Previous Article | Next Article ![]()
Journal of Bacteriology, April 2000, p. 2184-2190, Vol. 182, No. 8
AG Genetik, Fachbereich Biologie,
Universität Oldenburg, D-26111 Oldenburg,1
Marine Mikrobiologie, Fachbereich Biologie/Chemie, Zentrum
für Umweltforschung und Technologie, Universität Bremen,
D-28359 Bremen,2 and Medizinische
Hochschule Hannover, Abteilung Zellbiologie, D-30625
Hannover,3 Germany
Received 5 October 1999/Accepted 27 January 2000
Pseudomonas stutzeri lives in terrestrial and aquatic
habitats and is capable of natural genetic transformation. After
transposon mutagenesis, transformation-deficient mutants were isolated
from a P. stutzeri JM300 strain. In one of them a gene
which coded for a protein with 75% amino acid sequence identity to
PilC of Pseudomonas aeruginosa, an accessory protein for
type IV pilus biogenesis, was inactivated. The presence of type IV pili
was demonstrated by susceptibility to the type IV pilus-dependent phage
PO4, by occurrence of twitching motility, and by electron microscopy.
The pilC mutant had no pili and was defective in twitching motility. Further sequencing revealed that pilC is
clustered in an operon with genes homologous to pilB and
pilD of P. aeruginosa, which are also involved
in pilus formation. Next to these genes but transcribed in the opposite
orientation a pilA gene encoding a protein with high amino
acid sequence identity to pilin, the structural component of type IV
pili, was identified. Insertional inactivation of pilA
abolished pilus formation, PO4 plating, twitching motility, and natural
transformation. The amounts of 3H-labeled P. stutzeri DNA that were bound to competent parental cells and
taken up were strongly reduced in the pilC and
pilA mutants. Remarkably, the cloned pilA genes
from nontransformable organisms like Dichelobacter nodosus
and the PAK and PAO strains of P. aeruginosa fully restored
pilus formation and transformability of the P. stutzeri
pilA mutant (along with PO4 plating and twitching motility). It
is concluded that the type IV pili of the soil bacterium P. stutzeri function in DNA uptake for transformation and that their
role in this process is not confined to the species-specific pilin.
The soil bacterium Pseudomonas
stutzeri is capable of natural genetic transformation
(10). This phenomenon involves the binding of extracellular
DNA to the bacterial cell, the active uptake of the bound DNA, and the
heritable integration of its genetic information. Natural
transformation has been observed in bacterial species from various
taxonomic and trophic groups, including Proteobacteria,
cyanobacteria, and Archaeobacteria, and is considered a
major mechanism of horizontal gene transfer encompassing chromosomal
and plasmid DNA (25, 45, 46).
The physiological state in which cells are transformable is termed
competence and is reached in the late log phase of broth-grown cultures
of P. stutzeri (22). Competence is also achieved
in media prepared from aqueous extracts of various soils (23,
24). During these studies, it was found that P. stutzeri responds to limitations of single nutrients like C, N, or
P by an up-to-290-fold stimulation of transformation (23,
24). Other studies showed that P. stutzeri cells
can take up DNA adsorbed on the surface of sand grains (22).
Further, P. stutzeri is naturally transformable by
broad-host-range plasmids like RSF1010 (3), even when these plasmids do not contain inserts of chromosomal P. stutzeri
DNA (9). More recently, the transformation of P. stutzeri in nonsterile soil by added DNA or by DNA released from
bacteria in the soil was demonstrated (42). Initial
observations suggested that P. stutzeri preferentially takes
up DNA of its own species (10, 22), but recent studies show
that DNA from other prokaryotic or eukaryotic sources is taken up with
efficiency similar to that with which P. stutzeri DNA is
taken up (N. Weger, R. Hashemi, and W. Wackernagel, unpublished data).
In an attempt to identify the genetic determinants for competence and
transformability and to provide the basis for studies on the regulation
of their expression, we have isolated transformation-deficient mutants
of P. stutzeri after transposon and insertion mutagenesis. Here, we report on mutants which demonstrate that P. stutzeri has genes for the formation of type IV pili
(50) and that these are essential for genetic transformation
of P. stutzeri. In particular, we show that insertional
inactivation of the newly identified gene for the structural protein
component of pili, pilA, and another new gene necessary for
pilus formation, pilC, abolished transformation by
chromosomal and plasmid DNA through the prevention of
competence-specific DNA binding.
Bacterial strains and culture conditions.
The bacterial
strains and plasmids used are listed in Table
1. P. stutzeri and
Escherichia coli were grown on Luria-Bertani (LB) agar
plates or in LB liquid medium (37). Incubations were at
37°C. If necessary, LB medium was supplemented with ampicillin (1 g
liter
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Type IV Pilus Genes pilA and
pilC of Pseudomonas stutzeri Are Required for
Natural Genetic Transformation, and pilA Can Be Replaced
by Corresponding Genes from Nontransformable Species
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
1 for P. stutzeri; 100 mg
liter
1 for E. coli), gentamicin (10 mg
liter
1), kanamycin (60 mg liter
1),
streptomycin (1 g liter
1 for P. stutzeri; 100 mg liter
1 for E. coli), rifampin (20 mg
liter
1) or nalidixic acid (50 mg liter
1).
The minimal medium for P. stutzeri was minimal pyruvate (MP) agar medium (23).
TABLE 1.
Bacterial strains and plasmids used in this study
DNA manipulations and plasmid and strain constructions.
Plasmids and genomic DNA were prepared by using Qiagen columns (Qiagen,
Hilden, Germany) according to the instructions of the manufacturer.
Electrocompetent cells of P. stutzeri and E. coli
were prepared according to the methods of Pemberton and Penfold (33) and Dower et al. (13), respectively. A gene
bank of JM375 was obtained by partial digestion of chromosomal DNA with
PstI, ligation of fragments of about 6 to 12 kb to RSF1010d
(Table 1), and transformation of P. stutzeri APS121 by
electroporation (12.5 kV cm
1, 25 µF, 200
; Gene
Pulser; Bio-Rad Laboratories, Richmond, Calif.). The subclone pCOM81a
was constructed by treatment of pCOM81 with EcoRI and
NdeI and subsequent ligation resulting in a 7.7-kb deletion. The plasmid was electroporated into Tf81. Plasmid pST81 was obtained by
partial restriction of chromosomal Tf81 DNA with SacI,
ligation, and transformation of E. coli SF8recA.
The pilA complementing plasmid pUCA1 was constructed by PCR
amplification of the pilA gene from chromosomal LO15 DNA
using the primers PILAPRO4 (5'CATGCCGGCATACTAGACAT3') and
PILA4 (5'TTAGGAGCACTTGCCTGGCTTGTAC 3'), ligation to
SmaI-treated pUCP19, and transformation of E. coli XL10. For construction of Tf300, pUCA1 was treated with
BglII and ligated to a gentamicin resistance gene from pUCGm
DNA (40). For mutant constructions, integration of insertion
mutant alleles was by homologous recombination during plate transformation.
Transposon mutagenesis of P. stutzeri. Transposon mutagenesis of P. stutzeri was performed essentially according to the method of Simon et al. (43) using cells from the mobilizing E. coli strain S17-1 carrying pSUP102GmTn5B20 as donor cells and from LO15 as recipient cells. After conjugation on a filter for 16 h at 37°C, the cells were resuspended in 0.9% NaCl and plated on LB agar supplemented with rifampin, nalidixic acid, and kanamycin.
DNA sequencing. DNA sequencing was performed by the dideoxynucleotide chain termination method (38) with a cycle sequencing kit (GATC, Constance, Germany) and thermosequenase (Amersham, Braunschweig, Germany). The sequencing products were separated on a 1500 Long Run DNA Sequencer (GATC) and directly blotted onto a positively charged nylon membrane according to the instructions of the manufacturer. For sequencing of the pilABCD region, pCOM81a and pST81 were used.
Plate transformation of P. stutzeri. (i) Qualitative
plate transformation.
The method of Hahn et al. (18)
was adapted to P. stutzeri. P. stutzeri colonies
were replica plated onto MP agar supplemented with kanamycin, rifampin,
and nalidixic acid. The plates contained a low concentration of
histidine (0.5 mg liter
1) sufficient for growth of about
two generations (for integration and expression of the
his+ allele) and were streaked with 2 µg of
chromosomal DNA of JM375 (his+). Clones which
formed his+ colonies within 2 days were
considered transformation proficient; nongrowing clones were suspected
to be transformation-deficient.
(ii) Quantitative plate transformation.
The quantitative
plate transformation procedure was performed according to the method of
Lorenz and Wackernagel (23), except that 10 µg of JM375
DNA ml
1 was used and incubation of the cells on a fresh
LB agar plate with DNA was overnight at 37°C.
Transformation in liquid culture.
Competent cells were
prepared and stored at
80°C as described previously
(22). The cells were thawed at room temperature and aerated
at 37°C for 2 to 3 h. Culture samples of 0.25 ml were mixed with
0.25 µg of transforming his+ DNA from a
concentrated stock solution and incubated for 90 min at 37°C. Then
DNase I was added (final concentration, 100 µg ml
1).
After incubation for 15 min at 37°C the cells were plated on LB
(viable count) and MP (his+ transformants) agar.
The frequency of transformation was defined as the number of
his+ colonies per viable count.
Plating of PO4 and determination of twitching motility. Plaque formation of PO4 on P. stutzeri was performed in a spot test as described by Bradley (8). Twitching motility was determined by inspecting single colonies of P. stutzeri for spreading zones on LB agar after incubation in a humid atmosphere at 37°C for 10 days.
DNA binding and uptake of competent cells.
Purified
transforming DNA isolated from P. stutzeri JM375
(his+) was labeled with
3H-deoxythymidine triphosphate (specific activity, 63 Ci/mmol) by nick translation using the kit of Promega (Madison, Wis.). The DNA was purified by filtration on Microcon-100 (Amicon, Witten, Germany). The specific radioactivity of the DNA was 7 × 106 cpm/µg. The DNA fragments had a mean size of about 20 kb, as determined by gel electrophoresis. A competent cell suspension stored at
80°C was thawed at room temperature and aerated for 2 to
3 h at 37°C. To 0.5 ml of cell suspension, 0.5 µg of
3H-DNA (in a 1-µl volume) was added and aeration was
continued for 90 min. The cells of 0.5-ml samples either treated with
DNase I (100 µg/ml for 15 min at 37°C) or not treated were
sedimented through 1 ml of 10% glycerol for 15 min at
15,000 × g. The cell pellet was resuspended in 0.4 ml
of wash buffer (0.5% NaCl, 10 mM Tris HCl [pH 7.5]) and again
sedimented through 10% glycerol. This was done a third time. The cells
were then resuspended in 1 ml of wash buffer, and the radioactivity
associated with the cells was determined in a liquid scintillation
counter. The cell number was determined in a 5-µl sample in a
counting chamber under the light microscope to relate radioactivity to
the number of recovered cells.
Electron microscopy. Sample grids with Formvar film were touched to microcolonies grown after 12 to 15 h at 37°C on LB agar plates. The grids were floated for 10 min on a drop of 1% uranyl acetate for staining. After air drying for 15 min, transmission electron microscopy was performed with a Zeiss JM109A electron microscope.
Nucleotide sequence accession number. The nucleotide sequence of the pilABCD region has been deposited in the EMBL database under accession no. AJ132364.
| |
RESULTS |
|---|
|
|
|---|
Isolation of transformation-deficient mutants. After transposon mutagenesis about 3.3 × 104 Kmr mutants of LO15 (hisX) were screened for transformation deficiency by a qualitative replica plate transformation assay. The putative transformation-deficient clones were examined for their UV sensitivity to discriminate possible recombination-deficient mutants which were assumed to be detected by their repair deficiency. Additionally, the clones were subjected to a screening for extracellular DNase activity according to the method of Basse et al. (4) to exclude the possibility that the transformation deficiency resulted from increased DNase production. Finally, the mutants were electroporated with pSI1 (42) carrying the hisX gene. Those mutants which then did not grow on histidine-free minimal medium were assumed to have a transposon insertion in another his gene. Such mutants were found, suggesting that the genes for histidine biosynthesis are not clustered on the P. stutzeri genome. With the 39 mutants remaining after these tests a quantitative plate transformation test was performed. Compared to that of the LO15 cells, the transformation frequencies of the various mutants ranged from 0.1 to less than 0.00003.
Identification of a pilC insertion mutant.
One
mutant (Tf81) was not transformable with chromosomal DNA (Table
2) or with plasmid DNA (Weger et al.,
unpublished data). Strain Tf81 was used in complementation studies with
6- to 12-kb JM375 chromosomal DNA fragments present in plasmids of a
P. stutzeri gene bank. Clones of Tf81 obtained by
electroporation with gene bank plasmids were screened for the ability
to be naturally transformed by chromosomal his+
DNA. A gene bank plasmid which restored transformability of Tf81 (pCOM81) (Table 2) had an insert of about 10.8 kb. Subcloning of insert
fragments revealed that a 3.1-kb fragment fully complemented Tf81.
Sequencing of the insert showed that it covered a complete open reading
frame (ORF) of 405 triplets which was probably transcribed from the
sulfonamide resistance gene promoter of the vector pRSF1010. The
deduced amino acid sequence displayed two transmembrane helices and had
75% amino acid identity to PilC of Pseudomonas aeruginosa, which is a highly hydrophobic accessory protein in type IV pilus biogenesis (29). Sequencing of genomic DNA of Tf81 confirmed that in this strain pilC was inactivated by transposon
insertion (see below). This suggested that P. stutzeri has
type IV pili and that they might be necessary for genetic
transformation. The formation of type IV pili by P. stutzeri
LO15 and Tf81 was tested with the pilus-dependent phage PO4
(8). As shown in Table 2, the phage plated on LO15 cells,
indicating that these had intact pili, and did not plate on strain
Tf81. Complementation of Tf81 with pCOM81 or pCOM81a restored plating
of PO4 (Table 2).
|
|
Twitching motility.
We noticed that extended incubation of
P. stutzeri LO15 colonies at 37°C in a humid atmosphere
produced a thin growth halo around the colonies (Fig.
2). This resembled the phenomenon of twitching motility seen before with strains of P. stutzeri
(19) and other type IV pilus-producing strains (19, 50,
54). The growth halo was absent in cultures of strain Tf81, the
pilC mutant (Fig. 2). In cultures of Tf81 with pCOM81 or
pCOM81a, twitching motility was fully restored (Table 2).
|
Characterization of pilB, pilD, and orfX. The nucleotide sequences of the insert in pCOM81a upstream and downstream of pilC showed incomplete ORFs with deduced amino acid sequences similar to PilB and PilD of P. aeruginosa. Since the gene bank plasmid contained no further chromosomal DNA beyond the partial pilB and pilD genes, we used a new strategy to obtain the missing DNA. Previously, we had noticed that Tf81 was not only kanamycin resistant, as expected from the Tn5B20 insertion, but also gentamicin resistant. This could be explained if not only the transposon but also its vector pSUP102Gm, containing a gentamicin resistance gene (43), had been inserted into the chromosome. Such events occur when a Tn5-containing plasmid dimerizes and then cointegrates by transposase action. This leads to various types of transposition cointegrates in the host chromosome (6). PCR analyses indicated that in the P. stutzeri mutant Tf81, transposition from the presumably dimeric plasmid was mediated by two IS50R elements, resulting in a chromosomal insertion of the vector with two IS50R elements at the borders and one internal IS50L element. By partial restriction of chromosomal Tf81 DNA with SacI (which cleaves only once in pSUP102GmTn5B20), ligation, and transformation of E. coli, plasmids mediating resistance to kanamycin and gentamicin were obtained. One plasmid, named pST81, with a size of about 40 kb was used for the sequencing of regions adjacent to pilC. Before that, the transposon insertion site was identified to be about in the middle of pilC (nucleotide [nt] position 2528), verifying the complementation of Tf81 by pCOM81a. Then, the remaining parts of pilB and pilD were sequenced. The deduced PilB and PilD protein sequences had 79.5% and 79.0% amino acid identity to PilB and PilD of P. aeruginosa, which are accessory proteins in type IV pilus biogenesis (29). The probably cytoplasmically located PilB protein of P. stutzeri contains a conserved ATP or GTP binding site at nt positions 5438 to 5461. The PilD protein is probably integrated in the inner membrane by six membrane-spanning sequences. Downstream of pilD a gene named orfX was sequenced which codes for a conserved hypothetical protein with unknown function found in many other species. Mutants of Neisseria gonorrhoeae containing an insertion in orfX exhibited a severely restricted growth phenotype but expressed pili and were naturally transformable (14).
Identification of pilA. The sequence upstream of pilB contained an ORF of 420 nt oriented opposite to pilB. The derived protein had 50.3% amino acid identity to fimA of Xanthomonas campestris, which is a type IV pilin (31). The sequence also had high similarity to pilin genes of other species that all share a short hydrophilic leader peptide and the characteristic hydrophobic N-terminal region starting with a phenylalanine in the mature protein (2). The PilA protein of P. stutzeri contains a putative ATP or GTP binding site motif at nt positions 5438 to 6461, unusual for pilin proteins. It is not clear whether this site is functional in ATP or GTP hydrolysis or in which processes this would be involved.
A defective pilA allele was constructed by insertion of a gentamicin resistance gene into the BglII site of pUCA1 to yield pUCA1Gm (Table 1). The mutant allele was naturally transformed into the chromosome of an LO15 cell to yield the pilA::Gmr strain Tf300. The strain was PO4 resistant, did not show twitching motility (Table 2), and had no pili visible in the electron microscope (Fig. 1). Strain Tf300 was deficient for transformation with chromosomal DNA (Table 2) and plasmid DNA (Weger et al., unpublished data). All defects of Tf300 were complemented by plasmid pUCA1 (Table 2), although the PO4 plating efficiency was lower than that observed for LO15. Overexpression of pilA in P. aeruginosa was previously observed to reduce PO4 plating (54). These findings would be consistent with pilA providing the structural protein for type IV pilus biogenesis. The pilA gene of P. aeruginosa is under the control of a
54 promoter (32). A putative
54 promoter consensus sequence is present in the
P. stutzeri sequence at nt positions 5065 to 5081. Upstream,
a putative NifA-like recognition sequence (nt positions 5007 to 5023)
is present that might be a transcriptional activator binding site
characteristic for
54 promoters (20). The
pilA gene of P. stutzeri presumably starts at nt
position 5126, preceded by a typical ribosome binding site, and ends at
nt position 5546, followed by a perfect inverted repeat sequence of 13 nucleotides (
G,
28.7 kcal mol
1) that
could function as a rho-independent transcription terminator.
DNA binding and uptake.
In transformation-deficient mutants of
Acinetobacter sp. strain BD4 with defects in genes coding
for pilin-like and accessory proteins for pilus biogenesis, the binding
of DNA was abolished (21, 36). We measured the interaction
of 3H-labeled chromosomal P. stutzeri DNA with
LO15 cells. In previous experiments we had shown that the kinetics of
DNA binding, uptake (measured as the fraction of DNase I-resistant DNA
associated with the cells), and transformant formation were parallel
and reached a plateau after about 90 min of incubation of competent cells with DNA (Weger et al., unpublished data). When the cells were
taken from the competence peak (reached at a culture density of about
0.5 × 109 to 1 × 109 cells/ml), DNA
binding of about 150 pg/5 × 108 cells was found
(Table 3) and about one-third of the DNA
associated with the cells was taken up into a DNase I-resistant state
within 90 min. The DNA concentration of 1 µg/ml in these experiments was below saturation and corresponded to the concentration used in
normal transformation experiments. DNA binding, DNA uptake, and
transformation were drastically reduced when cells were allowed to grow
further or to stationary phase (Table 3). These findings suggested
competence-specific binding and uptake of DNA by LO15 cells. In
contrast, cells of pilA and pilC mutants, grown
to the phase in which maximum competence of LO15 was observed, bound roughly eight- and sixfold less DNA, respectively, and uptake was
reduced about fourfold (Table 3). Even with stationary-phase cells of
the pilA and pilC mutants, some DNA binding and
uptake were seen as with LO15. Apparently, cells of the parental strain and the pil mutants bind low amounts of DNA irrespective of
competence and a part of this DNA is not degradable by DNase I. The
data in Table 3 indicate that mature pilin or type IV pilus formation is necessary for the transformation-related binding and uptake of DNA
by P. stutzeri.
|
Complementation of pilA by heterologous genes coding
for pilin.
Watson et al. showed that twitching motility and PO4
plating can be partially restored in P. aeruginosa by
heterologous pilA (54). To investigate whether a
pilA defect of P. stutzeri can be complemented by
foreign structural genes for type IV pili, Tf300 was transformed with
plasmids carrying the pilin genes of P. aeruginosa PAK,
P. aeruginosa PAO, or Dichelobacter nodosus (54). The foreign pilin genes supported twitching motility
and partially restored PO4 plating (Table
4).
|
| |
DISCUSSION |
|---|
|
|
|---|
The characterization of the first transformation-deficient mutant isolated from P. stutzeri following transposon mutagenesis revealed that a gene essential for type IV pilus biogenesis was inactivated. This gene was termed pilC. The deduced protein was highly similar to PilC of P. aeruginosa and that of the corresponding proteins involved in pilus biogenesis, protein secretion, and DNA uptake of other bacteria (2). The pilC mutant of P. stutzeri did not plate the type IV pilus-dependent phage PO4, was defective in the pilus-mediated phenomenon of twitching motility, and had no pili visible in the electron microscope. It was further found that pilC of P. stutzeri is located in a cluster of pil genes including pilB and pilD and that a prepilin-coding gene, pilA, is located next to pilB and transcribed in the opposite direction. This arrangement of genes is identical to that in P. aeruginosa (29). In this organism, pilB, pilC, and pilD code for accessory proteins for pilus genesis, of which PilD is the prepilin peptidase necessary for processing of prepilin to pilin and methylation of the N-terminal phenylalanine (30, 49). Insertional inactivation of pilA in P. stutzeri abolished pilus formation, twitching motility, PO4 plating, and transformability. These defects were reversed by providing the cloned pilA gene in trans, indicating the absence of a polar effect of the insertion (Table 4). From these observations and the fact that heterologous genes for pilus structural proteins restored pilus formation (verified by electron microscopy) in the pilA mutant, it is concluded that the soil bacterium P. stutzeri has type IV pili, with pilA coding for the structural protein.
So far, predominantly pathogenic bacteria including N. gonorrhoeae, Neisseria meningitidis, P. aeruginosa, D. nodosus, Moraxella spp., and Legionella pneumophila were shown to have type IV pili (48, 50), which are thought to mediate adhesion to epithelial cells, which is believed to be a key step in the initiation of infections (5, 44). Recently, the bacterium Azoarcus was shown to have type IV pili which are essential for the establishment of bacteria on the root surface of rice seedlings and for adhesion to the mycelium of an ascomycete (11). It is not clear whether pili have a function in interactions of the soil bacterium P. stutzeri with host organisms.
Our studies with pilA and pilC mutants show that for natural transformation of P. stutzeri expression of pilA and pilC is required. The function of PilC may be limited to the export of processed PilA, but it is conceivable that other proteins necessary for competence are also dependent on PilC for export. From our data we cannot distinguish whether only the export of mature pilin or the formation of pili is required for competence. This question also remains open when looking at other transformable gram-negative bacteria which form type IV pili. On the one hand, nonpiliated mutants of N. gonorrhoeae (15, 41), N. meningitidis (51), Moraxella liquefaciens (7), and Legionella pneumophila (47) have lost transformability or give 1,000-fold lower transformation frequencies. On the other hand, strains of an Acinetobacter sp. defective in genes coding for type IV prepilin-like and accessory proteins were transformation deficient but fully piliated (21, 35). Further, proteins having remarkable levels of amino acid sequence identity to those of pilin and accessory proteins PilB, PilC, and PilD are required for competence of Haemophilus influenzae (12) and the gram-positive bacteria Bacillus subtilis (1, 28), S. pneumoniae (34) and S. gordonii (26). However, the proteins do not promote pilus formation in these bacteria.
The role of pili or pilin in DNA uptake is not yet clear. In extension of the phage PO4 infection theory of Bradley (8), it has been hypothesized that in Neisseria pilus retraction would translocate DNA into the periplasmic space (16). In Acinetobacter, the pilin-like and accessory proteins are necessary for binding of DNA by competent cells (21, 35). Our studies with radiolabeled DNA suggest that also in P. stutzeri PilA protein or pili are required for competence-specific binding of DNA and are probably also involved in its transport into a DNase-resistant state. That the mere formation of pili from pilin is not sufficient for successful DNA uptake is concluded from the transformation deficiency of a pilT mutant which is hyperpiliated (Weger et al., unpublished data). The mutant cells are defective in twitching motility and PO4 infection, suggesting that retractable pili are necessary for these processes and DNA uptake. In Neisseria, the piliated pilT strains were also defective in DNA uptake and twitching motility (55). The Neisseria pili do not bind DNA (27). Thus, our presently favored model of DNA uptake by P. stutzeri (and perhaps other transformable gram-negative organisms) would include pilus-mediated binding of DNA to a receptor protein not exposed to DNA in the absence of pilus formation. Binding is followed by retraction of the pilus, with concomitant translocation of DNA (perhaps together with the putative DNA binding protein) into a DNase I-resistant state. This could be the periplasmic space. Recent studies show that the pilin-like proteins of B. subtilis (encoded by comGC, comGD, comGE, and comGG) direct DNA to the competence-specific DNA binding protein ComEA (36). From the periplasm, DNA is translocated through the cytoplasmic membrane.
Substitution of the P. stutzeri pilA gene by the corresponding genes from three nontransformable bacteria caused transformation, pilus formation, twitching motility, and PO4 infection. This underlines the necessity of functional pili for DNA uptake and, at the same time, indicates the absence of species specificity of pilin for DNA internalization and other functions. It also suggests that the presumptive ATP or GTP binding site observed in the amino acid sequence of the P. stutzeri PilA protein is not involved in transformation, since the heterologous proteins do not have such a site. The fact that several of the transformation-deficient mutants isolated from P. stutzeri are not defective for pilus biogenesis indicates that other gene functions are additionally required for transformation. When these genes are identified it will be interesting to see whether complements to them are lacking in P. aeruginosa and other pseudomonads, which lack could explain why these organisms are not transformable.
| |
ACKNOWLEDGMENTS |
|---|
We thank Georg Basse, Marcus Wittstock, Uta Remmers, and Ralf Marienfeld for help during experiments on the isolation and characterization of transposon mutants. We are grateful to David Dubnau and Tøne Tønjum, who provided valuable information, to J. Mattick for strains and plasmids, to Stephen Lory for phage PO4, and to E. Ungewickel for help.
This work was supported by the Deutsche Forschungsgemeinschaft and the Fonds der Chemischen Industrie.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: AG Genetik, Fachbereich Biologie, Universität Oldenburg, Postfach 2503, D-26111 Oldenburg, Germany. Phone: 49-(0)441-7983298. Fax: 49-(0)441-7985606. E-mail: genetics{at}biologie.uni-oldenburg.de.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Albano, M.,
R. Breitling, and D. Dubnau.
1989.
Nucleotide sequence and genetic organization of the Bacillus subtilis comG operon.
J. Bacteriol.
171:5386-5404 |
| 2. | Alm, R. A., and J. S. Mattick. 1997. Genes involved in the biogenesis and function of type-4 fimbriae in Pseudomonas aeruginosa. Gene 192:89-98[CrossRef][Medline]. |
| 3. | Bagdasarian, M., R. Lurz, B. Rückert, F. C. H. Franklin, M. M. Bagdasarian, J. Frey, and K. N. Timmis. 1981. Specific-purpose cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16:237-247[CrossRef][Medline]. |
| 4. | Basse, G., M. G. Lorenz, and W. Wackernagel. 1994. A biological assay for the sensitive and quantifiable detection of extracellular microbial DNases. J. Microbiol. Methods 20:137-147[CrossRef]. |
| 5. | Beachey, E. H. 1981. Bacterial adherence: adhesin-receptor interactions mediating the attachment of bacteria to mucosal surfaces. J. Infect. Dis. 143:325-345[Medline]. |
| 6. | Berg, D. E. 1989. Transposon Tn5, p. 185-210. In D. E. Berg, and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. |
| 7. | Bøvre, K., and L. O. Frøholm. 1970. Correlation between the fimbriated state and competence of genetic transformation in Moraxella nonliquefaciens strains. Acta Pathol. Microbiol. Scand. Sect. B 78:526-528. |
| 8. | Bradley, D. E. 1973. A pilus-dependent Pseudomonas aeruginosa bacteriophage with a long noncontractile tail. Virology 51:489-492[CrossRef][Medline]. |
| 9. | Bruns, S., K. Reipschläger, M. G. Lorenz, and W. Wackernagel. 1992. Characterization of natural transformation of the soil bacteria Pseudomonas stutzeri and Acinetobacter calcoaceticus by chromosomal and plasmid DNA, p. 115-126. In M. J. Gauthier (ed.), Gene transfers and environment. Springer, New York, N.Y. |
| 10. |
Carlson, C. A.,
L. S. Pierson,
J. J. Rosen, and J. L. Ingraham.
1983.
Pseudomonas stutzeri and related species undergo natural transformation.
J. Bacteriol.
153:93-99 |
| 11. | Dörr, J., T. Hurek, and B. Reinhold-Hurek. 1998. Type IV pili are involved in plant-microbe and fungus-microbe interactions. Mol. Microbiol. 30:7-17[CrossRef][Medline]. |
| 12. |
Dougherty, B. A., and H. O. Smith.
1999.
Identification of Haemophilus influenzae Rd transformation genes using cassette mutagenesis.
Microbiology
145:401-409 |
| 13. |
Dower, W. J.,
J. F. Miller, and C. W. Ragsdale.
1988.
High efficiency transformation of E. coli by high voltage electroporation.
Nucleic Acids Res.
16:6127-6145 |
| 14. | Freitag, N. E., H. S. Seifert, and M. Koomey. 1995. Characterization of the pilF-pilD pilus-assembly locus of Neisseria gonorrhoeae. Mol. Microbiol. 16:575-586[Medline]. |
| 15. | Frøholm, L. O., K. Jyssum, and K. Bøvre. 1973. Electron microscopical and cultural features of Neisseria meningitidis competence variants. Acta Pathol. Microbiol. Immunol. Scand. Sect. B 81:525-537. |
| 16. |
Fussenegger, M.,
T. Rudel,
R. Barten,
R. Ryll, and T. F. Meyer.
1997.
Transformation competence and type IV pilus biogenesis in Neisseria gonorrhoeae a review.
Gene
192:125-134[CrossRef][Medline].
|
| 17. | Graupner, S., and W. Wackernagel. 1996. Identification of multiple plasmids released from recombinant genomes of Hansenula polymorpha by transformation of Escherichia coli. Appl. Environ. Microbiol. 62:1839-1841[Abstract]. |
| 18. |
Hahn, J.,
M. Albano, and D. Dubnau.
1987.
Isolation and characterization of Tn917lac-generated competence mutants of Bacillus subtilis.
J. Bacteriol.
169:3104-3109 |
| 19. | Henrichson, J. 1983. Twitching motility. Annu. Rev. Microbiol. 37:81-93[CrossRef][Medline]. |
| 20. |
Kustu, S.,
E. Santero,
J. Keener,
D. Propham, and D. Weiss.
1989.
Expression of 54 (ntrA)-dependent genes is probably united by a common mechanism.
Microbiol. Rev.
53:367-376 |
| 21. |
Link, C.,
S. Eickernjäger,
D. Porstendörfer, and B. Averhoff.
1998.
Identification of a novel gene, comC, required for DNA binding and uptake in Acinetobacter sp. strain BD413.
J. Bacteriol.
180:1592-1595 |
| 22. | Lorenz, M. G., and W. Wackernagel. 1990. Natural genetic transformation of Pseudomonas stutzeri by sand-adsorbed DNA. Arch. Microbiol. 154:380-385[Medline]. |
| 23. |
Lorenz, M. G., and W. Wackernagel.
1991.
High frequency of natural genetic transformation of Pseudomonas stutzeri in soil extract supplemented with a carbon/energy and phosphorus source.
Appl. Environ. Microbiol.
57:1246-1251 |
| 24. | Lorenz, M. G., and W. Wackernagel. 1992. Stimulation of natural genetic transformation of Pseudomonas stutzeri in extracts of various soils by nitrogen or phosphorus limitation and influence of temperature and pH. Microb. Releases 2:1-4. |
| 25. |
Lorenz, M. G., and W. Wackernagel.
1994.
Bacterial gene transfer by natural genetic transformation in the environment.
Microbiol. Rev.
58:563-602 |
| 26. |
Lunsford, R. D., and A. G. Roble.
1997.
comYA, a gene similar to comGA of Bacillus subtilis, is essential for competence-factor-dependent DNA transformation in Streptococcus gordonii.
J. Bacteriol.
179:3122-3126 |
| 27. |
Mathis, L. S., and J. J. Scocca.
1984.
On the role of pili in transformation of Neisseria gonorrhoeae.
J. Gen. Microbiol.
130:3165-3173 |
| 28. |
Mohan, S.,
J. Aghion,
N. Guillen, and D. Dubnau.
1989.
Molecular cloning and characterization of comC, a late competence gene of Bacillus subtilis.
J. Bacteriol.
171:6043-6051 |
| 29. |
Nunn, D.,
S. Bergman, and S. Lory.
1990.
Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili.
J. Bacteriol.
172:2911-2919 |
| 30. |
Nunn, D. N., and S. Lory.
1991.
Product of the Pseudomonas aeruginosa gene pilD is a prepilin leader peptidase.
Proc. Natl. Acad. Sci. USA
88:3281-3285 |
| 31. |
Ojanen-Reuhs, T.,
N. Kalkkinen,
B. Westerlund-Wikström,
J. van Doorn,
K. Haahtela,
E. L. Nurmiaho-Lassila,
K. Wengelnik,
U. Bonas, and T. K. Korhonen.
1997.
Characterization of the fimA gene encoding bundle-forming fimbriae of the plant pathogen Xanthomonas campestris pv. vesicatoria.
J. Bacteriol.
179:1280-1290 |
| 32. | Pasloske, B. L., D. S. Drummond, L. S. Frost, and W. Paranchych. 1989. The activity of the Pseudomonas aeruginosa pilin promoter is enhanced by an upstream regulatory site. Gene 81:25-34[CrossRef][Medline]. |
| 33. | Pemberton, J. M., and R. J. Penfold. 1992. High-frequency electroporation and maintenance of pUC- and pBR-based cloning vectors in Pseudomonas stutzeri. Curr. Microbiol. 25:25-29[CrossRef][Medline]. |
| 34. |
Pestova, E. V., and D. A. Morrison.
1998.
Isolation and characterization of three Streptococcus pneumoniae transformation-specific loci by use of a lacZ reporter insertion vector.
J. Bacteriol.
180:2701-2710 |
| 35. | Porstendörfer, D., U. Drotschmann, and B. Averhoff. 1997. A novel competence gene, comP, is essential for natural transformation of Acinetobacter sp. strain BD413. Appl. Environ. Microbiol. 63:4150-4157[Abstract]. |
| 36. | Provvedi, R., and D. Dubnau. 1999. ComEA is a DNA receptor for transformation of competent Bacillus subtilis. Mol. Microbiol. 31:271-280[CrossRef][Medline]. |
| 37. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 38. |
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467 |
| 39. | Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene 97:109-112[CrossRef][Medline]. |
| 40. | Schweizer, H. P. 1993. Small broad-host-range gentamicin resistance gene cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15:831-834[Medline]. |
| 41. |
Seifert, H. S.,
R. S. Ajioka,
D. Paruchuri,
F. Heffron, and M. So.
1990.
Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence.
J. Bacteriol.
172:40-46 |
| 42. |
Sikorski, J.,
S. Graupner,
M. G. Lorenz, and W. Wackernagel.
1998.
Natural transformation of Pseudomonas stutzeri in non-sterile soil.
Microbiology
144:569-576 |
| 43. | Simon, R., J. Quandt, and W. Klipp. 1989. New derivatives of transposon Tn5 suitable for mobilization of replicons, generation of operon fusions and induction of genes in gram-negative bacteria. Gene 80:161-169[CrossRef][Medline]. |
| 44. | Smith, H. 1984. The biochemical challenge of microbial pathogenicity. J. Appl. Bacteriol. 47:395-404. |
| 45. | Solomon, J. M., and A. D. Grossman. 1996. Who's competent and when? Regulation of natural genetic competence in bacteria. Trends Genet. 12:150-155[CrossRef][Medline]. |
| 46. | Steward, J. S., and C. A. Carlson. 1986. The biology of natural transformation. Annu. Rev. Microbiol. 40:211-235[CrossRef][Medline]. |
| 47. |
Stone, B. J., and Y. A. Kwaik.
1999.
Natural competence for DNA transformation by Legionella pneumophila and its association with expression of type IV pili.
J. Bacteriol.
181:1395-1402 |
| 48. |
Stone, B. J., and Y. A. A. Kwaik.
1998.
Expression of multiple pili by Legionella pneumophila: identification and characterization of a type IV pilin gene and its role in adherence to mammalian and protozoan cells.
Infect. Immun.
66:1768-1775 |
| 49. |
Strom, M. S.,
D. N. Nunn, and S. Lory.
1993.
A single bifunctional enzyme, PilD, catalyzes cleavage and N-methylation of proteins belonging to the type IV pilin family.
Proc. Natl. Acad. Sci. USA
90:2404-2408 |
| 50. | Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the type IV pili. Annu. Rev. Microbiol. 47:565-596[CrossRef][Medline]. |
| 51. | Tønjum, T., N. E. Freitag, E. Namork, and M. Koomey. 1995. Identification and characterization of pilG, a highly conserved pilus-assembly gene in pathogenic Neisseria. Mol. Microbiol. 16:451-464[Medline]. |
| 52. | Vosman, B., and K. J. Hellingwerf. 1991. Molecular cloning and functional characterization of a recA analog from Pseudomonas stutzeri and construction of a Pseudomonas stutzeri recA mutant. Antonie Leeuwenhoek 59:115-123. |
| 53. | Wall, D., and D. Kaiser. 1999. Type IV pili and cell motility. Mol. Microbiol. 32:1-10[CrossRef][Medline]. |
| 54. | Watson, A. A., J. S. Mattick, and R. A. Alm. 1996. Functional expression of heterologous type IV fimbriae in Pseudomonas aeruginosa. Gene 175:143-150[CrossRef][Medline]. |
| 55. | Wolfgang, M., P. Lauer, H. S. Park, L. Brossay, J. Hebert, and M. Koomey. 1998. PilT mutations lead to simultaneous defects in competence for natural transformation and twitching motility in piliated Neisseria gonorrhoeae. Mol. Microbiol. 29:321-330[CrossRef][Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»