colonies resulting from the mating (four kanamycin sensitive and one kanamycin resistant) were analyzed by DNA hybridization, using the 765-bp SalI-EcoRI fragment of the putA gene as a probe (Fig. 2). Colonies R1 to R4 were shown to be the result of double crossing-over or gene replacement, while R5 was the result of a single crossover carrying the wild-type gene. Mutant R2 was chosen as an open reading frame 2 (ORF2)/ORF3 mutant for further analysis.


View larger version (19K):
[in this window]
[in a new window]
 
FIG. 2.   Physical map of the S. meliloti putA gene region and organization of putA-lacZ transcriptional fusions. (A) Physical and genetic map of the S. meliloti putA gene region. Arrows indicate DNA sequences of the putA gene and three out of seven ORFs identified in the upstream region. The hatched box represents the Gmr cassette used to create the R2 mutant. (B) DNA fragments fused to the reporter gene lacZ of pRG970 and pMP220. Solid bars indicate DNA sequences of putA. Abbreviations: E, EcoRI; Sc, SacI; Sp, SphI; S, SalI; H, HindIII; B, BamHI.

DNA hybridization. Total DNA from S. meliloti and Agrobacterium was isolated, digested, and blotted to nylon filters by standard procedures (31). Hybridizations were performed overnight at 42°C, using as probes either the 765-bp SalI-EcoRI fragment of the S. meliloti putA gene (Fig. 2), the 2.2-kb EcoRI-SalI fragment containing the upstream region and the 5' end of the putA gene (Fig. 2), or the 1.6-kb XhoI-ClaI fragment from plasmid pPC6 (26), containing the Salmonella serovar Typhimurium putP gene. Agarose gel-purified fragments were labeled with digoxigenin (DIG) by random priming. Filters were washed under high-stringency conditions, and detection of hybridized DNA was performed with a DIG luminescent detection kit as specified by the manufacturer (Boehringer, Mannheim, Germany).

Construction of transcriptional putA-lacZ fusions and beta -galactosidase assays. To analyze the regulation of the S. meliloti putA expression, putA-lacZ fusions were created.

(i) Plasmid fusions were constructed in the mobilizable broad-host-range vector plasmids pRG970 and pMP220. The 883-bp BamHI fragment from pJZP3 and the 683-bp BamHI fragment from pJZP4 and pMP43 carrying overlapping fragments spanning the upstream region of the putA promoter were obtained by PCR using pPDH2 as the template. The 5' primers used were P3 (GTGGATCCCCGCCCATCAGAATTT, annealing with nucleotides [nt] 1145 to 1160 from the 5' EcoRI site) and P4 (GTGGATCCCCTGCAAGGTTTACGA, annealing with nt 1340 to 1355 from the 5' EcoRI site) (Fig. 2 and 3). In both cases the 3' primer was PR (GTGGATCCCGAGATGCGATTTCCA, located 385 bp downstream of the putA gene start codon). In the three primers, extra BamHI sites (indicated in bold) were added to facilitate subsequent cloning. The corresponding 883- and 683-bp PCR fragments were digested with BamHI and subcloned in pRG970, resulting in plasmids pJZP3 and pJZP4, respectively. The correct orientation was identified by PCR and checked by sequencing. Whereas the shorter PCR product in pJZP4 did not show any mismatch in the regulatory region, the cloned DNA in pJZP3 showed two transitions at positions 1257 and 1350 (Aright-arrowC and Tright-arrowC, respectively) (Fig. 3). To create pMH310, a 749-bp SphI-SalI fragment of pPDH2 was subcloned between the same sites of pUC18, creating pMH31. This plasmid was digested with SphI, treated with T4 DNA polymerase to obtain blunt ends, and digested with BamHI. Finally, the resulting 756-bp fragment was introduced between the SmaI and BamHI sites of pRG970. The putA-lacZ transcriptional fusions in pMP220, pMP301, and pMP43 were obtained by subcloning the 2,184-bp BamHI fragment from pJZ301 (13) and the 683-bp BamHI fragment from pJZP4, respectively, in the BglII site of pMP220. The hybrid plasmids pJZP3, pJZP4, pMH310, pMP301, and pMP43 were mobilized from E. coli DH5alpha into S. meliloti by triparental mating using pRK2013 as the helper plasmid.


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 3.   DNA sequence of the upstream region of the S. meliloti putA gene. Numbers indicate positions relative to the EcoRI site located in the upstream region (Fig. 2). The beginning of the putA gene as well as the putA-lacZ transcriptional fusions pJZP3, pJZP4, and pMH310 are marked by arrows. Mismatches in pJZP3 resulting from amplification with Taq polymerase are shown with asterisks. The dot indicates the center of the dyad symmetry sequence. Lines under the sequence represent nucleotides that form part of a stem. The -10 and -35 consensus sequences of the putA promoter and the putative Shine-Dalgarno (S/D) sequence are also indicated.

(ii) The putA-lacZ fusion was integrated into the chromosome of GRM8 and the LM1 PutA- strain by allelic exchange using the mobilizable suicide plasmid pK18mob::sacB. The putA-lacZ fusion of the plasmid pJZP4 was subcloned as a 7.3-kbp SmaI-PstI fragment between the same sites of pK18mob::sacB, creating pKFP4. To facilitate selection after recombination in the LM1 PutA- strain, the Omega -interposon cassette of pHP45Omega conferring resistance to streptomycin and spectinomycin (Smr/Spr cassette) was cloned into the SmaI site of pKFP4, resulting in pFS2 (Fig. 4A). This plasmid was mobilized to the S. meliloti strains by triparental mating. The transconjugants were selected on solid MM containing kanamycin, streptomycin, and spectinomycin and later tested for sensitivity to sucrose. The resulting colonies were analyzed by DNA hybridization.


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4.   Chromosomal putA-lacZ fusions in putA+ and putA genetic backgrounds. (A) Physical map of the pFS2 plasmid used to create a chromosomal putA-lacZ transcriptional fusion. (B) Genetic organization of the putA-lacZ transcriptional fusion following Campbell-type recombination of pFS2 plasmid in the PutA+ strain GRM8, creating GRMFS2, and in the PutA- strain LM1, creating LMFS29. Whereas GRMFS2 is the result of integration of pFS2 in the 683 bp comprising the upstream region and the 5' end of the putA gene, in LMFS29 the integration occurred in the mob site of the Tn5 element present in LM1. The dashed circle and lines represent the mobilizable suicide pK18mob::sacB vector. The hatched box represents the Smr/Spr cassette that allows selection in the Kmr LM1 mutant. The transcriptional fusion is represented by the thick line, and the white bar corresponding to the 683-bp BamHI fragment and the lacZ gene, respectively, from plasmid pJZP4. Black bars indicate DNA sequences of the putA gene. The narrow dotted black bars represent sequences corresponding to the Tn5 insertion element present in LM1. The narrow dotted white bars indicate the mob regions of the Tn5 and plasmid pFS2.

Levels of beta -galactosidase activity in the transconjugants were determined by the sodium dodecyl sulfate-chloroform method as described by Miller (22) in S. meliloti cultures grown in MM broth under different inducing conditions.

Nucleotide sequence accession number. The nucleotide sequence presented here has been submitted to the EMBL database under accession no. AJ27335.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

DNA sequence analysis of the region upstream of the S. meliloti putA gene. To determine whether an additional gene belonging to a putative put operon was present upstream of the S. meliloti putA gene, we sequenced 1,500 bp of this upstream DNA region. Sequence analysis showed the presence of seven ORFs encoding proteins larger than 100 amino acids, four of which were divergently transcribed from the putA gene. However, database searches revealed that none of them showed significant homology to the putR gene or other members of the Lrp family of transcriptional regulators, either at the amino acid or the nucleotide level. Similarly, no significant homology to the gene encoding the major proline permease (putP) was found. Furthermore, hybridization experiments performed with a putP probe from Salmonella serovar Typhimurium indicated that an S. meliloti putP gene homologue is present in another location within the genome (data not shown). The 268-amino-acid protein encoded by ORF1 (Fig. 2) showed 20% identity to cyclic 3',5'-adenosine monophosphate phosphodiesterase (CpdA) from E. coli (11) and the CpdA homologues from Mycobacterium leprae and Haemophilus influenzae. The 104-amino-acid polypeptide encoded by ORF2 (Fig. 2) revealed 32% identity to a putative ferredoxin from Acinetobacter calcoaceticus (data not shown). In addition, analysis of the secondary structure of the DNA upstream of putA revealed the presence of a dyad symmetry sequence (Fig. 3) which could serve as operator site (see Discussion).

Mutational analysis of the upstream region of the S. meliloti putA gene. Despite the absence of homologies, ORF3 (Fig. 2) shows some features similar to the putR gene identified in Rhodobacter and Agrobacterium. It encodes a polypeptide of similar size and is divergently transcribed from putA. To determine whether this ORF codes for a transcriptional activator of putA, a Gmr cassette was cloned into its unique SacI restriction site (thereby also disrupting ORF2) (Fig. 2). This mutation was introduced into S. meliloti GRM8 by allelic exchange, and the resulting strain R2 was tested for proline utilization. In contrast to the LM1 PutA- strain, mutant R2 was able to grow in media using either ornithine (whose immediate and major degradation product is proline [34]) or proline as sole carbon and nitrogen source (data not shown). These results indicate that the ORF knocked out in R2 (ORF2/ORF3) is not necessary for proline utilization.

Expression of transcriptional putA-lacZ fusions in different genetic backgrounds. To analyze the regulation of the S. meliloti putA expression, we used putA-lacZ plasmid fusions based on two different reporter systems (pRG970 and pMP220) as well as a putA-lacZ chromosomal fusion. The results obtained are presented in Tables 2 and 3.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Ex planta expression of putA-lacZ transcriptional fusions in S. meliloti GRM8 and its PutA- mutant derivative LM1


                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Ex planta expression of deleted-promoter putA-lacZ transcriptional fusionsa

pRG970 and pMP220, the lacZ promoterless vectors, were used as controls. The background levels of endogenous beta -galactosidase activity in S. meliloti GRM8 and the PutA- strain LM1 carrying pRG970 or pMP220 were unaffected by the addition of proline to the media; GRM8 cells carrying plasmid pJZ301 and grown in MM supplemented with proline showed an increase in beta -galactosidase activity of about 5-fold, whereas pMP301 fusion displayed a 15-fold increase in beta -galactosidase activity in the same genetic background and culture conditions (Table 2). These values represent levels of induction approximately threefold higher than those observed with the equivalent pRG970-derived fusion, which could be due to an effect of the reporter system. These data confirm previous results demonstrating proline transcriptional activation of the S. meliloti putA gene (13, 28). In Agrobacterium the amino acid valine is also a putA gene inducer. However, the addition of valine to the media did not significantly affect the basal levels of beta -galactosidase activity in GRM8 cells carrying either pJZ301 or pMP301 (data not shown).

In the PutA- strain LM1, the fusion pJZ301 exhibited a basal beta -galactosidase activity 9- to 17-fold higher than that in the parental strain GRM8 (Table 2). More interestingly, we found that in the PutA- background, proline did not induce putA gene expression. The increased basal expression and the loss of proline inducibility of the putA promoter in a PutA- background suggest that S. meliloti PutA functions as an autogenous repressor and additionally that a proline-responsive transcriptional activator is lacking. However, Jiménez-Zurdo et al. (13) reported that in a PutA- background, the inducibility of the putA gene expression by proline was retained. To resolve this discrepancy in results, we analyzed the expression of a similar putA-lacZ transcriptional fusion in a different reporter system, the IncP vector pMP220. As we observed with pJZ301, in the PutA- strain LM1, the pMP301 fusion exhibited basal beta -galactosidase activity 10- to 14-fold higher than that in the parental strain GRM8 (Table 2); similarly, in the presence of proline we did not observe induction of the putA gene. Thus, the data obtained using two different reporter systems further confirm that S. meliloti PutA functions as an autogenous repressor and that a proline-responsive transcriptional activator is lacking. However, an important drawback of using transcriptional plasmid fusions is that we have no evidence that the copy number of the plasmids remains unchanged in each of the strains and under the different growth conditions, which therefore could influence the determined levels of activity. To rule out this possibility, we decided to integrate the putA-lacZ transcriptional fusion present in the pJZP4 construction (Fig. 2) into the chromosome of the PutA+ strain GRM8 and the PutA- strain LM1. To do this, we created the mobilizable suicide plasmid pFS2 (Fig. 4A; Table 1). Campbell-type integration of pFS2 in GRM8 and LM1 created the GRMFS2 and LMFS29 mutant strains, respectively (Fig. 4B). Hybridization analysis performed using as a probe the 2.2-kb EcoRI-SalI fragment containing the upstream region and 5' end of the putA gene (Fig. 2), revealed that whereas GRMFS2 is the result of integration of pFS2 in the 700 bp of the putA upstream region, in LMFS29 the integration occurred in the mob site of the Tn5 insertion present in LM1 (data not shown). We found that in the absence of proline, beta -galactosidase basal expression in the PutA- strain LMFS29 was 10- to 13-fold higher than in the PutA+ strain GRMFS2 (Table 2). In addition, whereas the fusion in GRMFS2 was induced 9- to 11-fold in the presence of proline, no proline inducibility of the fusion in LMFS29 was observed, confirming the conclusions obtained with the plasmid reporter systems.

We have observed that the presence of proline in the MM caused problems in the growth of the PutA- strain LM1. To rule out the possibility that this could cause any effect in putA expression, we decided to analyze the activity of the putA promoter in exponential-phase growing cultures containing either the plasmid or the chromosomal transcriptional fusion after short incubation times with the inducer. Results showed that 2 h after the addition of proline, both GRM8 cells containing the plasmid transcriptional fusion and the GRMFS2 strain displayed levels of putA induction similar to those described in Table 2, whereas in PutA- cells the beta -galactosidase activity remained constant 4 h after the addition of the inducer (data not shown). These data indicate that the lower growth rate shown by the PutA- strain in MM containing proline has no significant effect in putA expression and confirm the results described above.

Deletion analysis of the putA gene promoter region. To further characterize the putA gene promoter, three additional transcriptional fusions of putA promoter fragments to lacZ were analyzed (Fig. 2; Table 3). Since the fusions pJZP3 and pJZP4 showed similar beta -galactosidase activities in the different genetic backgrounds, only the results obtained with the latter are shown. We observed a 17-fold increase in beta -galactosidase activity in GRM8 (pJZP4) cells grown in MM supplemented with proline; the equivalent pMP220-derived fusion exhibited a 15-fold increase in beta -galactosidase activity when GRM8 cells were grown in the presence of proline; in a PutA- background, fusions pJZP4 and pMP43 displayed increased basal expression of the lacZ gene and loss of proline inducibility (Table 3). These data define a functional promoter region extended 290 nt upstream of the putA gene start codon that contains the elements necessary for proline inducibility.

The plasmid fusion pMH310 displayed in both PutA+ and PutA- cells a basal level of beta -galactosidase activity similar to that of cells containing the control plasmid pRG970, and this activity was not altered by the presence of proline (Table 3). These data suggest that the transcriptional fusion pMH310 lacks promoter sequences necessary for the expression of the putA gene located in the additional 100 nt present in the pJZP4 construction.

S. meliloti putA gene is not catabolite repressed. The results described above suggest a model for putA repression similar to that described for Enterobacteriaceae. In enteric bacteria, the expression of the put operon is repressed by glucose. The catabolite repression of the Klebsiella and E. coli put operons is relieved during nitrogen starvation. In contrast, nitrogen starvation does not efficiently relieve catabolite repression of the Salmonella serovar Typhimurium put operon, which means that these bacteria are unable to grow in medium with glucose as a carbon source and proline as the sole nitrogen source (19). To test whether the S. meliloti putA gene is catabolite repressed, we compared putA expression of GRM8 cells containing pJZ301 when grown in different media. GRM8 was able to grow with glucose as a carbon source and proline as the sole nitrogen source. Furthermore, the levels of expression of S. meliloti putA were similar whether glucose is present or not (data not shown), strongly suggesting that the rhizobial gene is not catabolite repressed.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this report we show that the disruption of the S. meliloti putA gene increases basal expression of the putA promoter and abolishes induction of this gene by exogenous proline. These results indicate (i) that the S. meliloti PutA protein functions as an autogenous repressor and (ii) the lack of a proline responsive transcriptional activator of putA expression.

putA gene regulation has been studied in different bacteria. In Rhodobacter (14), Agrobacterium (8), and probably Bradyrhizobium (36), the expression of PDH is regulated via the transcriptional activator PutR, whose activity requires proline. In Rhodobacter, it has been reported that the PutA protein, similar to that of enteric bacteria, represses its own expression. However, in Agrobacterium the putA gene is not autorepressed. This conclusion has been based on several lines of evidence: (i) the proline inducibility of the gene remains in a putA mutant background; (ii) when saturating levels of proline are provided, the putA mutation has only a small effect on the expression of the putA promoter; and (iii) no differences were found when the noncatabolized inducer valine was used.

In S. meliloti, we found that valine is not an inducer of putA expression. Therefore, we could not test whether a noncatabolized inducer leads to differences between the putA mutant and the parental strain. However, in a putA mutant background, basal expression of the putA promoter increased either 8- to 24-fold (plasmid fusions) or 10- to 16-fold (chromosomal fusion), similar to the levels observed in a Salmonella serovar Typhimurium PDH mutant (15-fold) and contrary to the modest increase (4-fold) shown by an Agrobacterium lacking PutA activity. This suggests that the S. meliloti PutA protein could function as an autogenous repressor. On the other hand, genetic and mutational analyses have revealed that a PutR-like protein is not present upstream of the S. meliloti putA gene. Furthermore, the existence of such an activator-encoded gene elsewhere seems unlikely since proline inducibility of putA expression is not retained in a PutA- background.

A deletion analysis of the region located upstream of the putA gene revealed that the proline inducibility of the promoter is kept within the 290 nt present in the pJZP4 and pMP43 constructions. Furthermore, the decrease of beta -galactosidase activity to background levels in cells containing the pMH310 transcriptional fusion indicate that the promoter sequences necessary for the expression of the putA gene are located between nt 290 and 190 upstream of the translation initiation codon. Recent data in our laboratory have revealed that although the 190 nt in the upstream region do not contain all promoter sequences necessary for putA expression, they are enough to allow proline-responsive induction of the gene when located downstream of a functional promoter (M. J. Soto, unpublished data). Thus, the sequence of dyad symmetry identified within these 190 nt of the putA functional promoter region could be a putative operator site in putA gene regulation. In Salmonella serovar Typhimurium, a complex model for regulation of the put operon has been suggested in which proper contact between PutA proteins bound to different operator sites is facilitated by a loop of curved DNA (25). Whether this is the case in S. meliloti remains to be determined.

Our data suggest a model for regulation of the S. meliloti putA gene similar to that of enteric bacteria, in which the PutA protein is the main regulator of its own transcription in response to proline. However, some differences have been found: (i) the S. meliloti putA gene is not catabolite repressed, and (ii) although present in another location within the genome (data not shown), the gene encoding the major proline permease (putP) does not seem to form part of an operon with the PDH gene. It remains to be determined whether S. meliloti putP is also regulated by PutA.

The absence of a proline-responsive transcriptional activator of the putA gene in S. meliloti is noteworthy compared to the Rhizobiaceae relatives Agrobacterium and Bradyrhizobium. Some similarities at the nucleotide level have been found between the Agrobacterium putR gene and the upstream region of the S. meliloti putA gene (data not shown). If such a putR gene ever existed in S. meliloti, the changes which have occurred within the sequence have been large enough to eliminate the potential to encode a PutR-like protein. It is known that Lrp is a general regulatory protein responsible for the leucine-dependent control of several dozen operons in E. coli (5). However, in R. capsulatus PutR seems to be responsible only for the activation of genes involved in proline utilization. The distinct patterns in the regulation of putA expression within Rhizobiaceae are particularly interesting from an evolutionary point of view and can highlight adaptations to proline metabolism as a consequence of the different associations they establish with plants.


    ACKNOWLEDGMENTS

This work was funded by Comisión Asesora de Investigación Científica y Técnica (BIO96-0397) and by the Biotechnology Programme of the EU (grant B104-CT98-0483). M. J. Soto was supported by an EC (Training & Mobility of Researchers) and an MEC fellowship.


    FOOTNOTES

* Corresponding author. Mailing address: Departamento de Microbiología del Suelo y Sistemas Simbióticos, Estación Experimental del Zaidín, Consejo Superior de Investigaciones Científicas, Profesor Albareda 1, 18008 Granada, Spain. Phone: 34-958-121011. Fax: 34-958-129600. E-mail: ntoro{at}eez.csic.es.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Allen, S. W., A. Senti-Willis, and S. R. Maloy. 1993. DNA sequence of the putA gene from Salmonella typhimurium: a bifunctional membrane-associated dehydrogenase that binds DNA. Nucleic Acids Res. 21:1676[Free Full Text].
2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[CrossRef][Medline].
3. Becker, A., M. Schmidt, W. Jäger, and A. Pühler. 1995. New gentamicin-resistance and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of transcriptional fusions. Gene 162:37-39[CrossRef][Medline].
4. Beringer, J. E. 1974. R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol. 84:188-198[Abstract/Free Full Text].
5. Calvo, J. M., and R. G. Matthews. 1994. The leucine-responsive regulatory protein, a global regulator of metabolism in Escherichia coli. Microbiol. Rev. 58:466-490[Abstract/Free Full Text].
6. Casadesús, J., and J. Olivares. 1979. Rough and fine linkage mapping of the Rhizobium meliloti chromosome. Mol. Gen. Genet. 174:203-209[CrossRef][Medline].
7. Chen, L. M., and S. Maloy. 1991. Regulation of proline utilization in enteric bacteria: cloning and characterization of the Klebsiella put control region. J. Bacteriol. 173:783-790[Abstract/Free Full Text].
8. Cho, K., and S. C. Winans. 1996. The putA gene of Agrobacterium tumefaciens is transcriptionally activated in response to proline by an Lrp-like protein and is not autoregulated. Mol. Microbiol. 22:1025-1033[CrossRef][Medline].
9. Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648-1652[Abstract/Free Full Text].
10. Gish, W., and D. J. States. 1993. Identification of protein coding regions by database similarity search. Nat. Genet. 3:266-272[CrossRef][Medline].
11. Imamura, R., K. Yamanaka, T. Ogura, S. Hiraga, N. Fujita, A. Ishihama, and H. Niki. 1996. Identification of the cpdA gene encoding cyclic 3',5'-adenosine monophosphate phosphodiesterase in Escherichia coli. J. Biol. Chem. 271:25423-25429[Abstract/Free Full Text].
12. Jiménez-Zurdo, J. I., P. van Dillewijn, M. J. Soto, M. R. de Felipe, J. Olivares, and N. Toro. 1995. Characterization of a Rhizobium meliloti proline dehydrogenase mutant altered in nodulation efficiency and competitiveness on alfalfa roots. Mol. Plant-Microbe Interact. 8:492-498[Medline].
13. Jiménez-Zurdo, J. I., F. M. García-Rodríguez, and N. Toro. 1997. The Rhizobium meliloti putA gene: its role in the establishment of the symbiotic interaction with alfalfa. Mol. Microbiol. 23:85-93[CrossRef][Medline].
14. Keuntje, B., B. Masepohl, and W. Klipp. 1995. Expression of the putA gene encoding proline dehydrogenase from Rhodobacter capsulatus is independent of NtrC regulation but requires an Lrp-like activator protein. J. Bacteriol. 177:6432-6439[Abstract/Free Full Text].
15. Krywicki, K. A., and M. C. Brandriss. 1984. Primary structure of the nuclear PUT2 gene involved in the mitochondrial pathway for proline utilization in Saccharomyces cerevisiae. Mol. Cell. Biol. 4:2837-2842[Abstract/Free Full Text].
16. Lin, J. W., K. Y. Yu, H. Y. Chen, and S. F. Weng. 1996. Regulatory region with putA gene of proline dehydrogenase that links to the lum and the lux operons in Photobacterium leiognathi. Biochem. Biophys. Res. Commun. 219:868-875[CrossRef][Medline].
17. Macaluso, A., E. Best, and R. Bender. 1990. Role of the nac gene product in the nitrogen regulation of some NTR-regulated operons in Klebsiella aerogenes. J. Bacteriol. 172:7249-7255[Abstract/Free Full Text].
18. Maloy, S. R. 1987. The proline utilization operon, p. 1513-1519. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C.
19. Maloy, S. R., and J. R. Roth. 1983. Regulation of proline utilization in Salmonella typhimurium: characterization of put::Mu d(Ap, lac) operon fusions. J. Bacteriol. 154:561-568[Abstract/Free Full Text].
20. Maloy, S. R., and V. Stewart. 1993. Autogenous regulation of gene expression. J. Bacteriol. 175:307-316[Free Full Text].
21. Menzel, R., and J. Roth. 1981. Purification of the putA gene product: a bifunctional membrane-bound protein from Salmonella typhimurium responsible for the two-step oxidation of proline to glutamate. J. Biol. Chem. 256:9755-9761[Abstract/Free Full Text].
22. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
23. Muro-Pastor, A. M., and S. Maloy. 1995. Proline dehydrogenase activity of the transcriptional repressor PutA is required for induction of the put operon by proline. J. Biol. Chem. 270:9819-9827[Abstract/Free Full Text].
24. Muro-Pastor, A. M., P. Ostrovsky, and S. Maloy. 1997. Regulation of gene expression by repressor localization: biochemical evidence that membrane and DNA binding by the PutA protein are mutually exclusive. J. Bacteriol. 179:2788-2791[Abstract/Free Full Text].
25. Ostrovsky, P., K. O'Brien, and S. Maloy. 1991. Regulation of proline utilization in Salmonella typhimurium: a membrane-associated dehydrogenase binds DNA in vitro. J. Bacteriol. 173:211-219[Abstract/Free Full Text].
26. Ostrovsky, P., and S. Maloy. 1993. PutA protein, a membrane-associated flavin dehydrogenase, acts as a redox-dependent transcriptional regulator. Proc. Natl. Acad. Sci. USA 90:4295-4298[Abstract/Free Full Text].
27. Ostrovsky, P. C., and S. Maloy. 1995. Protein phosphorylation on serine, threonine, and tyrosine residues modulates membrane-protein interactions and transcriptional regulation in Salmonella typhimurium. Genes Dev. 9:2034-2041[Abstract/Free Full Text].
28. Phillips, D. A., E. S. Sande, J. A. C. Vriezen, F. J. De Bruijn, D. Le Rudulier, and C. M. Joseph. 1998. A new genetic locus in Sinorhizobium meliloti is involved in stachydrine utilization. Appl. Environ. Microbiol. 64:3954-3960[Abstract/Free Full Text].
29. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313[CrossRef][Medline].
30. Robertsen, B. K., P. Aiman, A. G. Darvill, M. McNeil, and P. Alberstein. 1981. The structure of acidic extracellular polysaccharides secreted by Rhizobium leguminosarum and Rhizobium trifolii. Plant Physiol. 67:389-400[Abstract/Free Full Text].
31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
32. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
33. Schäfer, A., A. Tauch, W. Jäger, J. Kalinowski, G. Thierbach, and A. Pühler. 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145:69-73[CrossRef][Medline].
34. Soto, M. J., P. van Dillewijn, J. Olivares, and N. Toro. 1994. Ornithine cyclodeaminase activity in Rhizobium meliloti. FEMS Microbiol. Lett. 119:209-214[CrossRef].
35. Spaink, H. P., R. J. H. Okker, C. A. Wijffelman, E. Pees, and B. J. J. Lugtenberg. 1987. Promoters in the nodulation region of the Rhizobium leguminosarum Sym plasmid pRL1JI. Plant Mol. Biol. 9:27-39.
36. Straub, P. F., P. H. S. Reynolds, S. Althomsons, V. Mett, Y. Zhu, G. Shearer, and D. H. Kohl. 1996. Isolation, DNA sequence analysis, and mutagenesis of a proline dehydrogenase gene (putA) from Bradyrhizobium japonicum. Appl. Environ. Microbiol. 62:221-229[Abstract].
37. Van den Eede, G., R. Deblaere, K. Goethals, M. Van Montagu, and M. Holsters. 1992. Broad host range and promoter selection vectors for bacteria that interact with plants. Mol. Plant-Microbe Interact. 5:228-234[Medline].
38. Wang, S. S., and M. C. Brandriss. 1987. Proline utilization in Saccharomyces cerevisiae: sequence, regulation, and mitochondrial localization of the PUT1 gene product. Mol. Cell. Biol. 7:4431-4440[Abstract/Free Full Text].
39. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119[CrossRef][Medline].


Journal of Bacteriology, April 2000, p. 1935-1941, Vol. 182, No. 7
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Gu, D., Zhou, Y., Kallhoff, V., Baban, B., Tanner, J. J., Becker, D. F. (2004). Identification and Characterization of the DNA-binding Domain of the Multifunctional PutA Flavoenzyme. J. Biol. Chem. 279: 31171-31176 [Abstract] [Full Text]  
  • Nakada, Y., Nishijyo, T., Itoh, Y. (2002). Divergent Structure and Regulatory Mechanism of Proline Catabolic Systems: Characterization of the putAP Proline Catabolic Operon of Pseudomonas aeruginosa PAO1 and Its Regulation by PruR, an AraC/XylS Family Protein. J. Bacteriol. 184: 5633-5640 [Abstract] [Full Text]  
  • van Dillewijn, P., Soto, M. J., Villadas, P. J., Toro, N. (2001). Construction and Environmental Release of a Sinorhizobium meliloti Strain Genetically Modified To Be More Competitive for Alfalfa Nodulation. Appl. Environ. Microbiol. 67: 3860-3865 [Abstract] [Full Text]  
  • Vílchez, S., Manzanera, M., Ramos, J. L. (2000). Control of Expression of Divergent Pseudomonas putida put Promoters for Proline Catabolism. Appl. Environ. Microbiol. 66: 5221-5225 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Soto, M. J.
Right arrow Articles by Toro, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Soto, M. J.
Right arrow Articles by Toro, N.