Previous Article | Next Article 
Journal of Bacteriology, April 2000, p. 2299-2306, Vol. 182, No. 8
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Heterologous Inducible Expression of
Enterococcus faecalis pCF10 Aggregation Substance Asc10 in
Lactococcus lactis and Streptococcus
gordonii Contributes to Cell Hydrophobicity and Adhesion
to Fibrin
Helmut
Hirt,1
Stanley L.
Erlandsen,2 and
Gary M.
Dunny1,*
Department of Microbiology, University of
Minnesota Medical School,1 and
Department of Genetics, Cell Biology and Development,
University of Minnesota,2 Minneapolis, Minnesota
55455
Received 18 October 1999/Accepted 22 January 2000
 |
ABSTRACT |
Aggregation substance proteins encoded by the sex pheromone plasmid
family of Enterococcus faecalis have been shown previously to contribute to the formation of a stable mating complex between donor
and recipient cells and have been implicated in the virulence of this
increasingly important nosocomial pathogen. In an effort to
characterize the protein further, prgB, the gene encoding
the aggregation substance Asc10 on pCF10, was cloned in a vector
containing the nisin-inducible nisA promoter and its
two-component regulatory system. Expression of aggregation substance
after nisin addition to cultures of E. faecalis and the
heterologous bacteria Lactococcus lactis and
Streptococcus gordonii was demonstrated. Electron
microscopy revealed that Asc10 was presented on the cell surfaces of
E. faecalis and L. lactis but not on that of
S. gordonii. The protein was also found in the cell culture
supernatants of all three species. Characterization of Asc10 on the
cell surfaces of E. faecalis and L. lactis
revealed a significant increase in cell surface hydrophobicity upon
expression of the protein. Heterologous expression of Asc10 on L. lactis also allowed the recognition of its binding ligand (EBS)
on the enterococcal cell surface, as indicated by increased transfer of
a conjugative transposon. We also found that adhesion of
Asc10-expressing bacterial cells to fibrin was elevated, consistent
with a role for the protein in the pathogenesis of enterococcal
endocarditis. The data demonstrate that Asc10 expressed under the
control of the nisA promoter in heterologous species will
be an useful tool in the detailed characterization of this important
enterococcal conjugation protein and virulence factor.
 |
INTRODUCTION |
The gram-positive intestinal
commensal Enterococcus faecalis is host to a variety of
mobile genetic elements ranging from conjugative plasmids to
conjugative transposons (7). Among the conjugative elements,
members of the sex pheromone plasmid family exhibit a novel mechanism
of plasmid transfer. Expression of conjugation functions in donor cells
is triggered by the secretion of hydrophobic hepta- or octapeptide sex
pheromones produced by plasmid-free recipient cells (14).
These peptides are sensed by a plasmid-containing donor cell, and the
uptake of the peptide induces the expression of the surface protein
aggregation substance (AS) (34). AS allows the formation of
macroscopic aggregates of donor and recipient cells, with subsequent
plasmid transfer reaching frequencies of 10
1 to
10
2 transconjugants per donor (12).
A multitude of sex pheromone plasmids have been described
(51), and with one exception (plasmid pAM373) all encode ASs
that have highly homologous DNA and protein sequences (23,
25). Most genes for AS encode proteins of approximately 137 kDa.
Sequence information on the three ASs of the plasmids pAD1, pCF10, and pPD1 has become available to date (21, 22, 29). The genes encode proteins consisting of roughly 1,300 amino acids with apparent molecular masses of approximately 150 to 160 kDa, as determined by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE). A 74- to 78-kDa fragment corresponding to the amino terminus of the protein
is commonly detected in cell surface extracts (17, 24). The
proteins each contain a relatively long signal peptide of 44 amino
acids and possess the widespread gram-positive cell wall anchor motive
LPXTG (39). Several groups used electron microscopy and
immunological techniques to determine the appearance of induced cells
and the distribution of the protein on the cell surface (24, 40,
49). No apparent structural features are prominent in the
protein, and its predicted overall shape is globular. One intriguing
feature is the presence of two RGD motifs in the proteins. This amino
acid sequence is present in a number of eucaryotic proteins and is
implicated in the binding of these proteins to eucaryotic cell surface
molecules of the integrin family (43).
The presence of the RGD sequences suggested involvement of AS in
virulence, and the work of several groups, using different model
systems, supports this hypothesis (4, 31, 44). The regulation of AS expression in the wild-type plasmid context in the two
best-characterized systems, pCF10 and pAD1, is rather complex. In the
case of pCF10, a promoter 5 kb upstream of the structural gene
prgB is involved (6), whereas in the pAD1 system a trans-acting regulatory protein is necessary for
expression (37, 47). Small RNA molecules are implicated in
the regulation of AS expression in both plasmids (2, 9). To
simplify characterization of the AS protein by avoiding possible
complicating factors of the pheromone plasmid regulatory systems, we
chose to use the well-characterized nisin-inducible promoter
nisA, which was recently demonstrated to be functional in
E. faecalis (18).
Nisin belongs to the lantibiotic class of peptide antibiotics produced
by certain strains of L. lactis (33). In the
nisin biosynthetic cluster, the promoters preceding nisA,
the nisin peptide structural gene, and nisF, involved in
immunity to nisin, are inducible by mature nisin. Nisin serves as a
peptide pheromone sensed by a classic two-component regulatory system,
with NisK as a histidine kinase and NisR as a response regulator
(19, 30, 32). In L. lactis, expression of the
nisA promoter increases linearly with the amount of nisin
present; however, in other bacterial species, this linearity is seen
only in the nanomolar range of nisin concentrations (18).
Here we describe the expression of the pCF10 AS under the control of
the nisA promoter in E. faecalis as well as in
the heterologous hosts Lactococcus lactis and
Streptococcus gordonii. The expression of AS increases the
cell surface hydrophobicity remarkably and allows increased adherence
to fibrin, thus supporting the role of the protein in virulence. The
functionality for adhesion of the expressed protein to E. faecalis cells is demonstrated by the increased transfer of a
conjugative transposon into AS-expressing hosts.
 |
MATERIALS AND METHODS |
Bacterial strains and culture conditions.
E. faecalis
and S. gordonii were grown without shaking at 37°C in
Todd-Hewitt broth (Difco, Detroit, Mich.). L. lactis was grown without shaking at 30°C in M17 medium (Difco) supplemented with
0.5% glucose. The host strain for molecular cloning was
Escherichia coli DH5
grown at 37°C in Luria-Bertani
medium or, if erythromycin was used as a selective marker, in brain
heart infusion broth (Difco). Agar plates contained 1.5% agar. The
following antibiotic concentrations were used: for E. coli,
kanamycin at 35 µg/ml and erythromycin at 100 µg/ml; for E. faecalis, erythromycin at 10 µg/ml and streptomycin at 1 mg/ml;
and for L. lactis and S. gordonii, erythromycin
at 10 µg/ml.
PCR amplification of the prgB gene.
The
prgB wild-type fragment containing plasmid pINY1801
(5) was utilized as the template for cloning of
prgB. The gene was amplified in two segments. The 5' end was
amplified with the primer pair 5'
TGATCCATGG-------------A
ATGATACATG 3', containing an NcoI site (broken underline) and a
base change at position 13 (boldfaced) from A
G to change the
ribosome binding site (RBS; double underlined) to GGAGG and thereby
improve it, and 5' TTTTCACATATGAGCCATTAATGTATTTGAACGC 3'.
The start codon for the prgB gene is single
underlined. The primers used for amplification of the remainder of the
gene were 5' GCAACTTCCAGAATTCC 3' and 5'
AATTACTCGAG-------------CCAATTTTTCCCCTCC 3',
with the latter containing an XhoI site (broken
underline). PCR was performed with a Hybaid thermocycler, using Vent
polymerase (New England Biolabs, Beverly, Mass.). The amplified
products were purified by the use of a DNA clean-up kit (Promega
Corporation, Madison, Wis.) and employed in further manipulations.
Molecular cloning procedures.
Restriction enzymes (Promega)
and T4 DNA ligase (Gibco BRL, Gaithersburg, Md.) were used in
accordance with the manufacturers' recommendations. Plasmid DNA was
isolated from E. coli by the use of a plasmid minikit
(Qiagen Inc., Chatsworth, Calif.). Electrotransformation was performed
with a Gene Pulser apparatus (Bio-Rad Corp., Richmond, Calif.) as
previously described for E. coli (20), E. faecalis (13), and L. lactis
(27). S. gordonii was transformed as described previously for Streptococcus mutans (45).
Nisin induction.
A preparation containing 2.5% nisin (Sigma
Chemical Co., St. Louis, Mo.) was used. A stock solution of 10 mg/ml
(effective nisin concentration, 250 µg/ml) in H2O was
prepared and stored at
20°C. Appropriate dilutions were made for
induction of the bacterial strains.
Expression of AS and Western blot analysis.
The strains were
inoculated in fresh medium at a 1:10 dilution from overnight cultures
and grown for 4 h under appropriate conditions. Nisin was added as
described above. Cells were sedimented, and a lysozyme cell surface
extraction was performed as described previously (22). For
analysis of AS in culture supernatant, cells were sedimented and the
supernatant was filtered through a 22-µm-pore-size filter (Millipore,
Bedford, Mass.). The filtrate was precipitated with 4 volumes of
ethanol overnight at 4°C, resuspended in H2O, and used
for PAGE. Protein concentrations were determined by the bicinchoninic
acid method (Pierce, Rockford, Ill.). The extracts were separated by
sodium dodecyl sulfate-7.5% PAGE and transferred to a BA 85 nitrocellulose membrane (Schleicher and Schuell, Keene, N.H.). Western
blot analysis was performed with an antibody against pAD1 AS (kindly
provided by A. Muscholl-Silberhorn, Universität Regensburg,
Regensburg, Germany) in accordance with an enhanced chemiluminescence
protocol (Pierce).
Electron microscopy.
Cells were grown and induced as
described above. A 1-ml volume of the cell culture was pelleted, washed
with phosphate-buffered saline (PBS), resuspended in PBS containing 5%
goat serum, and incubated with a 20-µg/ml solution of a monoclonal
antibody against AS for 2 h. The cells were washed three times
with PBS-5% goat serum, incubated for 1 h with goat anti-mouse
immunoglobulin G conjugated to 12-nm-diameter colloidal gold particles
(Jackson ImmunoResearch Laboratories, West Grove, Pa.) diluted 1:50,
and subsequently washed with PBS three times. The cells were
concentrated by centrifugation at low speed and then placed on
poly-L-lysine (Sigma)-covered glass supports (5 by 10 mm).
The cells were allowed to adhere for 30 min and then were washed and
fixed in 0.1 M cacodylate buffer containing 3% glutaraldehyde and
7.5% sucrose. The bacteria were examined by backscatter electron
imaging, using an AUTRATA modified YAG detector with a Hitachi S-900
field emission scanning microscope at 5 keV as described previously
(40).
Transposon transfer.
E. faecalis INY1010 harboring a
single copy of the conjugative transposon Tn925 was used as
the donor strain. The donor and recipient strains were inoculated into
fresh medium at a 1:10 dilution from overnight cultures, grown for
1 h under the appropriate conditions, and induced with nisin when
applicable. The recipient cultures were then inoculated with INY1010 at
a 1:10 (donor/recipient) ratio. The cultures were incubated for 8 h under the culture conditions most favorable for the recipient strain.
To dissolve cell aggregates, 100 µl of 0.5 M EDTA was added before
serial dilutions in 0.9% NaCl were made to determine donor and
transconjugant numbers.
Hydrophobicity and fibrin adherence assays.
Cell surface
hydrophobicity assays were performed, as previously described
(42), with hexadecane (0.25 ml) as the hydrocarbon providing
the hydrophobic phase. Hydrophobicity was expressed as the percentage
of cells adhering to the hexadecane phase. For fibrin adherence assays,
the strains were inoculated into fresh medium at a ratio of 1:10 from
overnight cultures, induced with nisin or cCF10 when indicated, and
allowed to grow for 2 h under the appropriate conditions. The
fibrin adherence assay was performed as described previously
(1) with the following modifications. Cells were allowed to
adhere to the plates for 30 min at room temperature. After being
washed, the fibrin plates were incubated at room temperature for 30 min
with a 0.25% trypsin-EDTA solution (Gibco BRL). Dilutions in 0.9%
NaCl were prepared for determination of levels of adherent bacteria.
DNA sequencing.
Correct PCR amplification was verified by
automated sequencing of the AS construct in plasmid pMSP7516
(Microchemical Facility, University of Minnesota).
 |
RESULTS |
Cloning of prgB behind the nisA
promoter.
The prgB gene was PCR amplified in two
fragments with a primer containing an improved RBS and an
NcoI site at the 5' end and cloned as an
NcoI-EcoRI fragment into the plasmid pET28b,
creating pMSP7513. The remaining part of prgB was amplified
from the EcoRI site to the end of the gene with an
XhoI restriction site, creating pMSP7514. Sequencing was
performed to verify correct amplification.
The amplified prgB gene was initially intended for cloning
into the nisA promoter vector pNZ8048 (Table
1), with the nisKR sensor/regulator component being supplied by plasmid pNZ9531
(18) in trans. Because constructs containing
pNZ8048 were unstable in our hands, we constructed pMSP7515,
containing the nisA promoter and the cloning sites of
pNZ8048 as a BglII-XhoI fragment in pET28b (Fig.
1A). The prgB gene was cloned
into pMSP7515 to yield plasmid pMSP7516. For use in a gram-positive
host, the nisA-prgB cassette was cloned as a
BglII-XhoI fragment into the shuttle vector
pDL289 (3). However, this construct resulted in constitutive
expression of prgB (data not shown). Therefore, we
constructed pMSP3535, containing the nisin response regulator pair as
well as the nisA promoter. The orientation of coding reading
frames on the plasmid (nisRK, ermAM, and
rep) was chosen so that no readthrough should occur. The
construction of this vector and the use of the nisin system for
controlled expression of other E. faecalis proteins are
described by Bryan et al. (E. M. Bryan, T. Bae, M. Kleerebezem, and G. M. Dunny, submitted for publication, 1999).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Construction of plasmid pMSP7517. The
prgB gene, encoding AS, was PCR amplified and cloned into
pET28b, yielding pMSP7514. The nisA promoter of plasmid
pNZ8048 was cloned in pET28b, resulting in pMSP7515, and
prgB was then cloned behind it, creating pMSP7516. The
nisA promoter-prgB construct was cloned as a
BglII-XhoI fragment into plasmid pMSP3535,
resulting in the final pMSP7517 construct. (B) Sequence of pMSP7517
from the nisA promoter 10 region to the start codon of
prgB. The 10 region and the RBS are boxed; the boldfaced G
indicates the base change in the RBS (see Materials and Methods). The
double underline designates the prgB start codon. The arrow
marks the transcription start site (10).
|
|
The complete
nisA promoter-
prgB fragment
from pMSP7516 was cloned into pMSP3535 by
BglII-
XhoI restriction to generate pMSP7517.
That
plasmid was transformed into
E. faecalis OG1SSp,
L. lactis NZ9800, and
S. gordonii DL1
(Challis).
Expression of AS in E. faecalis and heterologous
hosts.
The expression of AS under the control of the
nisA promoter in E. faecalis, L. lactis, and S. gordonii was investigated by Western
blot analysis of cell surface extracts with anti-AS antibodies. We
compared levels of nisin-induced expression to those induced by sex
pheromone cCF10 in E. faecalis. To determine the optimal nisin concentration for induction, the three species were grown in
media containing various concentrations of nisin in the
nanogram-per-milliliter range. E. faecalis (Fig.
2A) showed good expression of AS upon nisin induction, with a maximum effective nisin concentration of 25 ng/ml. AS expression from this promoter was not detected in the absence
of nisin. The induced cells demonstrated a very distinct ability to
form aggregates, confirming that AS is sufficient for formation of
tight junctions between the cells.

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of AS from pMSP7517. Western blot analysis
was performed with a polyclonal antibody specific to AS. The protein
concentrations in all lanes are identical. (A) E. faecalis
OG1SSp(pMSP7517). (B) L. lactis (pMSP7517). (C) S. gordonii(pMSP7517). Lanes 1, OG1SSp(pCF10) induced with cCF10 (10 ng/ml); lanes 2, no nisin; lanes 3, nisin at 1 (A and B) or 0.5 (C)
ng/ml; lanes 4, nisin at 5 (A and B) or 1 (C) ng/ml; lanes 5, nisin at
10 (A and B) or 2.5 (C) ng/ml; lanes 6, nisin at 25 (A and B) or 5 (C)
ng/ml; lanes 7, nisin at 50 (A and B) or 10 (C) ng/ml; lanes 8, nisin
at 100 (A and B) or 25 (C) ng/ml; lanes 9, nisin at 1,000 (A and B) or
50 (C) ng/ml.
|
|
L. lactis, not surprisingly, showed good inducible AS
expression (Fig.
2B). In comparison to
E. faecalis, larger
amounts of
protein were produced. In addition, there was no drop-off in
promoter
activity above a nisin concentration of 25 ng/ml. Although the
Western analysis of
S. gordonii showed expression of AS, in
comparison
to the other two species the amounts were smaller, with
maximum
production at a nisin concentration of 5 ng/ml (Fig.
2C). We
also
transformed pMSP7517 into
Bacillus subtilis; however,
AS expression
was only barely detectable and appeared to be
constitutive (data
not shown). Also noteworthy is the difference in the
AS banding
patterns of the various strains. In
E. faecalis,
the 78-kDa form
of AS was detectable at a nisin concentration of 5 ng/ml (Fig.
2A, lane 4), whereas in
L. lactis this form was
observed only
at a nisin concentration of at least 25 ng/ml (Fig.
2B,
lane 6).
There appeared to be less degradation of the mature form of AS
in
L. lactis than in
E. faecalis, for which the
laddering was
more abundant.
S. gordonii showed very little
degradation, which
could be partly due to the lower level of AS
expressed in this
species.
Electron microscopy of nisin-induced cells.
Scanning electron
microscopy was performed to determine if AS was correctly displayed on
the cell surface. A monoclonal anti-Asc10 antibody was used for
labeling, along with a 12-nm-diameter gold particle-labeled secondary
antibody. Labeling was successful with E. faecalis and
L. lactis expressing AS, as shown in Fig.
3B and C, respectively. Interestingly,
nisin-induced S. gordonii(pMSP7517) carried no gold label
(data not shown), suggesting that AS was not correctly expressed on the
cell surface of this species. The distributions of AS on the cell
surfaces of E. faecalis(pMSP7517) and L. lactis
were not significantly different from that on wild-type E. faecalis(pCF10) cells induced by cCF10 (Fig. 3A). Uninduced wild-type or pMSP7517-carrying cells did not show gold labeling [Fig.
3D, OG1SSp(pMSP7517)].

View larger version (152K):
[in this window]
[in a new window]
|
FIG. 3.
Electron microscopy of AS-expressing cells. A primary
mouse monoclonal antibody against AS was used, followed by a
12-nm-diameter gold particle-labeled secondary antibody (see Materials
and Methods). (A) E. faecalis(pCF10), cCF10 induced. (B)
E. faecalis(pMSP7517) induced with nisin at 25 ng/ml. (C)
L. lactis(pMSP7517) induced with nisin at 25 ng/ml. (D)
E. faecalis(pMSP7517), no nisin induction. Scale bars, 0.5 µm.
|
|
AS in the culture supernatant.
The surprising finding that
S. gordonii did not display AS on the cell surface led us to
investigate whether AS is secreted into the culture medium differently
in various species. To investigate this possibility, the culture
supernatants of all species were ethanol precipitated and subjected to
PAGE and Western blot analyses. Surprisingly, E. faecalis,
L. lactis, and S. gordonii all showed AS in their
culture supernatants (Fig. 4), suggesting
that not all of the produced protein is efficiently anchored in the
cell wall and that considerable amounts are released into the growth medium. Although this result could explain the lack of labeling for AS
on the cell surface of S. gordonii, the presence of similar amounts of AS in the supernatants of the other species argues against
there being a differential loss of AS into the medium. The supernatant
of an E. faecalis(pCF10) cell culture was also investigated
and was found to contain AS in comparable amounts (data not shown).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 4.
AS in the culture supernatant. A Western blot analysis
of culture supernatant of pCF10- or pMSP7517-carrying cells was
performed. Lanes: 1, surface extract of E. faecalis(pCF10),
cCF10 induced; 2 to 7, concentrated supernatants [lane 2, E. faecalis(pMSP7517), nisin induced; lane 3, E. faecalis(pMSP7517), uninduced; lane 4, L. lactis(pMSP7517), nisin induced; lane 5, L. lactis(pMSP7517), uninduced; lane 6, S. gordonii(pMSP7517), nisin induced; lane 7, S. gordonii(pMSP7517), uninduced].
|
|
Phenotypes of cells expressing AS.
An increase in cell
hydrophobicity due to expression of surface proteins is implicated in
many adhesion processes in gram-positive bacteria, especially among
oral streptococci (28). Therefore, we investigated the
influence of expression of AS on the cell surfaces of E. faecalis and L. lactis. A hydrophobicity assay performed with hexadecane showed a strong increase in cell surface hydrophobicity in E. faecalis(pMSP7517) if the cells were
induced by nisin (Table 2). A significant
increase in hydrophobicity was seen in nisin-induced, AS-expressing
L. lactis(pMSP7517). Pheromone cCF10-induced L. lactis(pCF10) cells also showed an increase in hydrophobicity.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Cell hydrophobicity and fibrin adhesion of E. faecalis(pMSP7517) and L. lactis(pMSP7517) strains
in comparison to wild-type OG1SSp(pCF10)
|
|
AS was shown previously to contribute to the severity of enterococcal
infective endocarditis (
4,
44). Adhesion to fibrin,
a
component of endocardial vegetations, could be one of the mechanisms
by
which AS increases virulence in this model system. A fibrin
adhesion
assay (Table
2) demonstrated that AS-expressing cells
of
E. faecalis adhere to the fibrin matrix two to three times
better
than non-AS-expressing cells. The assay with
E. faecalis cells is somewhat problematic due to the high level of aggregate
formation. Binding of the cells to each other instead of directly
to
the fibrin matrix may lead to an overestimation of the actual
number of
cells interacting with fibrin. The expression of AS
in
L. lactis, which shows no aggregation, allowed us to assess
the
actual contribution of AS to adherence of AS-expressing cells
to fibrin
without interference from cell self-aggregation. Fibrin
adhesion of
nisin-induced
L. lactis(pMSP7517) cells is also increased
around twofold in comparison to that of uninduced cells, demonstrating
the ability of AS to bind
fibrin.
The results obtained by electron microscopy as well as data obtained in
the cell hydrophobicity and fibrin binding assays
suggest that AS is
functionally expressed on the cell surface
if expressed from pMSP7517.
To investigate whether the expressed
AS is also functional in adherence
to
E. faecalis binding substance,
an assay making use of the
conjugative transposon Tn
925 in the
E. faecalis
donor strain INY1010 was employed. An 8-h coincubation
with
nisin-induced or uninduced recipient cells carrying pMSP7517
resulted
in transconjugants with a copy of the transposed Tn
925 appearing in the recipient cells. Results for mating of INY1010
with
E. faecalis or
L. lactis carrying pMSP7517 are
depicted in
Table
3. Transfer of
Tn
925 was increased in both species by about
100-fold if
nisin was added to induce AS expression, providing
a tight cell contact
between the mating partners. A mating between
INY1010 and
S. gordonii was also performed. However, the number
of
E. faecalis donor cells was reduced by 100-fold after 8 h in
comparison to the numbers obtained in the matings with the other
species, suggesting that an inhibitory product (potentially a
bacteriocin) was produced by
S. gordonii. When matings were
performed
at a donor-to-recipient ratio of 10:1, transconjugants were
recovered
only with nisin induction. Their numbers were very low (two
per
milliliter of culture medium), apparently approaching the limit
of
sensitivity for this assay. It is also noteworthy that visible
cell
aggregates with the heterologous host could be observed only
in induced
INY1010-
L. lactis(pMSP7517) cocultures.
 |
DISCUSSION |
AS of the enterococcal sex pheromone plasmids is a large surface
protein induced by peptide pheromones produced by plasmid-free recipient cells. The presence of two RGD sequences in the protein, as
well as data from several previous studies, suggests the involvement of
the protein in virulence of the nosocomial pathogen E. faecalis. The AS structural gene size (~3.8 kb) and complex
regulation provide sizable obstacles to a detailed characterization of
the protein. So far, only deletion analysis of fairly large stretches
of the protein has been accomplished (38). A further
restriction for the analysis of AS, especially in terms of adherence to
eucaryotic extracellular matrix proteins or cells, is the inherent
function of the protein, the formation of tight aggregates between
E. faecalis cells, thus potentially providing false-positive
results in adherence assays.
An inducible system with an AS, readily manipulable in a defined
background, is therefore highly desirable for use in our efforts to
understand the structure and function of AS. We successfully adapted
the nisin-inducible promoter system for this purpose. The AS gene was
cloned behind the nisA promoter and placed in the shuttle
vector pMSP3535. The resulting construct, pMSP7517, was introduced into
E. faecalis, L. lactis, and S. gordonii. Induction with nisin resulted in the expected formation
of E. faecalis cell aggregates, whereas the other species
did not show any aggregation. This result confirms that AS is the only
factor on the surface of the donor cells that is needed for aggregate
formation, and it confirms the specificity of AS for the E. faecalis cell surface for recognition.
Immunoblot analysis of cells expressing AS showed that the previously
described linearity of the nisA promoter (11) is
only in effect in L. lactis over the tested range. AS
expression in E. faecalis reaches a maximum at a nisin
concentration of around 25 ng/ml and falls off at higher
concentrations, whereas in S. gordonii the maximum is
reached at 5 ng/ml and there is no significant increase or decrease at
higher concentrations. It is also notable that the minimum
concentration of nisin necessary for detectable AS expression ranges
from 0.5 ng in S. gordonii and 1 ng in L. lactis
to around 5 ng in E. faecalis. A slight amount of uninduced AS expression can also be observed in S. gordonii. The size
of the produced protein is indistinguishable from that of AS isolated from cCF10-induced enterococcal cells carrying pCF10.
The correct display of the expressed AS was investigated by electron
microscopy. S. gordonii surprisingly did not show any labeling, suggesting that AS is not expressed on the surface of that
bacterium. E. faecalis and L. lactis were equally
well labeled when AS was induced. These results led us to question
whether AS is secreted and is not anchored correctly in the S. gordonii cell wall. However, AS was present in the culture
supernatants of all three species upon nisin induction. This result
showed that although AS was produced and obviously directed to the cell surface in S. gordonii, this apparently led to complete
secretion in this species, presumably due to insufficient anchoring of
AS in the cell wall. Secretion of the protein does not lead invariably to a loss of surface labeling with the AS antibody, as demonstrated by
the presence of the protein in supernatants and on the cell surfaces of
E. faecalis and L. lactis. The substantial
amounts of AS present in the supernatants of these two species suggest that a limit to assembly into the cell wall may exist, with the excess
protein being secreted.
Hydrophobicity can contribute to adherence and attachment of bacteria
(28). Upon induction of E. faecalis(pCF10) with
cCF10, the hydrophobicity of the cells increased considerably. AS is not the only surface protein induced by cCF10; Sec10, the surface exclusion protein, is also upregulated (29) and may
contribute to the increased hydrophobicity. The expression of AS on
cells carrying plasmid pMSP7517 alone shows that the protein
contributes to the increase in the surface hydrophobicity of E. faecalis and L. lactis. This high-level hydrophobicity
of the cells is, however, apparently not involved in aggregate
formation, since L. lactis expressing AS does not show any
aggregation unless E. faecalis is present in coculture.
Enterococci are commonly isolated in cases of infective endocarditis
(36), and sex pheromone plasmids are present at an increased
frequency in endocarditis-associated isolates (8). Adherence
of bacteria to fibrin (1) can contribute to virulence in
endocarditis. Our adherence assays demonstrate binding of AS-expressing bacteria to fibrin and show the advantage of expressing AS in a
heterologous host. Aggregate formation by E. faecalis cells can interfere with the outcome of the assay. This effect is evidenced by the higher degree of variation in numbers of adhesive cells seen
with E. faecalis(pMSP7517). The expression of AS from
pMSP7517 in L. lactis, however, allows a clear demonstration
of the fibrin-binding capability of AS, increasing the adherence by a
factor of two. Similar values were found recently for adherence of
S. gordonii CshA fibrils to fibronectin (35).
AS-mediated binding of E. faecalis cells to fibrin could
therefore help this bacterium establish itself on an endocardial
vegetation. Interestingly, the number of adherent OG1SSp(pCF10) cells
did not significantly change with induction by cCF10. The number of
adherent uninduced OG1SSp(pCF10) cells was larger than the number of
adherent OG1SSp(pMSP7517) cells not expressing AS. This effect could be
due to the surface exclusion protein Sec10, which is constitutively
expressed but upregulated upon cCF10 induction (16). The
Sec10 protein has so far been neglected in studies of virulence. This
protein may form a coiled-coil structure (29, 50), and
moderate similarity to a Streptococcus pyogenes
fibrinogen-binding protein (22% identity, 36% similar residues
[47]) suggests that it may also contribute to
enterococcal virulence.
Further confirmation that AS is functionally expressed on E. faecalis and L. lactis cells carrying pMSP7517 came
from the transfer of the conjugative transposon Tn925 into
cells that had not or had been induced with nisin, respectively.
Transfer of Tn925 into E. faecalis(pMSP7517) as well as L. lactis
(pMSP7517) increased around 100-fold upon nisin induction.
This clearly demonstrates that AS is functionally expressed and
displayed in both its homologous host, E. faecalis, and the
heterologous bacterium L. lactis. The correct folding of the
protein for the recognition of its cognate binding substance suggests
that the overall structures of AS in E. faecalis and
L. lactis are identical. Bactericidal activity of S. gordonii toward the E. faecalis Tn925 donor
strain did not allow us to determine the function of AS in this species.
The expression of gram-positive cell surface adhesin in heterologous
hosts has become a valuable tool, especially for surface proteins of
oral streptococci, with E. faecalis and L. lactis serving as host species (26, 35). Our results confirm that AS is the sole factor required for aggregation and that it is specific
for enterococcal binding substance. In addition, AS was successfully
expressed on the L. lactis cell surface, increasing the cell
surface hydrophobicity and enhancing adherence to fibrin. Both of these
phenotypes strongly suggest a contribution of AS proteins to the
virulence of E. faecalis.
 |
ACKNOWLEDGMENTS |
We thank Chris Frethem and Muriel Gavin for excellent technical
assistance and Michiel Kleerebezem for providing plasmids pNZ9531 and pNZ8048.
This work was supported by NIH grant HL51987.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, University of Minnesota Medical School, Box 196 FUHC,
1460 Mayo Memorial Building, 420 Delaware St. S.E., Minneapolis, MN 55455. Phone: (612) 625-9930. Fax: (612) 626-0623. E-mail:
gary-d{at}biosci.cbs.umn.edu.
 |
REFERENCES |
| 1.
|
Bancsi, M. J. L. M. F.,
M. H. A. M. Veltrop,
R. M. Bertina, and J. Thompson.
1996.
Role of phagocytosis in activation of the coagulation system in Streptococcus sanguis endocarditis.
Infect. Immun.
64:5166-5170[Abstract].
|
| 2.
|
Bensing, B. A.,
D. A. Manias, and G. M. Dunny.
1997.
Pheromone cCF10 and plasmid pCF10-encoded regulatory molecules act post-transcriptionally to activate expression of downstream conjugation functions.
Mol. Microbiol.
24:285-294[CrossRef][Medline].
|
| 3.
|
Buckley, N. D.,
L. N. Lee, and D. J. LeBlanc.
1995.
Use of a novel mobilizable vector to inactivate the scrA gene of Streptococcus sobrinus by allelic replacement.
J. Bacteriol.
177:5028-5034[Abstract/Free Full Text].
|
| 4.
|
Chow, J. W.,
L. A. Thal,
M. B. Perri,
J. A. Vazquez,
S. M. Donabedian,
D. B. Clewell, and M. J. Zervos.
1993.
Plasmid-associated hemolysin and aggregation substance production contribute to virulence in experimental enterococcal endocarditis.
Antimicrob. Agents Chemother.
37:2474-2477[Abstract/Free Full Text].
|
| 5.
|
Christie, P. J.,
S.-M. Kao,
J. C. Adsit, and G. M. Dunny.
1988.
Cloning and expression of genes encoding pheromone-inducible antigens of Enterococcus (Streptococcus) faecalis.
J. Bacteriol.
170:5161-5168[Abstract/Free Full Text].
|
| 6.
|
Chung, J. W., and G. M. Dunny.
1995.
Transcriptional analysis of a region of the Enterococcus faecalis plasmid pCF10 involved in positive regulation of conjugative transfer functions.
J. Bacteriol.
177:2118-2124[Abstract/Free Full Text].
|
| 7.
|
Clewell, D. B.
1990.
Movable genetic elements and antibiotic resistance in enterococci.
Eur. J. Clin. Microbiol. Infect. Dis.
9:90-102[CrossRef][Medline].
|
| 8.
|
Coque, T. M.,
J. E. Patterson,
J. M. Steckelberg, and B. E. Murray.
1995.
Incidence of hemolysin, gelatinase, and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalized and community-based persons.
J. Infect. Dis.
171:1223-1229[Medline].
|
| 9.
|
de Freire Bastos, M. C.,
K. Tanimoto, and D. B. Clewell.
1997.
Regulation of transfer of the Enterococcus faecalis pheromone-responding plasmid pAD1: temperature-sensitive transfer mutants and identification of a new regulatory determinant, traD.
J. Bacteriol.
179:3250-3259[Abstract/Free Full Text].
|
| 10.
|
de Ruyter, P. G. G. A.,
O. P. Kuipers,
M. M. Beerthuyzen,
I. van Alen-Boerrigter, and W. M. de Vos.
1996.
Functional analysis of promoters in the nisin gene cluster of Lactococcus lactis.
J. Bacteriol.
178:3434-3439[Abstract/Free Full Text].
|
| 11.
|
de Ruyter, P. G. G. A.,
O. P. Kuipers, and W. M. de Vos.
1996.
Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin.
Appl. Environ. Microbiol.
62:3662-3667[Abstract].
|
| 12.
|
Dunny, G. M.,
B. L. Brown, and D. B. Clewell.
1978.
Induced cell aggregation and mating in Streptococcus faecalis: evidence for a bacterial sex pheromone.
Proc. Natl. Acad. Sci. USA
75:3479-3483[Abstract/Free Full Text].
|
| 13.
|
Dunny, G. M.,
L. N. Lee, and D. J. LeBlanc.
1991.
Improved electroporation and cloning vector system for gram-positive bacteria.
Appl. Environ. Microbiol.
57:1194-1201[Abstract/Free Full Text].
|
| 14.
|
Dunny, G. M.,
B. A. B. Leonard, and P. J. Hedberg.
1995.
Pheromone-inducible conjugation in Enterococcus faecalis: interbacterial and host-parasite chemical communication.
J. Bacteriol.
177:871-876[Free Full Text].
|
| 15.
|
Dunny, G. M.,
M. Yuhasz, and E. E. Ehrenfeld.
1982.
Genetic and physiological analysis of conjugation in Streptococcus faecalis.
J. Bacteriol.
151:855-859[Abstract/Free Full Text].
|
| 16.
|
Dunny, G. M.,
D. L. Zimmerman, and M. L. Tortorello.
1985.
Induction of surface exclusion (entry exclusion) by Streptococcus faecalis sex pheromones: use of monoclonal antibodies to identify an inducible surface antigen involved in the exclusion process.
Proc. Natl. Acad. Sci. USA
82:8582-8586[Abstract/Free Full Text].
|
| 17.
|
Ehrenfeld, E. E.,
R. E. Kessler, and D. B. Clewell.
1986.
Identification of pheromone-induced surface proteins in Streptococcus faecalis and evidence of a role for lipoteichoic acid in formation of mating aggregates.
J. Bacteriol.
168:6-12[Abstract/Free Full Text].
|
| 18.
|
Eichenbaum, Z.,
M. J. Federle,
D. Marra,
W. M. de Vos,
O. P. Kuipers,
M. Kleerebezem, and J. R. Scott.
1998.
Use of the lactococcal nisA promoter to regulate gene expression in gram-positive bacteria: comparison of induction level and promoter strength.
Appl. Environ. Microbiol.
64:2763-2769[Abstract/Free Full Text].
|
| 19.
|
Engelke, G.,
Z. Gutowski-Eckel,
P. Kiesau,
K. Siegers,
M. Hammelmann, and K.-D. Entian.
1994.
Regulation of nisin biosynthesis and immunity in Lactococcus lactis 6F3.
Appl. Environ. Microbiol.
60:814-825[Abstract/Free Full Text].
|
| 20.
|
Fiedler, S., and R. Wirth.
1988.
Transformation of bacteria with plasmid DNA by electroporation.
Anal. Biochem.
170:38-44[CrossRef][Medline].
|
| 21.
|
Galli, D.,
A. Friesenegger, and R. Wirth.
1992.
Transcriptional control of sex-pheromone-inducible genes on plasmid pAD1 of Enterococcus faecalis and sequence analysis of a third structural gene for (pPD1-encoded) aggregation substance.
Mol. Microbiol.
6:1297-1308[Medline].
|
| 22.
|
Galli, D.,
F. Lottspeich, and R. Wirth.
1990.
Sequence analysis of Enterococcus faecalis aggregation substance encoded by the sex pheromone plasmid pAD1.
Mol. Microbiol.
4:895-904[CrossRef][Medline].
|
| 23.
|
Galli, D., and R. Wirth.
1991.
Comparative analysis of Enterococcus faecalis sex pheromone plasmids identifies a single homologous DNA region which codes for aggregation substance.
J. Bacteriol.
173:3029-3033[Abstract/Free Full Text].
|
| 24.
|
Galli, D.,
R. Wirth, and G. Wanner.
1989.
Identification of aggregation substances of Enterococcus faecalis cells after induction by sex pheromones. An immunological and ultrastructural investigation.
Arch. Microbiol.
151:486-490[CrossRef][Medline].
|
| 25.
|
Hirt, H.,
G. Wanner,
D. Galli, and R. Wirth.
1993.
Biochemical, immunological and ultrastructural characterization of aggregation substances encoded by Enterococcus faecalis sex-pheromone plasmids.
Eur. J. Biochem.
211:711-716[Medline].
|
| 26.
|
Holmes, A. R.,
C. Gilbert,
J. M. Wells, and H. F. Jenkinson.
1998.
Binding properties of Streptococcus gordonii SspA and SspB (antigen I/II family) polypeptides expressed on the cell surface of Lactococcus lactis MG1363.
Infect. Immun.
66:4633-4639[Abstract/Free Full Text].
|
| 27.
|
Holo, H., and I. F. Nes.
1995.
Transformation of Lactococcus by electroporation.
Methods Mol. Biol.
47:195-199[Medline].
|
| 28.
|
Jenkinson, H. F., and R. J. Lamont.
1997.
Streptococcal adhesion and colonization.
Crit. Rev. Oral Biol. Med.
8:175-200[Abstract/Free Full Text].
|
| 29.
|
Kao, S.-M.,
S. B. Olmsted,
A. S. Viksnins,
J. C. Gallo, and G. M. Dunny.
1991.
Molecular and genetic analysis of a region of plasmid pCF10 containing positive control genes and structural genes encoding surface proteins involved in pheromone-inducible conjugation in Enterococcus faecalis.
J. Bacteriol.
173:7650-7664[Abstract/Free Full Text].
|
| 30.
|
Kleerebezem, M.,
W. M. de Vos, and O. P. Kuipers.
1999.
The lantibiotics nisin and subtilin act as extracellular regulators of their own biosynthesis, p. 159-174.
In
G. M. Dunny, and S. C. Winans (ed.), Cell-cell signaling in bacteria. ASM Press, Washington, D.C.
|
| 31.
|
Kreft, B.,
R. Marre,
U. Schramm, and R. Wirth.
1992.
Aggregation substance of Enterococcus faecalis mediates adhesion to cultured renal tubular cells.
Infect. Immun.
60:25-30[Abstract/Free Full Text].
|
| 32.
|
Kuipers, O. P.,
M. M. Beerthuyzen,
P. G. de Ruyter,
E. J. Luesink, and W. M. de Vos.
1995.
Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction.
J. Biol. Chem.
270:27299-27304[Abstract/Free Full Text].
|
| 33.
|
Kuipers, O. P.,
M. M. Beerthuyzen,
R. J. Siezen, and W. M. de Vos.
1993.
Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity.
Eur. J. Biochem.
216:281-291[Medline].
|
| 34.
|
Leonard, B. A.,
A. Podbielski,
P. J. Hedberg, and G. M. Dunny.
1996.
Enterococcus faecalis pheromone binding protein, PrgZ, recruits a chromosomal oligopeptide permease system to import sex pheromone cCF10 for induction of conjugation.
Proc. Natl. Acad. Sci. USA
93:260-264[Abstract/Free Full Text].
|
| 35.
|
McNab, R.,
H. Forbes,
P. S. Handley,
D. M. Loach,
G. W. Tannock, and H. F. Jenkinson.
1999.
Cell wall-anchored CshA polypeptide (259 kilodaltons) in Streptococcus gordonii forms surface fibrils that confer hydrophobic and adhesive properties.
J. Bacteriol.
181:3087-3095[Abstract/Free Full Text].
|
| 36.
|
Megran, D. W.
1992.
Enterococcal endocarditis.
Clin. Infect. Dis.
15:63-71[Medline].
|
| 37.
|
Muscholl, A.,
D. Galli,
G. Wanner, and R. Wirth.
1993.
Sex pheromone plasmid pAD1-encoded aggregation substance of Enterococcus faecalis is positively regulated in trans by traE1.
Eur. J. Biochem.
214:333-338[Medline].
|
| 38.
|
Muscholl-Silberhorn, A.
1998.
Analysis of the clumping-mediating domain(s) of sex pheromone plasmid pAD1-encoded aggregation substance.
Eur. J. Biochem.
258:515-520[Medline].
|
| 39.
|
Navarre, W. W., and O. Schneewind.
1999.
Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope.
Microbiol. Mol. Biol. Rev.
63:174-229[Abstract/Free Full Text].
|
| 40.
|
Olmsted, S. B.,
S. L. Erlandsen,
G. M. Dunny, and C. L. Wells.
1993.
High-resolution visualization by field emission scanning electron microscopy of Enterococcus faecalis surface proteins encoded by the pheromone-inducible conjugative plasmid pCF10.
J. Bacteriol.
175:6229-6237[Abstract/Free Full Text].
|
| 41.
|
Pakula, R., and W. Walczak.
1963.
On the nature of competence of transformable streptococci.
J. Gen. Microbiol.
31:125-133[Abstract/Free Full Text].
|
| 42.
|
Rosenberg, M.,
D. Gutnick, and E. Rosenberg.
1980.
Adherence of bacteria to hydrocarbons: a simple method for measuring cell-surface hydrophobicity.
FEMS Microbiol. Lett.
9:29-33[CrossRef].
|
| 43.
|
Ruoslahti, E.
1996.
RGD and other recognition sequences for integrins.
Annu. Rev. Cell Dev. Biol.
12:697-715[CrossRef][Medline].
|
| 44.
|
Schlievert, P. M.,
P. J. Gahr,
A. P. Assimacopoulos,
M. M. Dinges,
J. A. Stoehr,
J. W. Harmala,
H. Hirt, and G. M. Dunny.
1998.
Aggregation and binding substances enhance pathogenicity in rabbit models of Enterococcus faecalis endocarditis.
Infect. Immun.
66:218-223[Abstract/Free Full Text].
|
| 45.
|
Shah, G. R., and P. W. Caufield.
1993.
Enhanced transformation of Streptococcus mutans by modifications in culture conditions.
Anal. Biochem.
214:343-346[CrossRef][Medline].
|
| 46.
|
Stenberg, L.,
P. O'Toole, and G. Lindahl.
1992.
Many group A streptococcal strains express two different immunoglobulin-binding proteins, encoded by closely linked genes: characterization of the proteins expressed by four strains of different M-type.
Mol. Microbiol.
6:1185-1194[CrossRef][Medline].
|
| 47.
|
Tanimoto, K., and D. B. Clewell.
1993.
Regulation of the pAD1-encoded sex pheromone response in Enterococcus faecalis: expression of the positive regulator TraE1.
J. Bacteriol.
175:1008-1018[Abstract/Free Full Text].
|
| 48.
|
Trotter, K. M.
1990.
Ph.D. thesis.
Cornell University, Ithaca, N.Y.
|
| 49.
|
Wanner, G.,
H. Formanek,
D. Galli, and R. Wirth.
1989.
Localization of aggregation substances of Enterococcus faecalis after induction by sex pheromones: an ultrastructural comparison using immuno labelling, transmission and high resolution scanning electron microscopic techniques.
Arch. Microbiol.
151:491-497[CrossRef][Medline].
|
| 50.
|
Weidlich, G.,
R. Wirth, and D. Galli.
1992.
Sex pheromone plasmid pAD1-encoded surface exclusion protein of Enterococcus faecalis.
Mol. Gen. Genet.
233:161-168[CrossRef][Medline].
|
| 51.
|
Wirth, R.
1994.
The sex pheromone system of Enterococcus faecalis. More than just a plasmid-collection mechanism?
Eur. J. Biochem.
222:235-246[Medline].
|
Journal of Bacteriology, April 2000, p. 2299-2306, Vol. 182, No. 8
0021-9193/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Macintosh, R. L., Brittan, J. L., Bhattacharya, R., Jenkinson, H. F., Derrick, J., Upton, M., Handley, P. S.
(2009). The Terminal A Domain of the Fibrillar Accumulation-Associated Protein (Aap) of Staphylococcus epidermidis Mediates Adhesion to Human Corneocytes. J. Bacteriol.
191: 7007-7016
[Abstract]
[Full Text]
-
Jakubovics, N. S., Brittan, J. L., Dutton, L. C., Jenkinson, H. F.
(2009). Multiple adhesin proteins on the cell surface of Streptococcus gordonii are involved in adhesion to human fibronectin. Microbiology
155: 3572-3580
[Abstract]
[Full Text]
-
Chen, Y., Zhang, X., Manias, D., Yeo, H.-J., Dunny, G. M., Christie, P. J.
(2008). Enterococcus faecalis PcfC, a Spatially Localized Substrate Receptor for Type IV Secretion of the pCF10 Transfer Intermediate. J. Bacteriol.
190: 3632-3645
[Abstract]
[Full Text]
-
Dufour, M., Manson, J. M., Bremer, P. J., Dufour, J.-P., Cook, G. M., Simmonds, R. S.
(2007). Characterization of Monolaurin Resistance in Enterococcus faecalis. Appl. Environ. Microbiol.
73: 5507-5515
[Abstract]
[Full Text]
-
Hirt, H., Manias, D. A., Bryan, E. M., Klein, J. R., Marklund, J. K., Staddon, J. H., Paustian, M. L., Kapur, V., Dunny, G. M.
(2005). Characterization of the Pheromone Response of the Enterococcus faecalis Conjugative Plasmid pCF10: Complete Sequence and Comparative Analysis of the Transcriptional and Phenotypic Responses of pCF10-Containing Cells to Pheromone Induction. J. Bacteriol.
187: 1044-1054
[Abstract]
[Full Text]
-
Stentz, R., Jury, K., Eaton, T., Parker, M., Narbad, A., Gasson, M., Shearman, C.
(2004). Controlled expression of CluA in Lactococcus lactis and its role in conjugation. Microbiology
150: 2503-2512
[Abstract]
[Full Text]
-
Waters, C. M., Wells, C. L., Dunny, G. M.
(2003). The Aggregation Domain of Aggregation Substance, Not the RGD Motifs, Is Critical for Efficient Internalization by HT-29 Enterocytes. Infect. Immun.
71: 5682-5689
[Abstract]
[Full Text]
-
Xin, K.-Q., Hoshino, Y., Toda, Y., Igimi, S., Kojima, Y., Jounai, N., Ohba, K., Kushiro, A., Kiwaki, M., Hamajima, K., Klinman, D., Okuda, K.
(2003). Immunogenicity and protective efficacy of orally administered recombinant Lactococcus lactis expressing surface-bound HIV Env. Blood
102: 223-228
[Abstract]
[Full Text]
-
Waters, C. M., Antiporta, M. H., Murray, B. E., Dunny, G. M.
(2003). Role of the Enterococcus faecalis GelE Protease in Determination of Cellular Chain Length, Supernatant Pheromone Levels, and Degradation of Fibrin and Misfolded Surface Proteins. J. Bacteriol.
185: 3613-3623
[Abstract]
[Full Text]
-
Antiporta, M. H., Dunny, G. M.
(2002). ccfA, the Genetic Determinant for the cCF10 Peptide Pheromone in Enterococcus faecalis OG1RF. J. Bacteriol.
184: 1155-1162
[Abstract]
[Full Text]
-
Ribeiro, L. A., Azevedo, V., Le Loir, Y., Oliveira, S. C., Dieye, Y., Piard, J.-C., Gruss, A., Langella, P.
(2002). Production and Targeting of the Brucella abortus Antigen L7/L12 in Lactococcus lactis: a First Step towards Food-Grade Live Vaccines against Brucellosis. Appl. Environ. Microbiol.
68: 910-916
[Abstract]
[Full Text]
-
Hirt, H., Schlievert, P. M., Dunny, G. M.
(2002). In Vivo Induction of Virulence and Antibiotic Resistance Transfer in Enterococcus faecalis Mediated by the Sex Pheromone-Sensing System of pCF10. Infect. Immun.
70: 716-723
[Abstract]
[Full Text]
-
Waters, C. M., Dunny, G. M.
(2001). Analysis of Functional Domains of the Enterococcus faecalis Pheromone-Induced Surface Protein Aggregation Substance. J. Bacteriol.
183: 5659-5667
[Abstract]
[Full Text]
-
McCormick, J. K., Hirt, H., Waters, C. M., Tripp, T. J., Dunny, G. M., Schlievert, P. M.
(2001). Antibodies to a Surface-Exposed, N-terminal Domain of Aggregation Substance Are Not Protective in the Rabbit Model of Enterococcus faecalis Infective Endocarditis. Infect. Immun.
69: 3305-3314
[Abstract]
[Full Text]
-
Wells, C. L., Moore, E. A., Hoag, J. A., Hirt, H., Dunny, G. M., Erlandsen, S. L.
(2000). Inducible Expression of Enterococcus faecalis Aggregation Substance Surface Protein Facilitates Bacterial Internalization by Cultured Enterocytes. Infect. Immun.
68: 7190-7194
[Abstract]
[Full Text]
-
Mundy, L. M., Sahm, D. F., Gilmore, M.
(2000). Relationships between Enterococcal Virulence and Antimicrobial Resistance. Clin. Microbiol. Rev.
13: 513-522
[Abstract]
[Full Text]