Previous Article | Next Article ![]()
Journal of Bacteriology, April 2000, p. 2037-2042, Vol. 182, No. 7
Departments of Microbiology and
Immunology1 and
Pathology,2 New York Medical
College, Valhalla, New York 10595
Received 6 July 1999/Accepted 4 January 2000
BmpA, BmpB, BmpC, and BmpD are homologous Borrelia
burgdorferi lipoproteins of unknown functions, encoded by the
bmp genes of paralogous chromosomal gene family 36. At
least some of the Bmp proteins are immunogens in infected vertebrate
hosts. The genetic organization of the bmp region has been
characterized for a variety of B. burgdorferi sensu lato
strains by Southern hybridization, PCR amplification, and DNA
sequencing. All four bmp genes were present in the same
relative order in all B. burgdorferi sensu lato low- and
high-passage-number isolates. While there were no differences in the
relative orders of the bmp genes in these species,
variations in DNA sequence in the bmpD-bmpC and bmpC-bmpA intergenic regions were significantly more common
than in the corresponding 3' bmpD and bmpC
coding regions. The genetic structure of the chromosomal region
containing the bmp genes thus appears to be well conserved
across different species of B. burgdorferi, but variations
in DNA fine structure that prevent PCR primer annealing may occur in
this region and make Southern hybridization much more reliable than PCR
for detection of the presence of these genes. Our results also suggest
that bmp gene products may be used as reagents in the
preparation of vaccines and diagnostic assays to protect against and
diagnose Lyme disease produced by B. burgdorferi sensu lato.
DNA sequencing of Borrelia
burgdorferi B31 has identified open reading frames that encode at
least 105 lipoproteins belonging to several redundant gene families
(6). Paralogous plasmid and chromosomal genes encoding
lipoproteins are, in general, characteristic of the B. burgdorferi genome (6) and include bmp
(1, 17, 19), erp (21), the 2.9 gene
family (16), and vls, the B. hermsii
vmp homologue (24). While DNA of any of these gene
families could be a substrate for stochastic genetic rearrangement to
yield variation in gene expression and/or antigenic variation
(14), this phenomenon has not yet been demonstrated to occur
in B. burgdorferi infections.
In B. burgdorferi B31, bmp genes (paralogous gene
family 36) are located in tandem in the chromosome in the order
bmpD bmpC bmpA bmpB in a region extending from nucleotides
391932 to 396563 (6). They are also present in the
chromosomes of other B. burgdorferi strains (1, 17,
19). In B. burgdorferi B31, DNA sequence homologies
among bmp genes range from 56 to 64%. DNA sequence analysis
has suggested that bmpC is preceded by two promoters (1), that bmpD and bmpA are preceded
by individual promoters (17, 19), and that bmpB
is preceded by no promoter (19). The putative
bmpA promoter is located within the bmpC coding
sequence (1, 19). Although the functions of the proteins
encoded by the bmp genes are unknown, Borrelia
organisms in culture synthesize mRNAs of all four bmp genes
(17; E. Dobrikova, V. Gorbacheva, and F. C. Cabello, unpublished data) and antibodies to BmpA, BmpC, and BmpD
proteins are present in infected hosts (1, 2, 17, 19). These
data suggest that the functions of these proteins may be necessary for
in vitro and in vivo growth and that at least three members of this
family may have a role in virulence (4).
Very few genes of B. burgdorferi that are involved in
virulence have been identified as a result of obtaining the complete sequence of this organism (6). Analysis of a B. burgdorferi chromosomal region whose genes code for exposed,
putatively in vivo-induced and clearly immunogenic lipoproteins may
therefore be relevant to Borrelia virulence. The presence of
Bmp proteins on the surface of B. burgdorferi, the tandem
arrangement of their genes in the chromosome of Borrelia,
and their overlapping transcriptional signals suggest that these
proteins may be virulence related and that the expression of their
genes may be coregulated (1, 17, 19).
It is not known whether bmp genes are present in the genomes
of all isolates of B. burgdorferi sensu lato, but at least
bmpC and bmpA have been identified in B. garinii and B. afzelii (1, 17, 19). To
provide a basis for understanding the role that chromosomally encoded
Bmp proteins might play in the biology of B. burgdorferi and
in the pathogenesis of Lyme disease, and to evaluate the usefulness of
Bmp proteins as reagents for diagnosis of Lyme disease produced by
different Borrelia strains (1, 18), the
structures of the bmp regions in several Borrelia
species were analyzed using DNA hybridization, PCR amplification, and DNA sequencing. There were no differences in the relative order of the
bmp genes in these species, but variations in DNA sequence were significantly more common in intergenic regions than in coding regions.
Bacterial strains and culture.
B. burgdorferi B31 (ATCC
35210) and 297 (20); 10 B. burgdorferi sensu
stricto strains recently isolated from skin biopsies and blood samples
from patients with Lyme disease and passaged only once (10);
B. garinii G25 and N34 (from R. Marconi); B. afzelii Ip3 (9), ACA1 (3), VS461
(9), and VS486 (from J. Benach); B. bissettii
25015 (formerly B. burgdorferi sensu lato group DN127)
(22); B. andersonii 21038 (from R. Marconi); B. japonica H014 (13); and B. hermsii
(from R. Johnson) were grown at 32 to 34°C in BSK-H medium
supplemented with 7% rabbit serum (Sigma Chemical Co., St. Louis, Mo.)
(7). Strains were cloned by two rounds of limiting dilution
in BSK-H medium or by subsurface agarose colony isolation
(5). Cell concentration was determined by counting cells
stained with acridine orange under fluorescence microscopy
(23) or by counting viable cells on agarose plates
(5). Comparable results were obtained by both techniques.
Southern hybridization.
Total DNA from each
Borrelia strain was purified from a mid-log-phase culture
(8) and digested overnight with SwaI and/or HindIII (New England Biolabs, Inc., Beverly, Mass.)
according to the manufacturer's instructions. The resulting DNA
fragments were separated by agarose gel electrophoresis (1% agarose in
Tris-acetate-EDTA [TAE] buffer), stained with ethidium bromide, and
transferred by capillary action to a nylon membrane (Magna Graph;
Micron Separation, Inc., Westboro, Mass.) (1). DNA probes
were generated by PCR using partial (P) primers (Fig.
1) to amplify the central part of each
bmp gene. Templates for these reactions were pUC19-based plasmids containing different DNA segments of the bmp region
of B. burgdorferi 297 (2). A DNA probe targeting
the flaB gene for use as a control was obtained by PCR
amplification by using total DNA purified from B. burgdorferi 297 as a template and appropriate primers
(5'-CTAGTGGGTACAGAATTAATCGAGC-3' and
5'-GCCTGCGCAATCATTGCCATTGC-3') (11). DNA probes
were purified, labeled with digoxigenin-11-dUTP by the random primer
method according to the instructions of the manufacturer (Boehringer
Mannheim, Indianapolis, Ind.), hybridized to DNA blots at 65°C, and
washed under high-stringency conditions in 0.5× SSC (1× SSC is 0.15 M
NaCl plus 0.015 M sodium citrate) buffer at 68°C (1).
Bound probes were detected colorimetrically using nitroblue tetrazolium
and BCIP (5-bromo-4-chloro-3-indolylphosphate) technology according to
the manufacturer's instructions.
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Analysis of the bmp Gene Family in Borrelia
burgdorferi Sensu Lato
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References

View larger version (16K):
[in a new window]
FIG. 1.
Schematic representation of the PCR primer binding sites
in the bmp chromosomal region. The sequence of this region
was created on the basis of sequences of bmpD from B. burgdorferi JD1 (accession no. U35450) (17) and
bmpC, -A, and -B genes from B. burgdorferi 297 (accession no. U49938) (2) using the
program Primer 3 Output (Center for Genome Research). Position 1 corresponds to nucleotide 396706, and position 5000 corresponds to
nucleotide 391707 on the B. burgdorferi B31 chromosomal map
(6). The relative locations of primer binding sites are
indicated by arrows. W primer pairs are for amplification of the entire
indicated coding sequence, and P primer pairs are for amplification of
partial regions of the indicated coding sequence. All primers with the
suffix (+) are plus-strand primers, and those with the suffix (
) are
minus-strand primers (i.e., reverse complement of the gene sequences).
Primer sequences (5'
3') for the indicated regions were as follows.
bmpD: 7(+), GAATGGCTGAAGCAAATAAAGC(W); 8(
),
CAAATCAGCTCAATAAAAATC (W); 19(+),
CTGATGATGGCAAGTCGGAG(P); 20(
), ACGCCTATACCAGAAAGCCC
(P). bmpC: 15(+),
GGCAAGGGCATATGTTTAAAAGATTTATTTTTATTA (W); 16(
),
CGCAGATCTCCCCTTTACAAACAAAGC (W); 1(+),
GATGAGGCAATGACTGAGGA (P); 2(
),
GCAGCGTCATAAACTCCAAGACC (P). bmpA: 9(+),
TGTAAAGGGGAAATAGTTTATG (W); 10(
), TTCAAACAAAACCAATGTG
(W); 21(+), CCAAGGTTGCGGCTCTTC (P); 22(
),
CTTCTACCAGCTTCAAGGTCAG (P). bmpB: 11(+),
AAACACATTGGTTTTGTTTG (W); 12(
),
TCTTTCTATTTCAAAAGTTTATAAC (W); 23(+),
TGGTGATGATGTTCAGATTCC (P); 24(
), TTTGCTGCCTCAATAACACC
(P). bmpD to bmpC: 3(+),
AGGCCGCAAAAGAGTTGGG; 4(
), GCTACCATGAGCCAAAACACC.
bmpC to bmpA: 5(+),
TGATCGGGGGTTAAAGGAAGG; 6(
), TGAAGAGCCGCAACCTTGGC.
bmpA to bmpB: 13(+),
GGCCTTAAAGAAGGAGTTGTGGG; 14(
),
CCAAATCAAGTCTGAGCC.
PCR. Primers to amplify full-length coding regions and flanking regions of bmp genes (whole [W] primers) or partial internal regions of each bmp gene (P primers) were designed on the basis of nucleotide sequences of the bmpD region of B. burgdorferi JD1 (GenBank accession no. U35450) (17) and the bmpC, bmpA, and bmpB regions of B. burgdorferi 297 (accession no. U49938) (2) by using the program Primer 3 Output (Center for Genome Research, Whitehead Institute for Biochemical Research, Cambridge, Mass.) (Fig. 1) and synthesized (GenoSys Biotechnology, The Woodlands, Tex.). Primers specific for 16S rRNA genes (5'-GAATTTTACAATCTTTCGACC-3' and 5'-GGGGAATAATTATCTCTAAC-3') (10) and the flaB gene (see above) (17) were a gift from I. Schwartz. PCR amplifications were performed in a Rapid Cycler (Idaho Technology, Idaho Falls) according to the manufacturer's recommendations, with the final mixture in 10-µl glass capillary tubes containing a 200 µM concentration of each deoxynucleoside triphosphate, 2 mM MgCl2, 50 mM Tris-HCl (pH 8.3), 0.5 mg of bovine serum albumin/ml, 0.5 to 1% Ficoll (Idaho Technology); 0.25 U of Taq polymerase (Gibco BRL, Gaithersburg, Md.), and 0.5 µM concentrations of primers. Chromosomal DNA was initially denatured for 5 s at 96°C, followed by a total of 30 cycles of 94°C for 0 s, 60°C for 1 s, and 72°C for 30 s and a final cycle of 2 min at 72°C. PCR-generated products were purified and sequenced by the dideoxy chain termination method using a dye terminator-Taq cycle sequencing kit and a model 377 DNA sequencer (Perkin-Elmer, Foster City, Calif.). DNA sequences were aligned and analyzed with Assembly-LIGN and MacVector software (IBI, New Haven, Conn.), Clustal W 1.7, and Laling CCM Search Launcher (Human Genome Center, Baylor, Tex.). Some manual refinement of the alignments was performed.
Detection of bmp genes in B. burgdorferi
sensu lato.
Southern hybridization results are summarized in Table
1. DNA hybridization patterns in Southern
blots with PCR-generated probes specific for each bmp gene
indicated that a single copy of each bmp gene was present in
the genomic DNA of B. burgdorferi sensu lato. Differences in
hybridization patterns of B. burgdorferi strains consisted
of variations in the lengths of the DNA restriction fragments
hybridizing with the DNA probes and in band intensity. For example,
total DNA from B. burgdorferi sensu lato strains digested
with SwaI and hybridized with a P probe specific for bmpC yielded the expected single 1,271-bp band with B. burgdorferi B31; a single 3,750-bp band with B. garinii, B. afzelii, B. afzelii, and
B. japonica; a single 1,750-bp band with B. andersoni; and a major 750-bp band and a minor 550-bp band with
B. bissettii. The additional fragment in B. bissettii is likely generated by an alternative restriction site
for SwaI present inside bmpC in this
Borrelia species. This possibility is supported by the facts that amplification with primers specific for the central partial coding
region of bmpC in this strain generated only one product (Table 1) and that the sum of the molecular masses of the fragments observed during the hybridization was equal to the molecular mass of
the expected fragment containing only one copy of bmpC. B. hermsii total DNA digested in the same manner used as a control failed to hybridize with any of the bmp DNA probes used in
these experiments. A DNA probe for the highly conserved B. burgdorferi flaB gene (11) hybridized to all borrelial
total DNAs examined (both B. burgdorferi sensu lato and
B. hermsii) and gave the expected pattern and sizes of
amplicons (data not shown). This result indicated that the lack of
hybridization of B. hermsii total DNA with bmp DNA probes was unlikely to be due to technical problems related to
hybridization itself.
|
PCR analysis of the bmp genes and their intergenic noncoding regions. PCR amplification of borrelial DNA was done using three groups of primers (Fig. 1). W primers were designed to analyze full-length coding regions of bmp genes and generated amplicons for bmp genes only from B. burgdorferi sensu stricto isolates as well as B. bissettii, from which bmpA was weakly amplified (Table 1). All products obtained with W primer sets were of the expected sizes (data not shown). No products were obtained from B. hermsii DNA with any W primers.
P primers were designed to amplify a partial internal region of each bmp gene. Amplicons corresponding to bmpC and bmpB were obtained from all B. burgdorferi sensu lato strains (Table 1), amplicons corresponding to bmpD were obtained from all B. burgdorferi sensu lato strains but not B. bissettii and B. japonica (Table 1), and amplicons corresponding to bmpA were obtained only from B. burgdorferi sensu stricto and B. andersonii (Table 1). Amplicons had the same size in all tested B. burgdorferi strains when they were obtained with each pair of P primers. For example, all bmpC amplicons of B. burgdorferi sensu lato obtained using P primers 1 and 2 were the predicted size of 484 bp; comparable results were obtained with amplicons from bmpB and bmpD (data not shown). Similar PCR results were obtained with DNAs from cloned and uncloned Borrelia strains (data not shown). No products were obtained from B. hermsii DNA with any P primers. In these experiments, primers specific for 16S rRNA genes yielded amplicons from all borrelial DNA, including B. hermsii DNA (data not shown), suggesting that the failure to amplify bmp genes from B. hermsii DNA and some B. burgdorferi sensu lato DNAs (e.g., bmpA) was not due to template degradation or to the presence of PCR inhibitors and suggested the existence of DNA sequence heterogeneity in this region. As an additional step in revealing possible DNA sequence heterogeneity in the bmp cluster, a third group of primers was designed to amplify bmp intergenic regions. These intergenic primer sets amplified regions extending from the 3' end of the upstream gene to the 5' end of the downstream gene of each bmp. B. burgdorferi sensu stricto and B. andersonii DNAs generated amplicons with single primer pairs designed to amplify bmpD-bmpC, bmpC-bmpA, and bmpA-bmpB intergenic regions (Table 1). In other B. burgdorferi sensu lato strains, only bmpD-bmpC and bmpA-bmpB regions were amplified (Table 1). B. japonica DNA did not generate a product when it was amplified with primers targeting any of the intergenic regions. Other primer sets composed of combinations of different plus- and minus-strand primers (Fig. 1) were used to provide further characterization of the bmp region. These additional primer sets generated amplicons from all B. burgdorferi sensu lato DNAs except that of B. japonica. In each case, the products obtained were of the expected sizes and overlapped throughout the entire bmp region. This result ruled out the possibility that the observed negative PCR amplifications were caused by the presence of extensive deletions in these regions and suggested that the failure to amplify was due to sequence polymorphism. None of the primers directed at amplifying bmp intergenic regions generated any product from B. hermsii DNA.PCR analysis of the bmp chromosomal region in B. burgdorferi low-passage-number strains. Ten B. burgdorferi sensu stricto strains recently isolated from skin biopsies and blood samples from patients with Lyme disease and passaged only once (10) were used to characterize the genetic structure of the bmp chromosomal region in low-passage-number B. burgdorferi strains. All primer sets directed at amplifying full-length and partial coding regions of each bmp gene and of the bmp intergenic regions yielded single DNA products identical in size to those amplified from B. burgdorferi 297 and B31. Although continuous in vitro cultivation can cause significant changes in the B. burgdorferi genome (15), low-passage-number B. burgdorferi sensu stricto strains recently isolated from patients with Lyme disease were identical to B. burgdorferi 297 and B31 in terms of both PCR pattern and amplicon size.
DNA sequence analysis of bmp intergenic regions in
B. burgdorferi sensu lato.
To identify the molecular
basis for the polymorphism observed in the bmp region during
PCR amplification, and to assess the genetic divergence in this region
among different strains of the B. burgdorferi sensu lato
complex, PCR products containing bmpD-bmpC and
bmpC-bmpA intergenic regions were sequenced and compared
(Fig. 2). In those cases when the primer
sets designed to amplify the intergenic region did not yield an
amplification product, combinations of different primers were used to
amplify DNA sequences of an increased size that included the regions of
interest. Because it was not possible to obtain amplification of
B. japonica DNA with any available primer set, this isolate
was not subjected to further analysis.
|
Nucleotide sequence accession numbers. Nucleotide sequences of bmpD-bmpC and bmpC-bmpA intergenic regions have been deposited in GenBank under accession numbers U49934, AF222434, AF222435, AF222436, AF222437, AF222438, AF222439, AF222440, and AF222441.
| |
ACKNOWLEDGMENTS |
|---|
We gratefully acknowledge C. Pavia, R. Johnson, R. Marconi, J. Benach, and D. Liveris for providing us with different Borrelia isolates. We also thank Ira Schwartz for Borrelia 16S ribosomal DNA and flagellin primers and for stimulating discussions regarding DNA sequence analysis. L. Aron provided us with recombinant plasmid DNA containing different DNA segments of the bmp region of the B. burgdorferi 297 chromosome. S. Newman advised us on the use of programs needed for the DNA sequence analysis and in the preparation of the manuscript. H. V. Harrison and M. Steinberg made important contributions in the preparation of the manuscript.
Funds for this work were provided by Public Health Service grants R01 AI43063 and R44 AI36004 to F. C. Cabello.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology and Immunology, New York Medical College, Basic Science Building, Valhalla, NY 10595-1690. Phone: (914) 594-4182. Fax: (914) 594-4176. E-mail: Cabello{at}nymc.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aron, L., M. Alekhun, I. Schwartz, L. Perlee, H. P. Godfrey, and F. C. Cabello. 1994. Cloning and DNA sequence analysis of bmpC, a gene encoding a potential membrane lipoprotein of Borrelia burgdorferi. FEMS Microbiol. Lett. 123:75-82[CrossRef][Medline]. |
| 2. | Aron, L., C. Toth, H. P. Godfrey, and F. C. Cabello. 1996. Identification and mapping of a chromosomal gene cluster of Borrelia burgdorferi containing genes expressed in vivo. FEMS Microbiol. Lett. 145:309-314[CrossRef][Medline]. |
| 3. | Åsbrink, E., B. Hederstedt, and A. Hovmark. 1984. A spirochetal etiology of acrodermatitis chronica atrophicans Herxheimer. Acta Dermato-Venereol. 64:506-512[Medline]. |
| 4. | de Silva, A. M., E. Fikrig, E. Hodzic, F. S. Kantor, S. R. Telford III, and S. W. Barthold. 1998. Immune evasion by tickborne and host-adapted Borrelia burgdorferi. J. Infect. Dis. 177:395-400[Medline]. |
| 5. |
Dever, L. L.,
J. H. Jorgensen, and A. G. Barbour.
1992.
In vitro antimicrobial susceptibility testing of Borrelia burgdorferi: a microdilution MIC method and time-kill studies.
J. Clin. Microbiol.
30:2692-2697 |
| 6. | Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, W. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richarson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic sequence of a Lyme disease spirochete, Borrelia burgdorferi. Nature 390:580-586[CrossRef][Medline]. |
| 7. | Indest, K. J., R. Ramamoorthy, M. Sole, R. D. Gilmore, B. J. B. Johnson, and M. T. Philipp. 1997. Cell-density-dependent expression of Borrelia burgdorferi lipoproteins in vitro. Infect. Immun. 65:1165-1171[Abstract]. |
| 8. | LeFebre, R. B., J. W. Foley, and A. B. Thierman. 1985. Rapid and simplified protocol for isolation and characterization of leptospiral chromosomal DNA for taxonomy and diagnosis. J. Clin. Microbiol. 30:606-608. |
| 9. | Liveris, D., A. Gazumyan, and I. Schwartz. 1995. Molecular typing of Borrelia burgdorferi sensu lato by PCR-restriction fragment length polymorphism analysis. J. Clin. Microbiol. 33:589-595[Abstract]. |
| 10. |
Liveris, D.,
S. Varde,
R. Iyer,
S. Koenig,
S. Bittker,
D. Cooper,
D. McKenna,
R. B. Nadelman,
J. Novakowski,
G. P. Wormser, and I. Schwartz.
1999.
Genetic diversity of Borrelia burgdorferi in Lyme disease in patients as determined by culture versus direct PCR with clinical specimens.
J. Clin. Microbiol.
37:565-569 |
| 11. |
Marconi, R. T., and C. F. Garon.
1992.
Development of polymerase reaction primer sets for diagnosis of Lyme disease for species-specific identification of Lyme disease isolates by 16S rRNA signature nucleotide analysis.
J. Clin. Microbiol.
30:2830-2834 |
| 12. | Marconi, R. T., D. Liveris, and I. Schwartz. 1995. Identification of novel insertion elements, restriction fragment length polymorphism patterns, and discontinuous 23S rRNA in Lyme disease spirochetes: phylogenetic analysis of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates. J. Clin. Microbiol. 33:2427-2434[Abstract]. |
| 13. |
Masuzawa, T.,
Y. Okada,
Y. Yanigahara, and N. Sato.
1991.
Antigenic properties of Borrelia burgdorferi isolated from Ixodes ovatus and Ixodes persulcatus in Hokkaido, Japan.
J. Clin. Microbiol.
29:1568-1573 |
| 14. | Moxon, E. R., P. B. Rainey, M. A. Nowak, and R. E. Lenski. 1994. Adaptive evolution of highly mutable loci in pathogenic bacteria. Microbiology 141:1321-1329[Abstract]. |
| 15. | Norris, S. J., J. K. Howell, S. A. Garza, M. S. Ferdows, and A. G. Barbour. 1995. High- and low-infectivity phenotypes of clonal populations of in vitro-cultured Borrelia burgdorferi. Infect. Immun. 63:2206-2212[Abstract]. |
| 16. |
Porcella, S. F.,
T. G. Popova,
D. R. Akins,
M. Li,
J. D. Radolf, and M. V. Norgard.
1996.
Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and lipoprotein gene family.
J. Bacteriol.
178:3293-3307 |
| 17. | Ramamoorthy, R., L. Povinelli, and M. T. Philipp. 1996. Molecular characterization, genomic arrangement, and expression of bmpD, a new member of the bmp class of genes encoding membrane proteins of Borrelia burgdorferi. Infect. Immun. 64:1259-1264[Abstract]. |
| 18. |
Simpson, W. J.,
W. Burgdorfer,
M. E. Schrumpf,
R. H. Karstens, and T. G. Schwan.
1991.
Antibody to a 39-kilodalton Borrelia burgdorferi antigen (P39) as a marker for infection in experimentally and naturally inoculated animals.
J. Clin. Microbiol.
29:236-243 |
| 19. | Simpson, W. J., W. Cieplak, M. E. Schrumpf, A. G. Barbour, and T. G. Schwan. 1994. Nucleotide sequence and analysis of the gene in Borrelia burgdorferi encoding the immunogenic P39 antigen. FEMS Microbiol. Lett. 119:381-388[CrossRef][Medline]. |
| 20. | Steere, A. C., R. L. Grodzicki, A. N. Kornblatt, J. E. Craft, A. G. Barbour, W. Bergdorfer, G. P. Schmid, E. Johnson, and S. E. Malawista. 1983. The spirochetal etiology of Lyme disease. N. Engl. J. Med. 308:733-740[Abstract]. |
| 21. |
Stevenson, B.,
J. L. Bono,
T. G. Schwan, and P. Rosa.
1998.
Borrelia burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria.
Infect. Immun.
66:2648-2654 |
| 22. | Strle, F., R. N. Picken, Y. Cheng, J. Cimperman, V. Maraspin, S. Lotric-Furlan, E. Ruzic-Sabljic, and M. M. Picken. 1997. Clinical findings for patients with Lyme borreliosis caused by Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities to strain 25015. Clin. Infect. Dis. 25:273-280[Medline]. |
| 23. | West, S. S. 1969. Quantitative microscopy in bacteriology. Ann. N. Y. Acad. Sci. 158:111-122. |
| 24. | Zhang, J.-R., J. M. Hardham, A. G. Barbour, and S. J. Norris. 1997. Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes. Cell 89:275-285[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Appl. Environ. Microbiol. | Infect. Immun. | Eukaryot. Cell |
|---|---|---|
| Mol. Cell. Biol. | J. Virol. | Microbiol. Mol. Biol. Rev. |
| ALL ASM JOURNALS |